Space chip and preparation method and application thereof

Abstract

The invention relates to the technical field of biology, and provides a space chip and a preparation method and application thereof. The preparation method of the space chip comprises the following steps: synthesizing first single-stranded nucleotide libraries with bar code sequences, wherein different first single-stranded nucleotide libraries have different nucleotide sequences; fixing the first single-stranded nucleotide library on the surface of a solid-phase substrate, and amplifying the first single-stranded nucleotide library to obtain an amplified cluster; carrying out linearization treatment on the amplification cluster to obtain a single-stranded nucleic acid amplification cluster; and sequencing the single-stranded nucleic acid amplification cluster to obtain the sequence and physical coordinates of the bar code sequence to obtain the space chip.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a space chip and a preparation method and application thereof. Background Art

[0002] Spatial omics refers to a research method that combines omics with spatial information. In omics, the research objects can be biological molecules such as genes, proteins, metabolites, and spatial information refers to the distribution and interaction of these molecules in cells, tissues and organs. Spatial omics technology can simultaneously obtain the spatial location information and multi-omics data of the research. By analyzing these high-dimensional data, the structure and function of biological systems can be explained, and it provides important research methods for many fields such as tissue cell function, microenvironment interaction, developmental lineage tracing, disease pathology, etc., thereby providing new ideas and methods for disease diagnosis, treatment and drug development. However, there is currently no universal spatial chip that is convenient for personalized scientific research. Therefore, it is very important to develop a universal spatial omics chip that can study transcriptomes, proteomes and ATAC (Assay for Targeting Accessible-Chromatin) sequencing and other studies. Summary of the Invention

[0003] The purpose of the embodiments of the present application is to provide a spatial chip and a preparation method thereof, so as to form a single-stranded nucleic acid amplification cluster having a barcode sequence and physical coordinates on the surface of the spatial chip, and the barcode sequence and the physical coordinates of the single-stranded nucleic acid amplification cluster correspond one to one, so that when the chip is used as a spatial chip, it can perform a variety of omics analyses including genome, reverse transcriptase and proteome through known site information (including physical coordinates and the barcode sequence corresponding to each position), and is suitable for spatial information analysis in various omics fields.

[0004] Another purpose of the embodiments of the present application is to provide an application of a spatial chip in the field of spatial omics, a composition containing a spatial chip, a spatial reverse transcription method, an ATAC sequencing method, and a spatial protein analysis method.

[0005] To achieve the above application objectives, the technical solutions adopted in the embodiments of this application are as follows:

[0006] In a first aspect, a method for preparing a space chip comprises the following steps:

[0007] synthesizing a first single-stranded nucleotide library with a barcode sequence, wherein different first single-stranded nucleotide libraries have different nucleotide sequences, and the barcode sequence of each first single-stranded nucleotide library is different;

[0008] immobilizing the first single-stranded nucleotide library on a solid substrate surface, and amplifying the first single-stranded nucleotide library to obtain an amplified cluster;

[0009] linearizing the amplified cluster to obtain a single-stranded nucleic acid amplified cluster;

[0010] The single-stranded nucleic acid amplification cluster is sequenced to obtain the sequence and physical coordinates of the barcode sequence, and information on the one-to-one correspondence between the barcode sequence and the physical coordinates of each of the first single-stranded nucleotide libraries is obtained to obtain a spatial chip.

[0011] In a second aspect, a spatial chip comprises a chip substrate, wherein at least one surface of the chip substrate has a plurality of separated single-stranded nucleic acid amplification clusters, wherein the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and different single-stranded nucleic acid amplification clusters have different nucleotide sequences;

[0012] The single-stranded nucleic acid amplification cluster has known physical coordinates relative to the spatial chip, the single-stranded nucleic acid molecules include at least a barcode sequence with a known sequence, and the barcode sequence of each first single-stranded nucleic acid molecule corresponds one-to-one to the physical coordinates.

[0013] In the third aspect, the application of the spatial chip prepared by the method described in the first aspect or the spatial chip described in the second aspect in the field of spatial omics.

[0014] In a fourth aspect, a composition comprises a space chip, the space chip comprising a chip substrate, at least one surface of the chip substrate having a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters having the same nucleotide sequence, and different single-stranded nucleic acid amplification clusters having different nucleotide sequences;

[0015] The single-stranded nucleic acid amplification cluster has known physical coordinates relative to the spatial chip, and the single-stranded nucleic acid molecule includes a barcode sequence with a known sequence, and a first acquisition sequence and a second capture sequence respectively connected to the two ends of the barcode sequence, wherein the first acquisition sequence is connected to the surface of the chip substrate, and the barcode sequence of each of the first single-stranded nucleic acid molecules corresponds one to one to the physical coordinates.

[0016] A fifth aspect is a spatial reverse transcription method comprising the following steps:

[0017] A space chip and a second single-stranded nucleotide library are provided, wherein the space chip includes a chip substrate, at least one surface of the chip substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different, the single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first acquisition sequence and a second capture sequence respectively connected to both ends of the barcode sequence, the first acquisition sequence is connected to the surface of the chip substrate, and the barcode sequence of each first single-stranded nucleotide molecule corresponds to the physical coordinates one by one; the second single-stranded nucleotide library includes a first base sequence, a second base sequence, and a capture portion connected in sequence, the first base sequence is a known sequence complementary to the second capture sequence, the second base sequence is a tag sequence, and the capture portion is a primer sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the tag sequence is different;

[0018] contacting the cell or tissue sample to be tested with the spatial chip and the second single-stranded nucleotide library, so that RNA in the cell or tissue sample to be tested is bound to the spatial chip through the second single-stranded nucleotide library;

[0019] Excising the space chip and collecting the excision products;

[0020] The excision products are sequenced, and the obtained sequencing data are analyzed.

[0021] A sixth aspect provides an ATAC sequencing method, comprising the following steps:

[0022] A space chip and a second single-stranded nucleotide library are provided, wherein the space chip includes a chip substrate, at least one surface of the chip substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different, the single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first acquisition sequence and a second capture sequence respectively connected to both ends of the barcode sequence, the first acquisition sequence is connected to the surface of the chip substrate, and the barcode sequence of each first single-stranded nucleotide molecule corresponds to the physical coordinates one by one; the second single-stranded nucleotide library includes a first base sequence, a second base sequence, and a capture portion, the first base sequence is a known sequence, the second base sequence is a tag sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the tag sequence is different, the capture portion is a transposase, and the first base sequence and the second base sequence are located in the transposase;

[0023] contacting the cell or tissue sample to be tested with the spatial chip and the second single-stranded nucleotide library, so that ATAC in the cell or tissue sample to be tested is bound to the spatial chip through the second single-stranded nucleotide library;

[0024] Excising the space chip and collecting the excision products;

[0025] The excision products are sequenced, and the obtained sequencing data are analyzed.

[0026] A seventh aspect is a method for spatial protein analysis, comprising the following steps:

[0027] A space chip and a second single-stranded nucleotide library are provided, wherein the space chip includes a chip substrate, at least one surface of the chip substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different, the single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first acquisition sequence and a second capture sequence respectively connected to both ends of the barcode sequence, the first acquisition sequence is connected to the surface of the chip substrate, and the barcode sequence of each first single-stranded nucleotide molecule corresponds to the physical coordinates one by one; the second single-stranded nucleotide library includes a first base sequence, a second base sequence and a capture portion connected in sequence, the first base sequence is a known sequence complementary to the second capture sequence, the second base sequence is a tag sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the tag sequence is different;

[0028] contacting a cell or tissue sample to be tested with the space chip and the second single-stranded nucleotide library, so that the target in the sample to be tested that is bindable to the capture portion is bound to the space chip through the second single-stranded nucleotide library;

[0029] Excising the space chip and collecting the excision products;

[0030] The excision products are sequenced, and the obtained sequencing data are analyzed.

[0031] The spatial chip and its preparation method provided herein have barcode sequences on their surface that correspond one-to-one with the locations of nucleic acid clusters. Thus, when using the spatial chip for spatial omics applications, nucleic acid molecules released from the spatial chip can be used to capture samples such as cells and tissues in situ, and then spatially restore them using the barcode sequences on the nucleic acid molecules to obtain spatial omics information. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the embodiments or descriptions of the prior art. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0033] Figure 1 This is a schematic diagram of a space chip provided in an embodiment of the present application;

[0034] Figure 2 This is an array distribution diagram provided by an embodiment of the present application;

[0035] Figure 3 This is an array distribution diagram provided by an embodiment of the present application;

[0036] Figure 4 This is a schematic diagram of a space chip provided in an embodiment of the present application;

[0037] Figure 5 This is a schematic diagram of a space chip provided in an embodiment of the present application;

[0038] Figure 6 Schematic diagram of the composition of the single-stranded nucleic acid molecule and the second single-stranded nucleotide library provided in the examples of the present application;

[0039] Figure 7 This is the sequencing base distribution map provided in Example 1 of the present application;

[0040] Figure 8 This is a graph showing the analysis results of the spatial transcriptome clustering data of the spatial omics chip provided in Example 2 of the present application;

[0041] Figure 9 This is a fluorescence detection diagram of the chip surface provided in Example 3 of the present application;

[0042] Figure 10 This is a nucleic acid fragment analysis diagram provided in Example 4 of the present application;

[0043] Figure 11 This is a statistical graph of bin 50 μm data in the Free RNA spatial capture method provided in Example 5 of the present application;

[0044] Figure 12 This is a visual effect diagram obtained by performing data restoration on bin 50 μm in the Free RNA spatial capture method provided in Example 5 of the present application;

[0045] Figure 13 This is a fluorescence detection diagram of the chip surface provided in Example 5 of the present application. DETAILED DESCRIPTION

[0046] In order to make the technical problems, technical solutions and beneficial effects to be solved by this application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not intended to limit this application.

[0047] In this application, the terms used in the embodiments of this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The term "and / or" describes the association relationship between associated objects and indicates that three relationships can exist. For example, A and / or B can represent: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " in "and / or" indicates that the associated objects are in an "and" relationship.

[0048] The term "at least one" refers to one or more, and "plurality" refers to two or more. "At least one" or similar expressions refer to any combination of these items, including any combination of a single item or multiple items. For example, "at least one of a, b, or c", or "at least one of a, b and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be a single item or multiple items, respectively.

[0049] As used in the embodiments of the present application and the appended claims, the singular forms "a," "an," "said," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0050] The terms "first" and "second" are used for descriptive purposes only to distinguish purposes such as substances, directions, interfaces, messages, requests, and terminals from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. For example, without departing from the scope of the embodiments of the present application, the first imaging process may also be referred to as the second imaging process, and similarly, the second imaging process may also be referred to as the first imaging process. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of such features.

[0051] In the description of this application, the concentrations of the relevant components mentioned not only refer to the specific content of each component, but also represent the proportional relationship between the contents of each component. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced in accordance with the embodiment description of this application, it is within the scope disclosed in the embodiment description of this application.

[0052] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution. Some or all of the steps can be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0053] In the embodiments of the present application, the term "sequencing" may also be referred to as "nucleic acid sequencing" or "gene sequencing", i.e., the three terms are interchangeable in terms of expression, and refer to the determination of the types and order of bases in a nucleic acid sequence, including the process of binding nucleotides (including nucleotide analogs) to a template and collecting the corresponding signals emitted by the nucleotides (including analogs). "Sequencing" methods include synthesis sequencing (sequencing by synthesis, SBS) and / or ligation sequencing (sequencing by ligation, SBL), including DNA sequencing and / or RNA sequencing, including long fragment sequencing and / or short fragment sequencing, and the so-called long fragments and short fragments are relative, such as nucleic acid molecules longer than 1Kb, 2Kb, 5Kb or 10Kb can be called long fragments, and those shorter than 1Kb or 800bp can be called short fragments; including double-end sequencing, single-end sequencing and / or paired-end sequencing, etc., and the so-called double-end sequencing or paired-end sequencing can refer to the reading of any two segments or two parts of the same nucleic acid molecule that do not completely overlap.

[0054] The term "nucleotide" means a molecule comprising a sugar and at least one phosphate group, and further comprising a nucleobase. Nucleotides include deoxyribonucleotides, modified deoxyribonucleotides, ribonucleotides, modified ribonucleotides, peptide nucleotides, modified peptide nucleotides, modified phosphate sugar backbone nucleotides, and mixtures thereof. Examples of nucleotides include adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxycytidine diphosphate (dCDP), deoxycytidine triphosphate (dCTP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGTP). DP), deoxyguanosine triphosphate (dGTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), and deoxyuridine triphosphate (dUTP).

[0055] As used herein, the term "nucleotide" is also intended to encompass any nucleotide analogs, which are nucleotides comprising a modified nucleobase, sugar, and / or phosphate moiety compared to a naturally occurring nucleotide. Exemplary modified nucleobases include inosine, xanthine (xathanine), hypoxanthine, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halouracil, 15-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, In some embodiments, the nucleotide analogs of the present invention can be substituted with 5'- 5'- phosphates.The nucleotide analogs of the present invention can be substituted with 5'- phosphates.The nucleotide analogs of the present invention can be substituted with 5'- phosphates.The nucleotide analogs of the present invention can be substituted with 5'- phosphates.

[0056] The term "nucleic acid molecule" refers to a polymeric form of nucleotides of any length and may include ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. The term may refer to single-stranded or double-stranded polynucleotides. The nucleotides in a nucleic acid molecule may include naturally occurring nucleotides and their functionally alternative analogs. Examples of analogs are capable of hybridizing to nucleic acids in a sequence-specific manner or serving as templates for the replication of a specific nucleotide sequence. Naturally occurring nucleotides typically have a backbone comprising a phosphodiester bond. Analog structures may have alternative backbone connections comprising any species known in the art. Naturally occurring nucleotides typically have deoxyribose (e.g., found in DNA) or ribose (e.g., found in RNA). Analog structures may have alternative sugar moieties, comprising any species known in the art. Nucleotides may include natural bases or non-natural bases. The bases in natural DNA may include one or more of adenine, thymine, cytosine, and / or guanine, and the bases of natural RNA may include one or more of adenine, uracil, cytosine, and / or guanine. Nucleotides may also use any unnatural bases or base analogs, such as locked nucleic acids (LNA) and bridged nucleic acids (BNA).

[0057] "Polynucleotide" refers to a molecule comprising a sequence of nucleotides bound to one another. A polynucleotide is a non-limiting example of a polymer. Examples of polynucleotides include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and their analogs. A polynucleotide can be a single-stranded sequence of nucleotides, such as RNA or single-stranded DNA; a double-stranded sequence of nucleotides, such as double-stranded DNA; or can comprise a mixture of single-stranded and double-stranded sequences of nucleotides. Double-stranded DNA (dsDNA) includes genomic DNA, as well as PCR and amplification products. Single-stranded DNA (ssDNA) can be converted to dsDNA and vice versa. A polynucleotide can include non-naturally occurring DNA, such as enantiomeric DNA. The following are examples of polynucleotides: a gene or gene fragment (e.g., a probe, primer, expressed sequence tag (EST) or serial analysis of gene expression (SAGE) tag), genomic DNA, a genomic DNA fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, synthetic polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, primers, or amplified copies of any of the foregoing.

[0058] The term "barcode sequence" refers to a segment of nucleotides within a nucleic acid molecule that has a unique sequence within a spatial chip and can be used to identify the nucleic acid, its characteristics, or operations performed on it. A barcode sequence can be a naturally occurring sequence or a synthetic sequence that does not occur naturally. For a population of nucleic acid clusters within a spatial chip, the barcode sequence within each cluster is unique.

[0059] The term "primer", also known as "probe", refers to an oligonucleotide or nucleic acid molecule that can hybridize with a target sequence of interest. In an embodiment, a primer acts as a substrate onto which nucleotides can be polymerized by a polymerase. For example, a primer can be used as a starting point for DNA or RNA synthesis. For example, a sequencing primer can hybridize with a synthetic nucleic acid template strand to initiate the synthesis of a new strand complementary to the synthetic nucleic acid template strand. A primer can include any combination of nucleotides or their analogs. In some instances, a primer is a single-stranded oligonucleotide or polynucleotide.

[0060] The term "linked" refers to the state in which two objects are joined, fastened, adhered, attached, or bound to each other. For example, a nucleic acid molecule can be attached to a material such as a gel or solid support via covalent or non-covalent bonds. Covalent bonds are characterized by the sharing of electron pairs between atoms; non-covalent bonds are chemical bonds that do not involve the sharing of electron pairs and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0061] The term "cleavage site" refers to a position in a nucleic acid molecule that is susceptible to bond breakage. The position may be specific for a particular chemical, enzymatic, or physical process that results in bond breakage. For example, the position may be an abasic nucleotide or a nucleotide having a base that is susceptible to removal to produce an abasic site. Examples of nucleotides susceptible to removal include uracil and 8-oxo-guanine. The position may also be at or near a recognition sequence for a restriction endonuclease, such as a nickase.

[0062] The term "cluster" refers to a population of nucleic acid molecules connected to a solid substrate surface to form a feature or site. The nucleic acid molecules in the nucleic acid molecule population are generally nucleic acid molecules with the same sequence, which are amplified or cloned to form a monoclonal cluster. For clusters that are not monoclonal, they are generally mainly composed of amplicons from the first nucleic acid and may also have low levels of contaminating amplicons from the second nucleic acid. For example, when cluster arrays are used in detection applications, an acceptable contamination level will be a level that does not affect the signal-to-noise ratio or resolution of the detection technology in an unacceptable manner. Therefore, apparent clonality is generally related to the specific use or application of the array prepared by the method set forth herein.

[0063] The present invention will be described below in conjunction with the above understanding.

[0064] The embodiment of the present application provides a space chip, combined with Figure 1-6 The space chip 10 includes a chip substrate 11, which is used to carry nucleic acid molecules and provide a reaction site for identification based on nucleic acid molecules, feature detection of nucleic acid molecules, and other operations occurring on nucleic acid molecules.

[0065] The chip substrate 11 is a solid-phase substrate, and the material can be selected from materials such as quartz, glass, crystal, silicon wafer, silicon nitride, silicon dioxide, etc., and can also be plastic, ceramic, PET (polyethylene terephthalate), PMMA (polymethyl methacrylate), hydrogel, metal or any other suitable material. The shape of the chip substrate 11 can be flexibly set, or it can have a special shape according to the material of the chip substrate 11. In one embodiment, the chip substrate 11 is a plane. In another embodiment, the chip substrate 11 can be a non-planar surface. Exemplarily, the chip substrate 11 is a microbead or a magnetic bead, in which case the chip substrate 11 is a curved surface such as a spherical surface or a hemispherical surface. Of course, based on the above two embodiments, the surface of the chip substrate 11 can be modified to form a modified substance containing, for example, a dendritic polymer on its surface. In this case, the surface may be a random surface containing ups and downs or unevenness.

[0066] When the chip substrate 11 is a plane, in some embodiments, the overall shape of the chip substrate 11 can be a rectangular, square, diamond, other polygonal, circular, elliptical or irregularly shaped sheet structure. In some embodiments, in order to match the structure of the fixture and / or instrument of most current space chips to accommodate and fix the chip substrate 11, the overall shape of the chip substrate 11 is set to a rectangular sheet structure. In addition, in some embodiments, the chip substrate 11 can be formed by intercepting the sequencing area after the entire sequencing chip is sequenced. Thus, the array chip with known site information in each chip substrate 11 (including the barcode sequence bound to each site in the chip substrate 11, and the physical coordinates of the barcode sequence) can be prepared in advance and in batches to achieve the preparation of the space chip. Based on the rectangular sequencing area of the common sequencing chip, the chip substrate 11 thus obtained can also be rectangular. It should be understood that the chip substrate 11 provided in the embodiment of the present application can be used as a sequencing carrier or as a carrier for other nucleic acid detection. Exemplarily, the source and chip characteristics of the chip substrate 11 are not strictly limited, including but not limited to sequencing chips (also called flow cells) provided by sequencing platforms such as Illumina, Zhenmai Bio, and BGI, sequencing beads provided by platforms such as Thermo Fisher and Ultima, gene chips provided by affymatrix, and other similar chip substrates.

[0067] In the embodiment of the present application, when the chip substrate 11 is planar as a whole, micro-nano holes, which can also be understood as depressions, can be formed on the chip substrate 11; or micro-nano pillars, which can also be understood as protrusions, can be formed on the surface of the chip substrate. There are no strict restrictions on the cross-sectional shapes of the micro-nano holes and nano pillars, and they can be circular, regular, rectangular, rhombus, elliptical, other polygons, especially regular polygons, or other non-track shapes. Among them, micro-nano holes refer to holes or depressions with an pore size of micrometers or nanometers, and nano pillars refer to columnar protrusions with a maximum radial dimension of the cross section of micrometers or nanometers. In some embodiments, the micro-nano holes or micro-nano pillars are distributed in an array on the surface of the chip substrate 11.

[0068] In one embodiment, the chip substrate 11 is made of a material with a light transmittance greater than or equal to 90%. This allows for detection of reactions or operations on the surface of the chip substrate 11 using existing sequencing methods based on optical signal detection. In theory, both surfaces of the chip substrate 11 can serve as detection or monitoring surfaces for optical signals, expanding the application of space chips.

[0069] In some embodiments, the thickness of the chip substrate 11 is 0.05 to 0.3 mm. For example, the thickness of the chip substrate 11 is 0.05 mm, 0.10 mm, 0.15 mm, 0.20 mm, 0.25 mm, 0.30 mm, and the like. Therefore, the thickness of the chip substrate 11 within this range is, on the one hand, beneficial for maintaining the structural integrity and information integrity of the chip substrate 11 when separating the chip substrate 11 from the chip mother. On the other hand, the thickness of the chip substrate 11 within this range is beneficial for the optical system to image the optical signal generated on the surface of the chip substrate 11 to obtain an optical image.

[0070] In the embodiment of the present application, at least one surface of the chip substrate 11 has a plurality of separated single-stranded nucleic acid amplification clusters 111. The single-stranded nucleic acid amplification clusters 111 can be randomly distributed on the surface of the chip substrate 11, or can be distributed on the surface of the chip 11 in the form of an array. In some embodiments, the single-stranded nucleic acid amplification clusters 111 are bound to the modified surface of the chip substrate 11; in other embodiments, the single-stranded nucleic acid amplification clusters 111 can be bound to the surface of the micro-nanowells or micro-nanopillars of the chip substrate 11, that is, the chip substrate 11 is a nanowell or nanopore chip, and the single-stranded nucleic acid amplification clusters 11 are fixed in the nanowells or nanopores of the chip substrate 11.

[0071] In certain embodiments, the single-stranded nucleic acid amplification cluster 111 is formed in the micro-nanopore structure of the chip substrate 11. In some embodiments, the depth of the micro-nanopore structure is 10 nm to 100 μm to provide the space required for sample binding or reaction. In some embodiments, the depth of the micro-nanopore structure can be 100 nm to 1 μm, or even 200 nm to 800 nm. In some embodiments, the micro-nanopore structure is a circular pore structure. In such embodiments, the diameter of the micro-nanopore structure is 10 nm to 100 μm to provide the space required for sample binding or reaction. In some embodiments, the diameter of the micro-nanopore structure is 50 nm to 10 μm, or even 100 nm to 1 μm, or even 200 nm to 800 nm.

[0072] In some embodiments, the distribution of the single-stranded nucleic acid amplification clusters 111 on the chip substrate 11 may be random. That is, the single-stranded nucleic acid amplification clusters 111 are randomly distributed on the chip substrate 11. As a possible implementation method, the single-stranded nucleic acid amplification clusters 111 are arranged in an array on the chip substrate 11, so that the reaction signal generated by the detection reaction of the regularly arranged single-stranded nucleic acid amplification clusters 111 has better identifiability. Exemplarily, when the detection reaction occurring on the surface of the single-stranded nucleic acid amplification clusters 111 generates an optical signal, the regularly distributed optical signal is conducive to data analysis or algorithm statistics, thereby facilitating the acquisition of corresponding detection parameters or detection results, or based on the array optical signal obtained at the single-stranded nucleic acid amplification clusters 111, the accuracy and detection efficiency of the detection analysis results can be improved.

[0073] In some implementations, the single-stranded nucleic acid amplification clusters 111 may form regularly arranged array units 11A on the surface of the chip substrate 11. In one embodiment, Figure 2 As shown, the single-stranded nucleic acid amplification clusters 111 form array units 11A on the surface of the chip substrate 11, and each array unit 11A includes four single-stranded nucleic acid amplification clusters 111, and the four single-stranded nucleic acid amplification clusters 111 can be connected in sequence to form a rectangle, and these array units 11A are regularly arranged on the chip substrate 11. The long sides of the rectangle formed by connecting the four single-stranded nucleic acid amplification clusters 111 in each array unit 11A are equal, and the short sides are also equal. That is: the rectangles formed by connecting the four single-stranded nucleic acid amplification clusters 111 in each array unit 11A in the same way are all congruent rectangles. Not only that, the rectangles formed by connecting the four single-stranded nucleic acid amplification clusters 111 in adjacent array units 11A in the same way share a long side or a short side. In some embodiments, the rectangle can be a square. In this case, any non-edge single-stranded nucleic acid amplification cluster 111 (such as Figure 2 The central single-stranded nucleic acid amplification cluster 111) can also serve as a vertex of the array unit 11A.

[0074] In one embodiment, Figure 3As shown, the chip substrate 11 has a number of array units 11B, each array unit 11 includes three single-stranded nucleic acid amplification clusters 111, and the three single-stranded nucleic acid amplification clusters 111 are connected in pairs to form an isosceles triangle, and these array units 11 are regularly arranged on the chip substrate 11. The isosceles triangle formed by the three single-stranded nucleic acid amplification clusters 111 in each array unit 11 has equal side lengths, equal base lengths, and equal vertex angles and base angles. That is, the isosceles triangles formed by the three single-stranded nucleic acid amplification clusters 111 in each array unit 11 are all congruent triangles. Not only that, the isosceles triangles formed by the three single-stranded nucleic acid amplification clusters 111 in adjacent array units 11 share a side or a base. In some embodiments, the isosceles triangle can be an equilateral triangle. At this time, any single-stranded nucleic acid amplification cluster 111 (such as Figure 3 The central single-stranded nucleic acid amplification cluster 111 includes six single-stranded nucleic acid amplification clusters 111 that are closest to the single-stranded nucleic acid amplification cluster 111 and are equidistant from the single-stranded nucleic acid amplification cluster 111. The six equidistant single-stranded nucleic acid amplification clusters 111 can be connected in sequence to form a regular hexagon.

[0075] The single-stranded nucleic acid amplification cluster 111 includes multiple single-stranded nucleic acid molecules 111-1 having the same nucleotide sequence. In some embodiments, the number of amplification clusters 111 on the chip substrate 11 is n, the number of nucleotides constituting the barcode is m, and n and m satisfy: 4 m ≥n. Thus, by the arrangement and combination of the four nucleotides A, T or U, G and C, 4 m Different barcode sequences can be formed in the single-stranded nucleic acid amplification cluster 111 on the chip substrate 11 , thereby forming a unique barcode sequence, that is, the barcode sequence of each first single-stranded nucleotide library is different.

[0076] In some embodiments, n is a natural number greater than or equal to 28. In this case, at least 4 28 The barcodes must be of different sequences and the size must not exceed 1000mm. 2 The number of single-stranded nucleic acid amplification clusters 111 on the surface of the chip substrate 11 is required.

[0077] In the embodiment of the present application, the density of the amplification clusters on the chip substrate 11 can be set based on the complexity of different reaction samples to achieve a better balance between the detection throughput and the accuracy of the detection results. In some embodiments, the area of the single-stranded nucleic acid amplification cluster 111 in the chip substrate 11 is 0.25-100 μm 2 For example, the area of the single-stranded nucleic acid amplification cluster 111 in the chip substrate 11 can be 0.25 μm 2 , 0.5μm 2 , 0.8μm 2 , 1.0μm2 、5.0μm 2 、10.0μm 2 、15.0μm 2 、20.0μm 2 、25.0μm 2 、30.0μm 2 、35.0μm 2 、40.0μm 2 、45.0μm 2 、50.0μm 2 、55.0μm 2 、60.0μm 2 、65.0μm 2 、70.0μm 2 、75.0μm 2 、80.0μm 2 、85.0μm 2 、90.0μm 2 、95.0μm 2 、100μm 2 etc. situation.

[0078] In certain embodiments, the distance between adjacent single-stranded nucleic acid amplification clusters 111 is 10 nm to 100 μm. It should be understood that when the single-stranded nucleic acid amplification clusters 111 are regular shapes such as circles, ellipses, squares, rectangles, and other regular polygons, the distance between adjacent single-stranded nucleic acid amplification clusters 111 refers to the center-to-center distance between adjacent single-stranded nucleic acid amplification clusters 111; when the single-stranded nucleic acid amplification clusters 111 are irregular shapes, the minimum distance between adjacent single-stranded nucleic acid amplification clusters 111 refers to the shortest distance between all lines connecting any point on the outer edge of the single-stranded nucleic acid amplification cluster 111 and any point on the outer edge of the adjacent single-stranded nucleic acid amplification cluster 111. In some embodiments, the distance between adjacent single-stranded nucleic acid amplification clusters 111 can be in the range of 50 nm to 10 μm, or in the range of 100 nm to 1 μm, or in the range of 200 nm to 800 nm. Of course, it can be any interval range within 10 nm to 100 μm. In the single-stranded nucleic acid amplification cluster 111 in the embodiment of the present application, the distances between adjacent single-stranded nucleic acid amplification clusters 111 may be exactly the same or different within the above range. In some embodiments, the single-stranded nucleic acid amplification clusters 111 are arranged in an array on the surface of the chip substrate 11, and the distances between any two adjacent single-stranded nucleic acid amplification clusters 111 are the same. Exemplarily, the distances between adjacent single-stranded nucleic acid amplification clusters 111 may be 0.1 μm, 0.2 μm, 0.3 μm, 0.4 μm, 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, 1.0 μm, 1.2 μm, 1.5 μm, 1.8 μm, 2.0 μm, 2.2 μm, 2.5 μm, 2.8 μm, 3.0 μm, 3.2 μm, 3.5 μm, 3.8 μm, 4 .0μm, 4.2μm, 4.5μm, 4.8μm, 5.0μm, 5.2μm, 5.5μm, 5.8μm, 6.0μm, 6.2μm, 6.5μm, 6.8μm, 7.0μm , 7.2μm, 7.5μm, 7.8μm, 8.0μm, 8.2μm, 8.5μm, 8.8μm, 9.0μm, 9.2μm, 9.5μm, 9.8μm, 10.0μm, etc.

[0079] In the embodiment of the present application, the arrangement density of the single-stranded nucleic acid amplification clusters 111 on the chip substrate 11 is not strictly limited. In certain embodiments, the chip substrate 11 can be surface-treated so that a plurality of separated positions that have been surface-treated can bind to single-stranded nucleoside molecules, and other areas outside the plurality of separated positions cannot bind to single-stranded nucleoside molecules, thereby limiting the distribution area and density of the single-stranded nucleic acid amplification clusters 111, and defining the position and density of the single-stranded nucleic acid amplification clusters 111 on the chip substrate 11. The method of surface treatment and the result of surface treatment are not limited, as long as the position and density of the single-stranded nucleic acid amplification clusters 111 on the chip substrate 11 can be defined. For example, active groups that can bind to single-stranded nucleoside molecules can be formed at partially separated positions, or probes that can complement partial sequences of single-stranded nucleoside molecules can be connected at partially separated positions. In some embodiments, the arrangement density of the single-stranded nucleic acid amplification clusters 111 on the chip substrate 11 is 5 to 800 per mm. 2 For example, the density of the single-stranded nucleic acid amplification clusters 111 on the chip substrate 11 can be 5 to 500 per mm 2 50~500 pieces / mm 2 100~500 pieces / mm 2 100~600 pieces / mm 2 , 100~700 pieces / mm 2 , 100~800 pieces / mm 2 , 200~500 pieces / mm 2 , 200~600 pieces / mm 2 , 200~700 pieces / mm 2 , 200~800 pieces / mm 2 300~500 pieces / mm 2 300~600 pieces / mm 2 300~700 pieces / mm 2 300~800 pieces / mm 2 400~500 pieces / mm 2 400~600 pieces / mm 2 , 400~700 pieces / mm 2 400~800 pieces / mm 2 , 500~600 pieces / mm 2 , 500~700 pieces / mm 2 , 500~800 pieces / mm 2 , 600~700 pieces / mm 2 , 600~800 pieces / mm 2 ,700~800 pieces / mm 2 etc.

[0080] In some embodiments, the number of copies of the single-stranded nucleic acid molecule 111-1 in the single-stranded nucleic acid amplification cluster 111 in the chip substrate 11 may be 10 to 10 5 polynucleotides. For example, the copy number of the single-stranded nucleic acid molecule 111-1 of the single-stranded nucleic acid amplification cluster 111 in the chip substrate 11 can be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 500, 800, 1000, 2000, 5000, 8000, 10000, 20000, 50000, 80000, 100000, etc., thereby, after the single-stranded nucleic acid amplification cluster 111 of the chip substrate 11 is released, its density can reach more than 10 nmol / L.

[0081] In the embodiment of the present application, the nucleotide sequences of different single-stranded nucleic acid amplification clusters 111 are different. Figure 6 , the single-stranded nucleic acid molecule 111-1 includes at least a barcode sequence B with a known sequence. That is, the barcode sequence B of different single-stranded nucleic acid amplification clusters 111 is a unique sequence, so that the single-stranded nucleic acid amplification clusters 111 have known physical coordinates relative to the spatial chip 11. The position of each single-stranded nucleic acid amplification cluster 111 in the chip substrate 11 has a one-to-one correspondence with the barcode sequence B of the single-stranded nucleic acid molecule 111-1. Therefore, after obtaining the signal obtained by the detection reaction, the barcode sequence B of the single-stranded nucleic acid amplification cluster 111 can be obtained based on the physical coordinates of the single-stranded nucleic acid amplification cluster 111. Further, other sequence regions connected to the polynucleotide containing the barcode sequence can be obtained, and this can be used as the basis for detection and analysis to achieve analysis of the detection reaction and result determination.

[0082] In certain embodiments of the present application, the single-stranded nucleic acid molecule 111-1 further includes a first capture sequence A, which is located at one end of the barcode sequence B. The barcode sequence B is connected to the chip substrate 11 through the first capture sequence A. That is, the first capture sequence A is connected to the chip substrate 11, and the barcode sequence B is located at the end of the first capture sequence A away from the chip substrate 11. In some embodiments, the first capture sequence A is connected to the chip substrate 11 through chemical bonding, physical adsorption, electrostatic adsorption, or van der Waals forces.

[0083] In one implementation, the chip substrate 11 is bound to the compound, and the first capture sequence A is connected to the chip substrate 11 through the compound. The first capture sequence A is bound to the chip substrate 11 by connecting to the compound, especially the active group of the compound. In some embodiments, the surface of the chip substrate 11 has a first group, and the compound has a second group. The first group and the second group are a group of chemically reactive groups, and the compound is bound to the chip substrate 11 through the group group. In some embodiments, the group group is selected from an amino-carboxylic acid group, an amino-ester group, an amino-halogen group, an amino-aldehyde group, an amino-epoxy group, a thiol-imine group, an azide-alkyne group, an azide-alkenyl group, and a cycloalkenyl-tetrazine group. It should be understood that the two groups in the group group are derived from the surface of the chip substrate 11 and the compound, respectively, and any one of the group groups can be derived from the surface of the chip substrate 11, and the other can be derived from the compound. Exemplarily, the compound is selected from one or more of amino compounds, carboxylate compounds, succinimide or its analogs, pentafluorophenol ester or its analogs, aryl halides, maleimide or its analogs, epoxy compounds, aldehyde-containing compounds, azide-containing compounds, norbornene or its analogs, DBCO or its analogs, tetrazine and its analogs.

[0084] In another embodiment, the chip substrate 11 has a first reactant, the first capture sequence A has a second reactant, the first reactant and the second reactant are reactive, and the first capture sequence A is connected to the chip substrate 11 via the first reactant and the second reactant. In some embodiments, the first reactant and the second reactant are different. Exemplarily, the first reactant and the second reactant are each independently selected from an antigen and an antibody, or the first reactant and the second reactant are each independently selected from biotin and streptavidin.

[0085] In some embodiments, a first spacer sequence region is positioned between the first capture sequence A and the barcode sequence B.

[0086] In some embodiments of the present application, the single-stranded nucleoside molecule 111-1 further includes a second capture sequence C1, which is located at the end of the barcode sequence B away from the first capture sequence A. In other words, the second capture sequence C1 is connected to the end of the barcode sequence B away from the first capture sequence A. In this case, the single-stranded nucleoside molecule 111-1 sequentially includes the first capture sequence A, the barcode sequence B, and the second capture sequence C1. The second capture sequence C1 is used to capture the sample to be detected. The sequence length and configuration of the second capture sequence C1 can be determined according to the type and properties of the sample to be detected.

[0087] In some embodiments, a second spacer sequence region is disposed between the second capture sequence C1 and the barcode sequence B.

[0088] In one embodiment, the single-stranded nucleoside molecule 111-1 includes a first capture sequence A and a barcode sequence B linked in sequence. In one embodiment, the single-stranded nucleoside molecule 111-1 includes a first capture sequence A, a first spacer sequence region B, and a barcode sequence C1 linked in sequence. In one embodiment, the single-stranded nucleoside molecule 111-1 includes a first capture sequence A, a barcode sequence B, and a second capture sequence C1 linked in sequence. In one embodiment, the single-stranded nucleoside molecule 111-1 includes a first capture sequence A, a first spacer sequence region, a barcode sequence B, a second spacer region, and a second capture sequence C1 linked in sequence. Based on the above embodiment, as an implementation method, a Poly N may be further provided at the end of the barcode sequence B away from the first capture sequence A, or between the second capture sequence C1 and the barcode sequence B, wherein N is selected from one of A or its derivatives, T(U) or its derivatives, G or its derivatives, and C or its derivatives. Exemplarily, a Poly A may be further provided at the end of the barcode sequence B away from the first capture sequence A, or between the second capture sequence C1 and the barcode sequence B.

[0089] In some embodiments, the first capture sequence A and the second capture sequence C1 have breakage sites. Thus, through the breakage site of the first capture sequence A, after spatial capture using a spatial chip, the breakage site of the first capture sequence A can be cut off to release the single-stranded nucleic acid molecule 111-1 and the object captured. Therefore, in some embodiments, the chip substrate 11 is a substrate that can release single-stranded nucleic acid molecules under breakable conditions. The second capture sequence C1 can cut the obtained double-stranded nucleic acid molecules after forming an amplification cluster on the surface of the chip substrate 11 by amplification to achieve linearization and obtain a single-stranded nucleic acid molecule 111-1.

[0090] In some embodiments, the cleavage site can be a photocleavable site, a chemical cleavable site, or an enzyme cleavage site, or any two or three of the three types of cleavage sites. It should be understood that when the cleavage site is an enzyme cleavage site, the barcode sequence does not contain the same sequence as the cleavage site to prevent cleavage of the barcode sequence.

[0091] In some possible implementations, the space chip has two or more chip substrates 11, and the chip substrates 11 are fixed on the surface of the solid phase carrier according to a preset arrangement. Figure 4 As shown, the space chip 10 has two chip substrates 11 , and the two chip substrates 11 are fixed on a solid phase carrier 12 .

[0092] In the embodiment of the present application, each single-stranded nucleic acid amplification cluster 111 in the chip substrate 11 has known physical coordinates. When the spatial chip has two or more chip substrates 11, each chip substrate 11 has known position information relative to the spatial chip, so that each single-stranded nucleic acid amplification cluster 111 on each chip substrate 11 has known position information relative to the spatial chip.

[0093] In certain embodiments, the chip substrate 11 is provided with one or more markers. By providing markers on the chip substrate 11, it is possible to obtain the placement or arrangement direction of the chip substrate 11 on the surface of the solid phase carrier 12, as well as the location information of each single-stranded nucleic acid amplification cluster 111 in the chip substrate 11. This location information includes the physical coordinates of the single-stranded nucleic acid amplification cluster 111 and the barcode sequence of each single-stranded nucleic acid amplification cluster 111. Therefore, when using a spatial chip for spatial sample analysis, the physical coordinates corresponding to the barcode sequence can be used to determine the spatial location of the bound sample in the original sample.

[0094] In the embodiments of the present application, the marking method is not strictly limited. In some embodiments, one or a combination of letters, numbers and graphics can be used. For example, a separate letter mark, a separate number mark, a separate graphic mark, or a mark containing both letters and numbers, or both letters and graphics, or both numbers and graphics can be used. A mark containing both letters, numbers and graphics can also be used.

[0095] In certain embodiments, the markings include directional markings and regional markings. The directional markings are used to indicate the orientation of the chip substrate 11 bound to the surface of the solid support, so that the location information of each single-stranded nucleic acid amplification cluster 111 can be accurately determined during subsequent detection. In one embodiment, the directional markings can be arrows or other directional markings to indicate the orientation of the chip substrate 11.

[0096] In the embodiment of the present application, one or more direction marks can be provided on a chip substrate 11. The direction marks can be provided on the chip substrate 11 at the outer edge of the area of the single-stranded nucleic acid amplification cluster 111, that is, at the edge of the chip substrate 11. For example, when the chip substrate 11 is a rectangular chip, the direction marks can be provided at one or more right angles of the chip substrate 11 to quickly identify the direction of the chip substrate 11.

[0097] In some embodiments, each chip substrate 11 may include one or more region markers. When a region marker is provided on a chip substrate 11, the detection reaction performed in each reaction region must be positionally aligned with the region marker as a reference to determine the site information of the reaction region (including the barcode sequence and physical coordinates of each single-stranded nucleic acid amplification cluster 111), thereby obtaining and analyzing the corresponding detection reaction signal or result.

[0098] Therefore, in some embodiments, the chip substrate 11 is provided with a plurality of regional marks. By providing a plurality of regional marks, different regions on the surface of the chip substrate 11 can be marked respectively, so that when a detection reaction is performed on the surface of the chip substrate 11, the relative or absolute position of the reaction region in the chip substrate 11 can be quickly understood with the help of the regional marks, and the corresponding site information can be obtained. This method can quickly implement regional calibration based on the current regional mark when performing a detection reaction using the chip substrate 11, quickly determine the site information of the region (including the first position information of the single-stranded nucleic acid amplification cluster 111 and the barcode sequence corresponding to each position information), obtain the corresponding detection reaction signal or result, and avoid tedious calibration based on one mark for each reaction.

[0099] In an embodiment of the present application, when the chip substrate 11 is provided with multiple area marks, the multiple area marks can be carried out using different marking graphics, such as: using different letters / numbers (including different letters and / or uppercase and lowercase, such as A, B, C, D, a, b, c, d, etc.), different patterns such as circles, triangles, rectangles, squares, ellipses or other polygons, etc., or different letters and patterns, etc.; of course, the marking image can also be distinguished by setting different arrangement angles relative to a direction of the chip substrate 11 (such as the direction of the vertex of a non-equilateral triangle, etc.), and different numbers of marking graphics can also be used to distinguish (such as a square or triangle or circle, two squares or triangles or circles arranged according to a certain arrangement rule, etc.).

[0100] In some embodiments, a plurality of area marks are dispersedly arranged adjacent to the outer edge of the chip substrate 11. In some embodiments, the chip substrate 11 is a polygon such as a rectangle, and a plurality of area marks are evenly distributed in a direction parallel to each side of the polygon. In one embodiment, in order to facilitate quick identification, the marking types of the area marks are different for marks set on different sides, such as circular, triangular, square and rectangular marks on the four sides of a rectangle, respectively. Of course, different graphics or different numbers of the same graphics can also be used for marking. In another embodiment, the chip substrate 11 is circular or elliptical, and the area marks are evenly distributed along the trajectory adjacent to the outer edge. By evenly dispersing a plurality of area marks, the speed of positioning the detection area is increased, thereby improving the efficiency of detection reaction and analysis of the spatial chip substrate 11.

[0101] In some embodiments, the mark further includes a chip serial number mark, which is used to mark the arrangement order of the multiple chip substrates 11 on the solid phase carrier 12.

[0102] In some embodiments, the labeling may also include a chip source label for recording the location of the chip substrate 11 in the chip matrix before fabrication, thereby determining the location information within the chip substrate 11 in combination with the source information of the chip substrate 11. By source-labeling the chip substrate 11, that is, recording the location of the single-stranded nucleic acid amplification cluster 111 contained in the chip substrate 11 in the matrix chip, the unique barcode sequence corresponding to each single-stranded nucleic acid amplification cluster 111 contained in the chip substrate 11 can be determined. In some embodiments of the present application, the chip source labeling uses a combination of numbers and letters. For example, "3" in 3B represents the first partition from the matrix chip, and "B" represents the second partition within the first partition. For example, when the matrix chip is provided with four sequencing regions, such as four sequencing channels, and three chip substrates 11 are sequentially cut out in a certain direction from each sequencing region, 3B can represent the second chip substrate 11 cut out in a predetermined direction from the third sequencing region of the large chip.

[0103] In the present embodiment, the solid phase carrier is provided with a chip label; the chip label is a computer-stored information label, and the chip label is a QR code or barcode, or other mark or description that can be associated with the computer-stored information. By scanning the QR code or barcode, the location of the sites contained in the chip substrate 11 and the unique barcode sequence corresponding to each location can be quickly obtained.

[0104] In the embodiment of the present application, a certain space is reserved between the edge of the chip substrate 11 and the solid phase carrier, which can avoid wear or damage to the edge of the chip substrate 11 during preparation, storage, and transportation, and avoid loss of site data. In some embodiments, the distance between the edge of the chip substrate 11 and the edge of the solid phase carrier is greater than or equal to 1 mm. For example, the distance between the edge of the chip substrate 11 and the edge of the solid phase carrier is greater than or equal to 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, 6 mm, etc., but is not limited thereto. In some embodiments, the distance between the edge of adjacent chip substrates 11 and the edge of the solid phase carrier is one quarter or more of the length of the chip substrate 11 in the distance direction.

[0105] In an embodiment of the present application, one chip substrate 11 may be provided on a solid phase carrier, or two or more chip substrates 11 may be provided at the same time. The number and arrangement density of the chip substrates 11 on the solid phase carrier may be determined in combination with actual needs. In some embodiments, the distance between adjacent chip substrates 11 is greater than or equal to 1 mm. By setting a suitable distance between adjacent chip substrates 11, mutual reaction interference can be avoided during the detection reaction, and after the reaction, when the chip substrate 11 is subjected to signal acquisition or detection, detection crosstalk can be avoided.

[0106] It should be understood that when two or more chip substrates 11 are simultaneously disposed on a solid carrier, the plurality of chip substrates 11 may be arranged in an array on the surface of the solid carrier 12. In some embodiments, each chip substrate 11 has known positional information relative to the solid carrier 12. This positional information is obtained through the chip serial number marking on the chip substrate 11.

[0107] In some embodiments, an adhesive layer is provided between the solid substrate 11 and the solid carrier 12, and the chip substrate 11 is fixed by the adhesive effect of the adhesive layer. In some embodiments, the adhesive layer can cover the entire solid substrate 11 so as to completely bond the solid substrate 11 to the surface of the solid carrier 12. In other embodiments, the solid substrate 11 can also be partially bonded to the surface of the solid carrier 12 by providing an adhesive layer in a partial area of the solid substrate 11. It should be understood that, under the premise of using the same adhesive material and adhesive method, the larger the adhesive area, the higher the bonding strength between the solid substrate 11 and the solid carrier 12. When the adhesive layer is provided in a partial area of the solid substrate 11, the area where the adhesive layer is provided can be an edge area, or it can be several bonding areas evenly or unevenly provided on the adhesive layer.

[0108] In some embodiments, the adhesive layer is made of a material having a light transmittance greater than or equal to 90%, such as optical adhesive. Thus, the resulting chip substrate 11 can be used for optical inspection without being affected by the light transmittance of the adhesive layer. Exemplarily, the adhesive layer is selected from at least one of transparent double-sided tape, an epoxy adhesive such as epoxy resin, and an acrylate adhesive such as acrylic resin.

[0109] The above-mentioned solid phase carrier 12 provided in the embodiment of the present application can be implemented in a variety of ways, such as, fixing the chip substrate 11 that already has complete functional information on the surface of the solid phase carrier 12, or processing the chip substrate 11 bound to the solid phase carrier 12 to form sites with first position information on the chip substrate 11, and single-stranded nucleoside molecules with a unique barcode sequence at each site.

[0110] In some embodiments, the solid phase carrier 12 is a solid support for carrying the chip substrate 11, and it generally has a flat surface to ensure that each chip substrate 11 is evenly distributed on its surface. The material of the solid phase carrier 12 is not strictly limited and can be a material commonly used as a substrate or carrier. It can be an inorganic material such as silicon dioxide, silicon nitride, silicon, quartz, glass, ceramic, etc., or an organic material such as a polymer substrate PET (polyethylene terephthalate) or PMMA (polymethyl methacrylate).

[0111] In some embodiments, the solid phase carrier 12 is selected to have a light transmittance greater than or equal to 90%, such as transparent glass, so that when the obtained space chip 10 is used for optical detection, the solid phase carrier can avoid interfering with the detection signal.

[0112] In some embodiments, the thickness of the solid phase carrier 12 is 0.5 to 1.5 mm. For example, the thickness of the solid phase carrier 12 can be 0.5 ± 0.05 mm, 0.6 ± 0.05 mm, 0.7 ± 0.05 mm, 0.8 ± 0.05 mm, 0.9 ± 0.05 mm, 1.0 ± 0.05 mm, 1.1 ± 0.05 mm, 1.2 ± 0.05 mm, 1.3 ± 0.05 mm, 1.4 ± 0.05 mm, 1.5 ± 0.05 mm, etc. When the thickness of the solid phase carrier 12 is within this range, it is beneficial to fix the space chip in the carrier. At the same time, when collecting optical signals from the space chip 10, it is beneficial to optical focusing and optical imaging.

[0113] The shape of the solid phase carrier 12 is not strictly limited. In one possible embodiment, the solid phase carrier 12 is in the shape of a rectangular structure, and at least one of the four right angles of the rectangular structure is configured as a chamfer.

[0114] The chamfer in the embodiment of the present application may be, but is not limited to, a chamfer and / or a rounded corner. Wherein, a chamfer is sometimes also referred to as a bevel; a rounded corner is sometimes also referred to as a fillet or a rounded chamfer. Wherein, Figure 5 As shown, two adjacent side edges in the solid phase carrier 12 are connected by line segments instead of the original right angle to form a chamfered angle. It should be understood that the number of line segments forming the chamfered angle can be one, or two or more. When the line segments forming the chamfered angle include multiple lines, the multiple line segments are sequentially connected to form a regular or irregular line, and the two ends of the regular or irregular line are respectively connected to the end points of the two adjacent sides of the rectangular substrate where the chamfer is located. The chamfered angle is formed by connecting the end points of the two adjacent side edges in the rectangular substrate with an arc to replace the original right angle. It should be understood that the number of arcs forming the chamfered angle can be one, or two or more. When the arcs forming the chamfered angle include multiple lines, the multiple arcs are sequentially connected to form a regular or irregular curve, and the two ends of the regular or irregular curve are respectively connected to the end points of the two adjacent sides of the rectangular substrate where the chamfer is located.

[0115] In some embodiments, as Figure 5 As shown, three right angles of the solid phase carrier 12 are set as chamfered angles, and one right angle is set as a chamfered angle. In this way, the identifiability of the direction positioning of the solid phase carrier 12 can be enhanced.

[0116] The preparation method of the space chip provided in the embodiment of the present application is not strictly limited. As a possible implementation, the space chip is prepared by the following method.

[0117] The present invention provides a method for preparing a space chip, comprising the following steps:

[0118] S10. Synthesize a first single-stranded nucleotide library with a barcode sequence.

[0119] In the embodiment of the present application, the first single-stranded nucleotide library is a single-stranded nucleotide library containing a specific barcode sequence. The first single-stranded nucleotide library can be a polynucleotide sequence having the same sequence as the single-stranded nucleic acid molecule described above, or a polynucleotide sequence complementary to the single-stranded nucleic acid molecule described above.

[0120] In the embodiment of the present application, the nucleotide sequences of different first single-stranded nucleotide libraries are different. At least, the first single-stranded nucleotide libraries at least include a barcode sequence with a known sequence, and the barcode sequences of different first single-stranded nucleotide libraries are all unique sequences.

[0121] In certain embodiments of the present application, the first single-stranded nucleotide library further comprises a first capture sequence, which is located at one end of the barcode sequence. The first capture sequence is used to immobilize the first single-stranded nucleotide library on the surface of a solid substrate, or to connect the capture sequence so as to capture the sample to be analyzed via the capture sequence. In some embodiments, a first spacer sequence region is provided between the first capture sequence and the barcode sequence.

[0122] In some embodiments of the present application, the first single-stranded nucleotide library further includes a second capture sequence, and the second capture sequence is located at the end of the barcode sequence away from the first capture sequence, or in other words, the second capture sequence is connected to the end of the barcode sequence away from the first capture sequence. At this time, the single-stranded nucleoside molecule includes the first capture sequence, the barcode sequence, and the second capture sequence in sequence. The second capture sequence is used to fix the first single-stranded nucleotide library on the surface of the solid phase substrate, or to connect the capture sequence to capture the sample to be analyzed through the capture sequence. The sequence length and setting of the second capture sequence can be determined according to the type and nature of the sample to be detected. In some embodiments, a second spacer sequence region is set between the second capture sequence and the barcode sequence.

[0123] In one embodiment, the first single-stranded nucleotide library includes a first capture sequence, a barcode sequence, and a second capture sequence connected in sequence. In one embodiment, the first single-stranded nucleotide library includes a first capture sequence, a first spacer sequence region, a barcode sequence, a second spacer region, and a second capture sequence connected in sequence. Based on the above embodiment, as an implementation method, Poly N can be further set at one end of the barcode sequence away from the first capture sequence, or between the second capture sequence and the barcode sequence, wherein N is selected from one of A or its derivatives, T (U) or its derivatives, G or its derivatives, and C or its derivatives. Exemplarily, Poly A can be further set at one end of the barcode sequence away from the first capture sequence, or between the second capture sequence and the barcode sequence.

[0124] In some embodiments, the first capture sequence and the second capture sequence have a breakage site. Thus, through the breakage site of the first capture sequence, after spatial capture using a spatial chip, the breakage site of the first capture sequence can be cut off to release the single-stranded nucleic acid molecule and the object captured. Therefore, in some embodiments, the chip substrate 11 is a substrate that can release single-stranded nucleic acid molecules under breakable conditions. The second capture sequence can cut the obtained double-stranded nucleic acid molecules after forming an amplification cluster on the surface of the chip substrate 11 by amplification to achieve linearization and obtain single-stranded nucleic acid molecules.

[0125] In some embodiments, the cleavage site can be a photocleavable site, a chemical cleavable site, or an enzyme cleavage site, or any two or three of the three types of cleavage sites. It should be understood that when the cleavage site is an enzyme cleavage site, the barcode sequence does not contain the same sequence as the cleavage site to prevent cleavage of the barcode sequence.

[0126] S20. Immobilize the first single-stranded nucleotide library on the surface of a solid substrate, and amplify the first single-stranded nucleotide library to obtain an amplified cluster.

[0127] In the embodiment of the present application, the solid-phase substrate is a solid-phase substrate, and the material can be selected from materials such as quartz, glass, crystal, silicon wafer, silicon nitride, silicon dioxide, etc., and can also be plastic, ceramic, PET (polyethylene terephthalate), PMMA (polymethyl methacrylate), hydrogel, metal or any other suitable material. The shape of the solid-phase substrate can be flexibly set, or it can have a special shape according to the material of the solid-phase substrate. In one embodiment, the solid-phase substrate is a plane. In another embodiment, the solid-phase substrate can be a non-planar surface. Exemplary, the solid-phase substrate is a microbead or a magnetic bead, in which case the solid-phase substrate is a curved surface such as a spherical or hemispherical surface. Of course, based on the above two embodiments, the surface of the solid-phase substrate can be modified to form a modified substance containing, for example, a dendritic polymer on its surface. In this case, the surface may be a random surface containing ups and downs or uneven surfaces.

[0128] In the embodiment of the present application, when the solid substrate is planar as a whole, micro-nanopores, which can also be understood as depressions, can be formed on the solid substrate; or micro-nanopillars, which can also be understood as protrusions, can be formed on the surface of the solid substrate. There is no strict restriction on the cross-sectional shape of the micro-nanopores and nanopillars, which can be circular, regular, rectangular, rhombus, elliptical, other polygons, especially regular polygons, or other non-track shapes. Among them, micro-nanopores refer to holes or depressions with a pore size of micrometers or nanometers, and nanopillars refer to columnar protrusions with a maximum radial dimension of the cross section of micrometers or nanometers. In some embodiments, the micro-nanopores or micro-nanopillars are distributed in an array on the surface of the solid substrate. Exemplarily, the surface of the solid substrate has arrayed nanowells or nanopores, and the first single-stranded nucleotide library is fixed in the nanowells or nanopores.

[0129] In some embodiments, the selection of the solid phase substrate can refer to the chip substrate described above, and will not be described here in detail to save space.

[0130] In some embodiments, during the step of immobilizing the first single-stranded nucleotide library on the surface of a solid substrate, the first capture sequence is bound to the surface of the solid substrate. That is, the first capture sequence is attached to the solid substrate, and the barcode sequence is located at the end of the first capture sequence distal from the solid substrate. In some embodiments, the first capture sequence is attached to the surface of the solid substrate via chemical bonding, physical adsorption, electrostatic adsorption, or van der Waals forces.

[0131] In one implementation, the surface of the solid-phase substrate is bound to the compound, and the first capture sequence is connected to the surface of the solid-phase substrate through the compound. The first capture sequence is bound to the surface of the solid-phase substrate by connecting to the compound, especially the active group of the compound. In some embodiments, the surface of the solid-phase substrate has a first group, and the compound has a second group, the first group and the second group are group groups with chemical reaction activity, and the compound is bound to the surface of the solid-phase substrate through the group group. In some embodiments, the group group is selected from the amino-carboxylic acid group, the amino-ester group, the amino-halogen group, the amino-aldehyde group, the amino-epoxy group, the thiol-imine group, the azide-alkynyl group, the azide-alkenyl group, and the cycloalkenyl-tetrazine group. It should be understood that the two groups in the group group are derived from the surface of the solid-phase substrate and the compound, respectively, and any one of the group groups can be derived from the surface of the solid-phase substrate surface, and the other can be derived from the compound. Exemplarily, the compound is selected from one or more of amino compounds, carboxylate compounds, succinimide or its analogs, pentafluorophenol ester or its analogs, aryl halides, maleimide or its analogs, epoxy compounds, aldehyde-containing compounds, azide-containing compounds, norbornene or its analogs, DBCO or its analogs, tetrazine and its analogs.

[0132] In another embodiment, the solid phase substrate surface has a first reactant, the first capture sequence has a second reactant, the first reactant and the second reactant are reactive, and the first capture sequence is connected to the solid phase substrate via the first reactant and the second reactant. In some embodiments, the first reactant and the second reactant are different. Exemplarily, the first reactant and the second reactant are each independently selected from an antigen and an antibody, or the first reactant and the second reactant are each independently selected from biotin and streptavidin.

[0133] In the examples of the present application, the first single-stranded nucleotide library is amplified to obtain amplified clusters. The method for amplifying the first single-stranded nucleotide library is not strictly limited and can be bridge amplification or other amplification methods that can be performed on a solid surface, and is not strictly limited in the examples of the present application.

[0134] S30. Linearize the amplified cluster to obtain a single-stranded nucleic acid amplified cluster.

[0135] In an embodiment of the present application, the amplified cluster is linearized to remove one strand of the double-stranded amplified cluster and retain the other strand, thereby obtaining a single-stranded nucleic acid amplified cluster. In some embodiments, the step of linearizing the amplified cluster includes: adding a restriction endonuclease to cut the amplified cluster at the restriction endonuclease site.

[0136] In the embodiment of the present application, the single-stranded nucleic acid amplification cluster includes multiple single-stranded nucleic acid molecules having the same nucleotide sequence. In certain embodiments, the number of amplification clusters on the surface of the solid phase substrate is n, the number of nucleotides constituting the barcode is m, and n and m satisfy: 4 m ≥n. Thus, by the arrangement and combination of the four nucleotides A, T or U, G and C, 4 m Different barcode sequences can be generated, thereby forming a unique barcode sequence in the single-stranded nucleic acid amplification cluster on the surface of the solid substrate.

[0137] In some embodiments, n is a natural number greater than or equal to 28. In this case, at least 4 28 The barcodes must be of different sequences and the size must not exceed 1000mm. 2 The number of single-stranded nucleic acid amplification clusters on the surface of the solid substrate is required.

[0138] In the present embodiment, the density of amplification clusters on the solid substrate surface can be set based on the complexity of different reaction samples to achieve a better balance between detection throughput and accuracy of detection results. In some embodiments, the area of the single-stranded nucleic acid amplification cluster on the solid substrate surface is 0.25-100 μm 2 For example, the area of the single-stranded nucleic acid amplification cluster on the solid substrate surface can be 0.25 μm 2 , 0.5μm 2 , 0.8μm 2 , 1.0μm 2 , 5.0μm 2 , 10.0μm 2 , 15.0μm 2 , 20.0μm 2 , 25.0μm 2 、30.0μm 2 、35.0μm 2 , 40.0μm 2 , 45.0μm 2 , 50.0μm 2 , 55.0μm 2 、60.0μm 2 、65.0μm 2 , 70.0μm 2 , 75.0μm 2、80.0μm 2 、85.0μm 2 , 90.0μm 2 , 95.0μm 2 , 100μm 2 etc.

[0139] In certain embodiments, the distance between adjacent single-stranded nucleic acid amplification clusters is 10nm-100μm. It should be understood that when the single-stranded nucleic acid amplification cluster is a regular shape such as a circle, an ellipse, a square, a rectangle, or other regular polygons, the distance between adjacent single-stranded nucleic acid amplification clusters refers to the center-to-center distance of adjacent single-stranded nucleic acid amplification clusters; when the single-stranded nucleic acid amplification cluster is an irregular shape, the minimum distance between adjacent single-stranded nucleic acid amplification clusters refers to the shortest distance between all lines connecting any point on the outer edge of the single-stranded nucleic acid amplification cluster and any point on the outer edge of the adjacent single-stranded nucleic acid amplification cluster. In some embodiments, the distance between adjacent single-stranded nucleic acid amplification clusters can be in the range of 50nm to 10μm, or in the range of 100nm to 1μm, or in the range of 200nm to 800nm. Of course, it can be any interval range within 10nm to 100μm. In the single-stranded nucleic acid amplification clusters in the embodiments of the present application, the distance between adjacent single-stranded nucleic acid amplification clusters can be exactly the same or different within the above range. In some embodiments, the single-stranded nucleic acid amplification clusters are arranged in an array on the surface of the solid phase substrate, and the distance between any two adjacent single-stranded nucleic acid amplification clusters is the same. For example, the distance between adjacent single-stranded nucleic acid amplification clusters can be 0.1 μm, 0.2 μm, 0.3 μm, 0.4 μm, 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, 1.0 μm, 1.2 μm, 1.5 μm, 1.8 μm, 2.0 μm, 2.2 μm, 2.5 μm, 2.8 μm, 3.0 μm, 3.2 μm, 3.5 μm, 3.8 μm, 4.0 μm, 5.0 μm, 6.0 μm, 7.0 μm, 8.0 μm, 9.0 μm, 10.0 μm, 11.0 μm, 12.0 μm, 13.0 μm, 14.0 μm, 15.0 μm, 16.0 μm, 17.0 μm, 18.0 μm, 19.0 μm, 20.0 μm, 21.0 μm, 22.0 μm, 23.0 μm, 24.0 μm, 25.0 μm, 26.0 μm, 27.0 μm, 28.0 μm, 29.0 μm, 30.0 μm, 31.0 μm, 32.0 μm, 33.0 μm, 34.0 μm, 35.0 μm, 36.0 μm, 37.0 μm, 38.0 μm, 39.0 μm, 40.0 μm μm, 4.2μm, 4.5μm, 4.8μm, 5.0μm, 5.2μm, 5.5μm, 5.8μm, 6.0μm, 6.2μm, 6.5μm, 6.8μm, 7.0μm, 7.2μm, 7.5μm, 7.8μm, 8.0μm, 8.2μm, 8.5μm, 8.8μm, 9.0μm, 9.2μm, 9.5μm, 9.8μm, 10.0μm, etc.

[0140] In the embodiments of the present application, the density of the single-stranded nucleic acid amplification clusters on the surface of the solid substrate is not strictly limited. In certain embodiments, the surface of the solid substrate can be surface-treated so that a plurality of separated positions that have been surface-treated can bind to single-stranded nucleoside molecules, and other regional surfaces outside the plurality of separated positions cannot bind to single-stranded nucleoside molecules, thereby limiting the area and density of the distribution of the single-stranded nucleic acid amplification clusters to define the position and density of the single-stranded nucleic acid amplification clusters on the surface of the solid substrate. The method of surface treatment and the result of surface treatment are not limited, as long as the position and density of the single-stranded nucleic acid amplification clusters on the surface of the solid substrate can be defined. Exemplarily, an active group that can bind to a single-stranded nucleoside molecule can be formed at a partially separated position, or a probe that can be complementary to a partial sequence of a single-stranded nucleoside molecule can be connected at a partially separated position. In some embodiments, the density of the single-stranded nucleic acid amplification clusters on the surface of the solid substrate is 5 to 800 / mm. 2 For example, the density of the single-stranded nucleic acid amplification clusters on the solid substrate surface can be 5 to 500 per mm 2 50~500 pieces / mm 2 100~500 pieces / mm 2 100~600 pieces / mm 2 , 100~700 pieces / mm 2 100~800 pieces / mm 2 200~500 pieces / mm 2 , 200~600 pieces / mm 2 , 200~700 pieces / mm 2 , 200~800 pieces / mm 2 300~500 pieces / mm 2 300~600 pieces / mm 2 , 300~700 pieces / mm 2 300~800 pieces / mm 2 , 400~500 pieces / mm 2 400~600 pieces / mm 2 , 400~700 pieces / mm 2 400~800 pieces / mm 2 , 500~600 pieces / mm 2 , 500~700 pieces / mm 2 , 500~800 pieces / mm 2 , 600~700 pieces / mm 2 , 600~800 pieces / mm 2 ,700~800 pieces / mm 2 etc.

[0141] In certain embodiments, the number of copies of the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification cluster on the surface of the solid substrate may be 10 to 10 5 polynucleotides. For example, the copy number of the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification cluster on the surface of the solid substrate may be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 500, 800, 1000, 2000, 5000, 8000, 10000, 20000, 50000, 80000, 100000, etc., thereby, after the single-stranded nucleic acid amplification cluster on the surface of the solid substrate is released, its density can reach more than 10 nmol / L.

[0142] In the embodiment of the present application, the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different. At least, the single-stranded nucleic acid molecule at least includes a barcode sequence with a known sequence, that is, the barcode sequences of different single-stranded nucleic acid amplification clusters are all unique sequences, so that the single-stranded nucleic acid amplification cluster has a known physical coordinate relative to the spatial chip 11, and the position of each single-stranded nucleic acid amplification cluster on the surface of the solid phase substrate has a one-to-one correspondence with the barcode sequence of the single-stranded nucleic acid molecule. Thus, after obtaining the signal obtained by the detection reaction, the barcode sequence of the single-stranded nucleic acid amplification cluster can be obtained based on the physical coordinates of the single-stranded nucleic acid amplification cluster, and further, other sequence regions connected to the polynucleotide where the barcode sequence is located can be obtained, and this can be used as the basis for detection analysis to achieve analysis of the detection reaction and result determination.

[0143] S40. Sequence the single-stranded nucleic acid amplification cluster to obtain the sequence and physical coordinates of the barcode sequence to obtain a spatial chip.

[0144] In the embodiment of the present application, there is no strict restriction on sequencing the single-stranded nucleic acid amplification cluster. Sequencing can be performed using methods such as SBS to obtain the sequence and physical coordinates of the barcode sequence, and obtain the one-to-one correspondence between the barcode sequence and the physical coordinates of each of the first single-stranded nucleotide libraries to obtain a spatial chip.

[0145] In some embodiments, the solid substrate surface is derived from a surface having an area twice or greater than that of the solid substrate surface. Prior to obtaining the space chip, the method further includes: cutting the solid substrate surface into chip units of a predetermined size. In some embodiments, when the space chip includes multiple chip units, the method further includes: affixing one or more chip units to the surface of the solid carrier in a predetermined arrangement.

[0146] The embodiments of the present application also provide the application of the spatial chip prepared by the above method or the spatial chip provided by the above method in the field of spatial omics.

[0147] In one possible embodiment, a composition is provided, comprising a spatial chip, the spatial chip comprising a solid phase substrate, at least one surface of the solid phase substrate having a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters having the same nucleotide sequence, and different single-stranded nucleic acid amplification clusters having different nucleotide sequences;

[0148] The single-stranded nucleic acid amplification cluster has known physical coordinates relative to the spatial chip, see Figure 6 The single-stranded nucleic acid molecule 111-1 includes a barcode sequence B with a known sequence, and a first capture sequence A and a second capture sequence C1 respectively connected to the two ends of the barcode sequence B, wherein the first capture sequence A is connected to the surface of the solid phase substrate 11, and the barcode sequence B of each first single-stranded nucleic acid molecule 111-1 corresponds to the physical coordinates one by one.

[0149] In some embodiments, the space chip is the space chip described above. Figure 6 The composition also includes a second single-stranded nucleotide library 2, which includes a first base sequence C2, a second base sequence D and a capture part E, wherein the first base sequence C2 is a known sequence, the second base sequence D is a label sequence, and the first base sequence C2 of each nucleotide in the second single-stranded nucleotide library 2 is the same, but the label sequence is different.

[0150] In some embodiments, the first base sequence C2, the second base sequence D, and the capture portion E are sequentially connected, wherein the first base sequence C2 is complementary to the second capture sequence C1, and the capture portion E is a primer sequence. In this case, the composition can be used for spatial reverse transcription analysis. Specifically, the second single-stranded nucleotide library 2 can be bound to the first single-stranded nucleic acid molecule 111-1 via the first base sequence C2 and the second capture sequence C1, and the RNA in the sample to be analyzed—such as a cell sample or tissue sample—can be captured using the primer sequence provided by the capture portion E. After the captured sample is characterized by feature analysis such as fluorescence analysis, the reverse transcription information of the detected feature in the sample is restored based on the sequencing information of the barcode B in the first single-stranded nucleic acid molecule 111-1.

[0151] In some embodiments, the primer sequence is poly-dT, poly-dA, random primer or target molecule primer, which can be set according to the application scenario of the space chip.

[0152] In some embodiments, the capture portion E is a transposase, and the first base sequence C2 and the second base sequence D are located in the transposase. In this case, ATAC sequencing analysis can be performed using a spatial chip.

[0153] In some embodiments, the first base sequence C2, the second base sequence D and the capture part E are connected in sequence, wherein the first base sequence C2 is complementary to the second capture sequence C1, and the capture part E is a nucleic acid aptamer, protein, enzyme or antibody. At this time, a spatial protein analysis can be performed using a spatial chip. Specifically, the second single-stranded nucleotide library 2 can be combined with the first single-stranded nucleic acid molecule 111-1 through the first base sequence C2 and the second capture sequence C1, and the sample to be analyzed, such as a cell sample or a tissue sample, is captured through the primer sequence provided by the capture part E. After the captured sample is characterized by feature analysis such as fluorescence analysis, the spatial information of the detected feature in the sample is restored according to the sequencing information of the barcode in the first single-stranded nucleic acid molecule.

[0154] In one possible embodiment, a spatial reverse transcription method is provided, comprising the following steps:

[0155] (51) Provide a spatial chip and a second single-stranded nucleotide library.

[0156] Among them, the space chip can refer to the introduction of the space chip above, including a solid phase substrate, at least one surface of the solid phase substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different. The single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first capture sequence and a second capture sequence respectively connected to the two ends of the barcode sequence. The first capture sequence is connected to the surface of the solid phase substrate, and the barcode sequence and physical coordinates of each first single-stranded nucleotide molecule correspond one to one. For other situations of the space chip, refer to the above description. In order to save space, they will not be repeated here.

[0157] The second single-stranded nucleotide library includes a first base sequence, a second base sequence and a capture portion connected in sequence, the first base sequence is a known sequence complementary to the second capture sequence, the second base sequence is a label sequence, the capture portion is a primer sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the label sequence is different.

[0158] (52) The cells or tissue samples to be tested are brought into contact with the space chip and the second single-stranded nucleotide library, so that the RNA in the cells or tissue samples to be tested is bound to the space chip through the second single-stranded nucleotide library.

[0159] In this step, the cell or tissue sample to be tested is brought into contact with the space chip and the second single-stranded nucleotide library. This can be achieved by adding the cell or tissue sample to be tested and the second single-stranded nucleotide library to the space chip, and the adding method includes passing through or dripping. In one embodiment, the step of bringing the cell or tissue sample to be tested into contact with the space chip and the second single-stranded nucleotide library includes: after bringing the cell or tissue sample to be tested into contact with the space chip, adding the second single-stranded nucleotide library. The two are connected through the two ends of the second single-stranded nucleotide library. In another embodiment, the second single-stranded nucleotide library is first added to the space chip, and after the second single-stranded nucleotide library is combined with the first single-stranded nucleic acid molecule on the surface of the space chip, the cell or tissue sample to be tested is added.

[0160] In some embodiments, when the cell or tissue sample to be tested is a tissue sample, the tissue sample is a tissue section. In some embodiments, the thickness of the tissue section is less than or equal to 50 μm.

[0161] The second single-stranded nucleotide library can bind to the first single-stranded nucleic acid molecule through the first base sequence and the second capture sequence, and capture the RNA in the cell or tissue sample to be tested through the primer sequence provided by the capture part, so that the RNA in the cell or tissue sample to be tested is bound to the space chip through the second single-stranded nucleotide library.

[0162] In this step, the captured RNA may also be reverse transcribed to obtain cDNA. In some embodiments, the reverse transcription product is subjected to feature detection by feature analysis such as fluorescence analysis to obtain corresponding detection features such as fluorescence signals.

[0163] (53) The space chip is excised and the excision products are collected.

[0164] In this step, the first capture sequence of the spatial chip is excised to obtain an excision product. In one embodiment, if the captured RNA is reverse transcribed in step (52), the excision product includes a double strand formed by the single-stranded nucleic acid molecule after removing the first capture sequence, the second nucleic acid molecule, the RNA, and the cDNA.

[0165] In another embodiment, if the captured RNA is not reverse transcribed in step (52), the excision product includes a single-stranded nucleic acid molecule after removal of the first capture sequence, a second nucleic acid molecule, and RNA. Furthermore, the RNA in the excision product can be reverse transcribed to obtain cDNA. In some embodiments, the reverse transcription product is subjected to feature detection by a feature analysis such as fluorescence analysis to obtain a corresponding detection feature, such as a fluorescence signal.

[0166] (54) The excision products were sequenced and the obtained sequencing data were analyzed.

[0167] In this step, the excision product is sequenced to obtain the sequence information of the barcode, and then the spatial information of the detected feature in the sample can be restored based on the position information corresponding to the barcode in the first single-stranded nucleic acid molecule in the spatial chip.

[0168] In some embodiments, analyzing the obtained sequencing data comprises:

[0169] Based on the sequencing data, obtaining the position information of the barcode sequence in the excised product in the spatial chip;

[0170] Based on the position information, the excision products are spatially restored to achieve spatial reverse transcription analysis.

[0171] In one possible embodiment, an ATAC sequencing method is provided, comprising the following steps:

[0172] (61) Provide a spatial chip and a second single-stranded nucleotide library.

[0173] Among them, the space chip can refer to the introduction of the space chip above, including a solid phase substrate, at least one surface of the solid phase substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different. The single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first capture sequence and a second capture sequence respectively connected to the two ends of the barcode sequence. The first capture sequence is connected to the surface of the solid phase substrate, and the barcode sequence and physical coordinates of each first single-stranded nucleotide molecule correspond one to one. For other situations of the space chip, refer to the above description. In order to save space, they will not be repeated here.

[0174] The second single-stranded nucleotide library includes a first base sequence, a second base sequence and a capture part, the first base sequence is a known sequence, the second base sequence is a tag sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the tag sequences are different, the capture part is a transposase, and the first base sequence and the second base sequence are located in the transposase.

[0175] (62) The cells or tissue samples to be tested are contacted with the space chip and the second single-stranded nucleotide library, so that the ATAC in the cells or tissue samples to be tested is bound to the space chip through the second single-stranded nucleotide library.

[0176] In this step, the cell or tissue sample to be tested is brought into contact with the space chip and the second single-stranded nucleotide library. This can be achieved by adding the cell or tissue sample to be tested and the second single-stranded nucleotide library to the space chip, and the adding method includes passing through or dripping. In one embodiment, the step of bringing the cell or tissue sample to be tested into contact with the space chip and the second single-stranded nucleotide library includes: after bringing the cell or tissue sample to be tested into contact with the space chip, adding the second single-stranded nucleotide library. The two are connected through the two ends of the second single-stranded nucleotide library. In another embodiment, the second single-stranded nucleotide library is first added to the space chip, and after the second single-stranded nucleotide library is combined with the first single-stranded nucleic acid molecule on the surface of the space chip, the cell or tissue sample to be tested is added.

[0177] In some embodiments, when the cell or tissue sample to be tested is a tissue sample, the tissue sample is a tissue section. In some embodiments, the thickness of the tissue section is less than or equal to 50 μm.

[0178] (63) Excising the space chip and collecting the excision products;

[0179] In this step, the first capture sequence of the space chip is excised to obtain an excision product.

[0180] (64) The excision products were sequenced and the obtained sequencing data were analyzed.

[0181] In this step, the excision product is sequenced to obtain the sequence information of the barcode, and then the spatial information of the detected feature in the sample can be restored based on the position information corresponding to the barcode in the first single-stranded nucleic acid molecule in the spatial chip.

[0182] In some embodiments, analyzing the obtained sequencing data comprises:

[0183] Based on the sequencing data, obtaining position information of the barcode sequence in the excised product in the spatial chip;

[0184] Based on the position information, the excision products are spatially restored to achieve ATAC sequencing analysis.

[0185] In one possible embodiment, a spatial protein analysis method is provided, comprising the following steps:

[0186] (71) Provide a spatial chip and a second single-stranded nucleotide library.

[0187] Among them, the space chip can refer to the introduction of the space chip above, including a solid phase substrate, at least one surface of the solid phase substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different. The single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first capture sequence and a second capture sequence respectively connected to the two ends of the barcode sequence. The first capture sequence is connected to the surface of the solid phase substrate, and the barcode sequence and physical coordinates of each first single-stranded nucleotide molecule correspond one to one. For other situations of the space chip, refer to the above description. In order to save space, they will not be repeated here.

[0188] The second single-stranded nucleotide library comprises a first base sequence, a second base sequence, and a capture moiety, wherein the first base sequence is a known sequence complementary to the second capture sequence, and the second base sequence is a tag sequence. The first base sequence of each nucleotide in the second single-stranded nucleotide library is identical, but the tag sequences are different. In some embodiments, the capture moiety is a nucleic acid aptamer, a protein, an enzyme, or an antibody.

[0189] (72) The cell or tissue sample to be tested is brought into contact with the space chip and the second single-stranded nucleotide library, so that the target substance in the sample to be tested that is capable of binding to the capture portion is bound to the space chip through the second single-stranded nucleotide library.

[0190] In this step, the cell or tissue sample to be tested is brought into contact with the space chip and the second single-stranded nucleotide library. This can be achieved by adding the cell or tissue sample to be tested and the second single-stranded nucleotide library to the space chip, and the adding method includes passing through or dripping. In one embodiment, the step of bringing the cell or tissue sample to be tested into contact with the space chip and the second single-stranded nucleotide library includes: after bringing the cell or tissue sample to be tested into contact with the space chip, adding the second single-stranded nucleotide library. The two are connected through the two ends of the second single-stranded nucleotide library. In another embodiment, the second single-stranded nucleotide library is first added to the space chip, and after the second single-stranded nucleotide library is combined with the first single-stranded nucleic acid molecule on the surface of the space chip, the cell or tissue sample to be tested is added.

[0191] In some embodiments, when the cell or tissue sample to be tested is a tissue sample, the tissue sample is a tissue section. In some embodiments, the thickness of the tissue section is less than or equal to 50 μm.

[0192] (73) The space chip is excised and the excision products are collected.

[0193] In this step, the first capture sequence of the space chip is excised to obtain an excision product.

[0194] (74) The excision products were sequenced and the obtained sequencing data were analyzed.

[0195] In this step, the excision product is sequenced to obtain the sequence information of the barcode, and then the spatial information of the detected feature in the sample can be restored based on the position information corresponding to the barcode in the first single-stranded nucleic acid molecule in the spatial chip.

[0196] In some embodiments, analyzing the obtained sequencing data comprises:

[0197] Based on the sequencing data, obtaining position information of the barcode sequence in the excised product in the spatial chip;

[0198] Based on the position information, the excision products are spatially restored to achieve spatial protein analysis.

[0199] The following describes the details in conjunction with specific embodiments.

[0200] Example 1

[0201] (1) Two libraries with the following sequences were designed, where the underlined barcode sequences are barcode sequences, B represents a non-A base (selected from one of G, C, and T), V represents a non-T base (selected from one of G, C, and A), and N represents a random base in ACGT, but the specific type is unknown:

[0202] Library 1:

[0203] 5'-AATGATACGGCGACCACCGAGATCTACACCCAAGCTTGGCTGATAAGGTCGCC ATGCCTCTCAGTACGTCAGCAG NNNNNBNNBNNBNNBNNBNNBNNBV ATCTCGTA TGCCGTCTTCTGCTTG

[0204] Library 2:

[0205] 5'-AATGATACGGCGACCACCGAGATCTACAC BVNNVNNVNNVNNVNNVNNVNNV NNNNN CTGCTGACGTACTGAGAGGCATGGCGACCTTATCAGCCAAGCTTGGATCTCGT ATGCCGTCTTCTGCTTG

[0206] (2) The method for preparing the above library comprises: providing two nucleotide sequences 1-1 and 1-2 constituting library 1, and two nucleotide sequences 2-1 and 2-2 constituting library 2, respectively, and designing two RNA splint oligo primer sequences for connecting 1-1 and 1-2, and designing two RNA splint oligo primer sequences for connecting 2-1 and 2-2;

[0207] (3) Taking the preparation of library 1 as an example, configure the T4 DNA ligation reaction system according to Table 1 below, and ligate nucleotide sequences 1-1 and 1-2;

[0208] Table 1

[0209]

[0210]

[0211] (4) Prepare the PCR amplification system according to Table 2 below. After preparation, mix well, centrifuge briefly, and place on ice for later use.

[0212] Table 2

[0213] Components Volume (μL) 2×KAPAHiFiHotStartReadyMix(RocheKK2602) 50 lib_F (10 μM Biotechnology) 5 lib_R (10 μM Biotechnology) 5 dNTPMix (10 mM each Vazyme P031) 10 Fragmentation products 30 Total 100

[0214] (5) Using the amplification system in Table 2 above, perform a PCR reaction on the ligation product according to the amplification process shown in Table 3 below;

[0215] Table 3

[0216]

[0217] (6) The PCR product at position 127b was recovered by 2% agarose gel electrophoresis.

[0218] (7) The recovered products were subjected to high-throughput sequencing. The recovered library was diluted to the required concentration according to the sequencing platform instruction manual and hybridized to the surface of the sequencing chip. After surface solid-phase amplification and linearization, a 28-base SBS reaction was performed on one strand to obtain a unique barcode information. The sequencing results of some clusters under the same FOV are as follows: Figure 7 As shown, some cluster sequences and spatial coordinate information are shown in Table 4;

[0219] Table 4

[0220]

[0221]

[0222] (8) Use formamide to rinse the chip channel at 55°C, and then use 5×SSC to rinse the formamide;

[0223] (9) Hybridize the surface cluster library with 5 μM HandIIICut primer at 45°C for 20 min. Prepare the HandIII enzyme digestion system shown in Table 5 below and introduce the HandIII enzyme digestion system into the chip channel. Incubate at 37°C for 3 h.

[0224] Table 5

[0225] Components Volume (μL) HandIII(20u / μLYEASEN15012ES76) 10 <![CDATA[10×FuniCut TM Buffe(YEASEN 15012ES76)]]> 10 <![CDATA[Nuclease-freeH2O(InvitrogenAM9939)]]> 80 Total 100

[0226] (6) The 3 ends of the nucleic acid molecule sequence are exposed, and then washed with formamide to obtain a single-stranded nucleic acid molecular probe. The nucleic acid molecular probe can be represented as: chip substrate-AB-C1, wherein A comes from the fixed chain of the modified substrate of the sequencing chip, and B+C1 is obtained by surface solid-phase amplification based on A. B is a 28-base random sequence, and C1 is a sequence of 39-43 known bases (including primer binding sites).

[0227] Example 2

[0228] (1) Preparation of polyA probe chain with aminoallyl-dUTP:

[0229] The template chain is RNA sequence:

[0230] 5'NBUUUUUUUUUUUUUUUUUUUUUUUUUUNNNNNNNNNNNNNNNGAAGAUACCUGCGACCAUCCAGUUCCACUCA;

[0231] The extension primer is a DNA sequence with 5-terminal phosphate modification:

[0232] 5'P-TGAGTGGAACTGGATGGTCGCAGGTATCTTC;

[0233] (2) Prepare the reaction system according to Table 6 below, react at 55°C for 15 min and then at 75°C for 20 min:

[0234] Table 6

[0235]

[0236]

[0237] (3) Connect the fixed strand after sequencing and restriction endonuclease digestion to the polyA probe strand with aminoallyl-dUTP, and configure the surface connection reaction system according to Table 7 below:

[0238] Table 7

[0239] Components Volume (μL) 10×T4DNALigaseBuffer(NEBM0202) 10 T4 DNA ligase (NEBM0202) 10 Previous reaction product 20 LigaseCAC2 (100 μM) 10 50% PEG8000 (YEASEN60300ES60) 40 <![CDATA[NF-H2O]]> 10 Total 100

[0240] LigaseCAC2 primer sequence: 5'ATCCAGTTCCACTCATGGCTGATAAGGTCGCC.

[0241] (4) The above connection system is loaded onto a solid phase reaction carrier and connected at 25°C overnight. Then, the chip channel is rinsed with formamide to make the surface fixed clusters in a single-chain state.

[0242] (5) Fresh mouse brain tissue was obtained and embedded in OCT, frozen in a -80°C refrigerator, and restored to -20°C before use;

[0243] (6) Slice the sample into 10 μm thick slices and attach them to the nucleic acid chip prepared above. Add 4% paraformaldehyde and fix at room temperature for 10 min.

[0244] (7) Treat tissue sections with 0.5% NP-40 in PBS at room temperature for 5 min and then remove;

[0245] (8) BS(PEG)9 (Thermo 21582) was prepared in PBS at pH 7.0 and treated with the nucleic acid chip with tissue from the previous step for 30 min to allow the fixed chain probe to crosslink with the tissue;

[0246] (9) Configure the USER enzyme reaction system according to Table 8:

[0247] Table 8

[0248] Components Volume (μL) USER(1U / μLNEBM5505L) 5 10×rCutsmart(NEBM5505L) 10 50% PEG8000 (YEASEN60300ES60) 8 Nuclease-freeH2O(InvitrogenAM9939) 77 total 100

[0249] (9) Remove the NP-40 permeabilization system and add the USER enzyme digestion system dropwise on top, reacting at 37°C for 20 min;

[0250] (10) Remove the USER enzyme reaction system and use KOH to recover the product from the previous step;

[0251] (11) After constructing the oil-in-water reaction system, reverse transcription and cDNA library construction were performed using the Vahyme RNA sequencing library preparation kit VAHTS Universal V10 RNA-seq Library Prep Kit (Vazyme NR606-01);

[0252] (12) The product of the previous step is subjected to high-throughput sequencing, and PE100 sequencing is performed on a sequencing platform (PE sequencing means double-end sequencing, and 100 means the sequencing sequence length is 100 bases).

[0253] (13) Data comparison and analysis: The 28 Ns and 10 UMIs of the first strand of fq obtained by sequencing were extracted, and the 28N data were compared with the fq data of the first sequencing in Implementation Case 1 to obtain position information. UMI was used to quantify gene expression; the cDNA information of the second strand of fq obtained by sequencing was used for gene comparison.

[0254] (14) The statistical results of bin 50 μm are as follows Figure 8 As shown in the figure, the vertical axis of the first two figures represents the number, which respectively represents the distribution of the number of bound genes and UMIs; the third and fourth figures respectively represent the graphs obtained by taking the log values of the number of bound gene types and UMIs; the horizontal axis of the last figure represents the number of bound UMIs, and the vertical axis represents the number of bound gene types. It can be seen that as the number of UMIs increases, the number of identified gene types increases accordingly, and eventually tends to saturation.

[0255] (15) Taking bin 50 μm as an example, the sequence of the UMI bound in the window is detected and restored to the window according to the position information corresponding to the sequence. Figure 9 The left picture; restore the Gene type to the window according to the position information, and get Figure 9 As shown in the right figure, the spatial chip provided by the embodiment of the present application can restore spatial position information and realize tissue spatial transcriptome analysis.

[0256] Example 3

[0257] A method for preparing a spatial chip having oligodT on its surface, comprising:

[0258] (1) Design and synthesize a library containing 28N, the sequence of which is as follows:

[0259] 5'-AATGATACGGCGACCACCGAGATCTACAC BVNNVNNVNNVNNVNNVNNVNNV NNNNN CTGCTGACGTACTGAGAGGCATGGCGACCTTATCAGCCAAGCTTGGATCTCGT ATGCCGTCTTCTGCTTG, where the underline is the barcode sequence, B represents a non-A base (GCT), V represents a non-T base (GCA), and N represents a random base in ACGT, but the specific type is unknown;

[0260] (2) According to the sequencing platform operating instructions, the library in step (1) was denatured and diluted to 100 pM, placed in the library well of the kit, and the library was subjected to SE sequencing (SE sequencing means single-end sequencing) to obtain the barcode sequence;

[0261] (3) Hybridize the clustered library from step (1) with 5 μM HandIII Cut primer at 45°C for 20 min. Prepare the HandIII enzyme digestion system shown in Table 9 below, mix well, and place on ice until ready for use.

[0262] Table 9

[0263] Components Volume (μL) HandIII(20u / μLYEASEN15012ES76) 10 <![CDATA[10×FuniCut TM Buffe(YEASEN 15012ES76)]]> 10 <![CDATA[Nuclease-freeH2O(InvitrogenAM9939)]]> 80 Total 100

[0264] (4) Using 1×FuniCut TMThe hybridization system was washed with Buffe, and HandIII enzyme digestion system was introduced and reacted at 37℃ for 3h;

[0265] (5) using formamide to rinse the chip after enzyme digestion to obtain single-stranded nucleic acid molecular probes;

[0266] (6) Prepare the Klenow extension system shown in Table 10 below, mix well, and place on ice until ready for use;

[0267] Table 10

[0268]

[0269]

[0270] Among them, the sequence of the extension primer is:

[0271] 5'NBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANNNNNNNNNNGGCTGATAAGGTCGCCATGCCTCTCAGTACGTCAGCAG; (7) The Klenow extension system was introduced into the chip treated in step (5) and extended at 37°C for 1 hour; (8) A primer with 30 A bases and cy3 (concentration of 1 μM) was used to hybridize with the oligodT extended on the surface in step (7). The fluorescence detection results were as follows: Figure 10 As shown. Figure 10 As shown, the results show that the chip displays clustered fluorescence, indicating successful surface oligodT extension. The bright bar represents a 10 μm scale bar.

[0272] Example 4

[0273] The FreeRNA spatial transcriptome method has the following process:

[0274] (1) The spatial chip in Example 3 was reacted with 100% formamide at 50°C, then rinsed with enzyme-free water and dried for later use;

[0275] (2) Prepare the FreeRNA hybridization system according to Table 11 below. After the configuration is completed, mix well and place on ice for later use:

[0276] Table 11

[0277] Components Volume (μL) 20×SCC (Shenggong B548110) 50 Free RNA (528 ng / μl self-extraction) 4 RNaseinhibitor(40u / μlVazymeR301) 20 Nuclease-freeH2O(InvitrogenAM9939) 126 Total 200

[0278] (3) Add the above-mentioned free RNA hybridization system dropwise onto the chip treated in step (1) and hybridize at room temperature for 15 minutes;

[0279] (4) Prepare the reverse transcription reaction system according to Table 12 below. After the preparation is completed, mix well, centrifuge briefly, and place on ice for later use:

[0280] Table 12

[0281] Components Volume (μL) 5×MaximaHRTBuffer(ThermoEP0751) 20 RNaseinhibitor(40u / μLVazymeR301) 5 MaximaH (200U / μL ThermoEP0751) 5 dNTPMix (10 mM each Vazyme P031) 10 TSO (100 μM Biotech) 5 5M Betaine (Sigma B0300) 20 50%PEG20000(YEASEN60300ES60) 10 Nuclease-freeH2O(InvitrogenAM9939) 25 Total 100

[0282] (5) Remove the free RNA hybridization system and add the reverse transcription reaction system dropwise onto the chip surface. React at 55°C for 2 h and then at 42°C overnight.

[0283] (6) Prepare the USER enzyme digestion system according to Table 13 below. After the configuration is complete, mix well, centrifuge, and place on ice for later use:

[0284] Table 13

[0285]

[0286]

[0287] (7) Remove the RT MIX reaction system and add the USER enzyme digestion system dropwise on top. Incubate at 37°C for 1 h. Gently pipette the reaction mixture every 30 min to avoid air bubbles.

[0288] (8) Recover the USER reaction system and incubate at 75°C for 10 min to inactivate the enzyme;

[0289] (9) Prepare the cDNA amplification system according to Table 14 below. After the preparation is complete, mix well, centrifuge briefly, and place on ice for later use:

[0290] Table 14

[0291] Components Volume (μL) 2×KAPAHiFiHotStartReadyMix(RocheKK2602) 100 cDNA_F (10 μM Biotechnology) 10 cDNA_R (10 μM Biotechnology) 10 dNTPMix (10 mM each Vazyme P031) 20 USER reaction system recovery 60 Total 200

[0292] (10) PCR reaction was performed according to the amplification process shown in Table 15 below.

[0293] Table 15

[0294]

[0295] (11) According to the instructions of DNA magnetic bead purification (Norvozyme N411), 1×VAHTS DNA Clean Beads were used to recover the cDNA product, and the product was identified using Agilent 2100. The results are as follows Figure 11 As shown in the figure, the main peak of the sequence length distribution of cDNA products is around 1500 bp. It can be seen that the distribution of the full length of cDNA is in line with expectations.

[0296] (12) According to the instructions of Tn5 transposase (YEASEN 14524ES60), embed the linker shown in Table 16 below;

[0297] Table 16

[0298] Primer name Primer sequences PrimerA 5'-phos-CTGTCTCTTATACACATCT-NH2-3' PrimerB 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3′

[0299] (13) According to the instructions of Tn5 transposase (YEASEN 14524ES60), the cDNA product was fragmented using the embedded Tn5 transposase;

[0300] (14) Perform PCR amplification on the fragmented product. Prepare the system according to Table 17 below. After the configuration is completed, mix well, centrifuge briefly, and place on ice for later use:

[0301] Table 17

[0302] Components Volume (μL) 2×KAPAHiFiHotStartReadyMix(RocheKK2602) 50 lib_F (10 μM Biotechnology) 5 lib_R (10 μM Biotechnology) 5 dNTPMix (10 mM each Vazyme P031) 10 Fragmentation products 30 Total 100

[0303] (15) Perform PCR reaction according to the amplification process shown in Table 18 below;

[0304] Table 18

[0305]

[0306] (16) According to the instructions of DNA magnetic bead purification (Norvozyme N411), the amplified fragmented products were purified and recovered at 0.5+0.15×.

[0307] Example 5

[0308] (1) performing high-throughput sequencing on the product of Example 4 above, performing PE100 sequencing on a sequencing platform (PE sequencing indicates paired-end sequencing, and 100 indicates a sequencing sequence length of 100 bases), and operating according to the sequencing platform instruction manual to obtain sequencing data;

[0309] (2) Data comparison and analysis: The 28 Ns and 10 UMIs of the first strand of fq obtained by sequencing were extracted, and the 28N data were compared with the fq data of the first sequencing in Implementation Case 3 to obtain position information. UMIs were used to quantify gene expression; the cDNA information of the second strand of fq obtained by sequencing was used for gene comparison. The results are shown in Table 19 below:

[0310] Table 19

[0311]

[0312]

[0313] In the table, binXμm represents a window of size Xμm × Xμm, for example, bin100μm represents a window of size 100μm × 100μm. MeanUMl represents the average number of combined UMIs, MedianUMl represents the median of combined UMIs, MeanGeneNum represents the average number of combined Gene types, and MedianGeneNum represents the median of combined Gene types.

[0314] Among them, the statistical results of bin 50μm are plotted as follows Figure 12 As shown, Figure 12 The vertical axis of the first two figures represents the number, indicating the distribution of the number of bound genes and UMIs, respectively; the third and fourth figures are graphs obtained by taking the log values of the number of bound gene types and UMIs, respectively; the horizontal axis of the last figure represents the number of bound UMIs, and the vertical axis represents the number of bound gene types. It can be seen that as the number of UMIs increases, the number of identified gene types also increases, and eventually tends to saturation.

[0315] (3) Taking bin 50 μm as an example, the sequence of the UMI bound in the window is detected and restored to the window according to the position information corresponding to the sequence. Figure 13 The left picture; restore the Gene type to the window according to the position information, and get Figure 13 As shown in the right figure, the spatial chip provided by the embodiment of the present application can restore spatial position information and realize free RNA spatial transcriptome analysis.

[0316] The above are only preferred embodiments of the present application and are not intended to limit the present application. Any modifications, equivalent replacements, and improvements made within the spirit and principles of the present application should be included in the scope of protection of the present application.

Claims

1. A method for preparing a space chip, characterized in that: The steps include: synthesizing a first single-stranded nucleotide library with a barcode sequence, wherein different first single-stranded nucleotide libraries have different nucleotide sequences, and the barcode sequence of each first single-stranded nucleotide library is different; immobilizing the first single-stranded nucleotide library on a solid substrate surface, and amplifying the first single-stranded nucleotide library to obtain an amplified cluster; linearizing the amplified cluster to obtain a single-stranded nucleic acid amplified cluster; The single-stranded nucleic acid amplification cluster is sequenced to obtain the sequence and physical coordinates of the barcode sequence, and information on the one-to-one correspondence between the barcode sequence and the physical coordinates of each of the first single-stranded nucleotide libraries is obtained to obtain a spatial chip.

2. The preparation method according to claim 1, wherein The number of amplification clusters on the surface of the solid substrate is n, the number of nucleotides constituting the barcode sequence is m, and n and m satisfy: 4 m ≥n; Optionally, n is a natural number greater than or equal to 28; Optionally, the area of each amplified cluster is 0.25-100 μm 2 ; Optionally, the number of copies of the nucleic acid molecule in each amplification cluster is 10-10 5 indivual; Optionally, the distance between adjacent amplification clusters is 0.1-10 μm.

3. The preparation method according to claim 1, wherein The first single-stranded nucleotide library further comprises a first capture sequence, and the barcode sequence is located at one end of the first capture sequence; Optionally, in the step of fixing the first single-stranded nucleotide library on the surface of a solid substrate, the first capture sequence is bound to the surface of the solid substrate; Optionally, the first capture sequence is connected to the surface of the solid substrate through chemical bonding, physical adsorption, electrostatic adsorption, or van der Waals force; Optionally, the surface of the solid substrate is bound to a compound, and the first capture sequence is connected to the surface of the solid substrate via the compound; Optionally, the surface of the solid substrate has a first group, the compound has a second group, the first group and the second group are a group having chemical reaction activity, and the compound is bound to the surface of the solid substrate through the group; Optionally, the group is selected from an amino-carboxylic acid group, an amino-ester group, an amino-halogen group, an amino-aldehyde group, an amino-epoxy group, a thiol-imine group, an azide-alkynyl group, an azide-alkenyl group, and a cycloalkenyl-tetrazine group; Optionally, the compound is selected from one or more of amino compounds, carboxylate compounds, succinimide or its analogs, pentafluorophenol ester or its analogs, aryl halides, maleimide or its analogs, epoxy compounds, aldehyde-containing compounds, azide-containing compounds, norbornene or its analogs, DBCO or its analogs, tetrazine and its analogs; Optionally, the surface of the solid substrate has a first reactant, the first capture sequence has a second reactant, the first reactant and the second reactant are reactive, and the first capture sequence is connected to the surface of the solid substrate via the first reactant and the second reactant; Optionally, the first reactant is different from the second reactant, and the first reactant and the second reactant are each independently selected from an antigen and an antibody, or the first reactant and the second reactant are each independently selected from biotin and streptavidin; Optionally, the first single-stranded nucleotide library further comprises a second capture sequence, and the second capture sequence is connected to an end of the barcode sequence away from the first capture sequence; Optionally, a PolyN is provided between the second capture sequence and the barcode sequence, wherein the N is selected from one of A or its derivatives, T / U or its derivatives, G or its derivatives, and C or its derivatives; Optionally, the first capture sequence and the second capture sequence have breakage sites; Optionally, the cleavage site is at least one of a photocleavable site, a chemical cleavable site, and an enzyme cleavage site; Optionally, when the break site is an enzyme cleavage site, the barcode sequence does not contain the same sequence as the break site; Optionally, the step of linearizing the amplified cluster includes: adding a restriction endonuclease and enzymatically cutting the amplified cluster at the restriction site.

4. The preparation method according to any one of claims 1 to 3, wherein The surface of the solid phase substrate is a plane, a spherical surface or a non-planar shape formed by dendritic polymers; Optionally, the surface of the solid substrate has a nanotrap or nanopore, and the first single-stranded nucleotide library is immobilized in the nanotrap or nanopore; Optionally, the solid substrate surface is derived from a surface having an area twice or more than that of the solid substrate surface. Before obtaining the space chip, the method further includes: cutting the solid substrate surface into chip units of a preset size; Optionally, the method further comprises: fixing one or more of the chip units on the surface of a solid carrier according to a preset arrangement.

5. A space chip, characterized in that: The chip substrate comprises a plurality of separated single-stranded nucleic acid amplification clusters on at least one surface thereof, wherein the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and different single-stranded nucleic acid amplification clusters have different nucleotide sequences; The single-stranded nucleic acid amplification cluster has known physical coordinates relative to the spatial chip, the single-stranded nucleic acid molecules include at least a barcode sequence with a known sequence, and the barcode sequence of each first single-stranded nucleic acid molecule corresponds one-to-one to the physical coordinates.

6. The space chip according to claim 5, characterized in that: The number of amplification clusters on the chip substrate is n, the number of nucleotides constituting the barcode sequence is m, and n and m satisfy the following: m ≥n; Optionally, n is a natural number greater than or equal to 28; Optionally, the area of each single-stranded nucleic acid amplification cluster is 0.25-100 μm 2 ; Optionally, in each of the single-stranded nucleic acid amplification clusters, the copy number of the single-stranded nucleic acid molecule is 10-10 5 indivual; Optionally, the distance between adjacent single-stranded nucleic acid amplification clusters is 0.1-10 μm; Optionally, the single-stranded nucleic acid molecule further comprises a first capture sequence, and the barcode sequence is located at one end of the first capture sequence; Optionally, the first capture sequence is connected to the chip substrate; Optionally, the first capture sequence is connected to the chip substrate through chemical bonding, physical adsorption, electrostatic adsorption, or van der Waals force; Optionally, the chip substrate is bound to a compound, and the first capture sequence is connected to the chip substrate via the compound; Optionally, the chip substrate has a first group, the compound has a second group, the first group and the second group are a group having chemical reaction activity, and the compound is bound to the chip substrate through the group; Optionally, the group is selected from an amino-carboxylic acid group, an amino-ester group, an amino-halogen group, an amino-aldehyde group, an amino-epoxy group, a thiol-imine group, an azide-alkynyl group, an azide-alkenyl group, and a cycloalkenyl-tetrazine group; Optionally, the compound is selected from one or more of amino compounds, carboxylate compounds, succinimide or its analogs, pentafluorophenol ester or its analogs, aryl halides, maleimide or its analogs, epoxy compounds, aldehyde-containing compounds, azide-containing compounds, norbornene or its analogs, DBCO or its analogs, tetrazine and its analogs; Optionally, the chip substrate has a first reactant, the first capture sequence has a second reactant, the first reactant and the second reactant are reactive, and the first capture sequence is connected to the chip substrate via the first reactant and the second reactant; Optionally, the first reactant is different from the second reactant, and the first reactant and the second reactant are each independently selected from an antigen and an antibody, or the first reactant and the second reactant are each independently selected from biotin and streptavidin; Optionally, the single-stranded nucleoside molecule further comprises a second capture sequence, and the second capture sequence is connected to an end of the barcode sequence away from the first capture sequence; Optionally, a PolyN is provided between the second capture sequence and the barcode sequence, wherein the N is selected from one of A or its derivatives, T / U or its derivatives, G or its derivatives, and C or its derivatives; Optionally, the first capture sequence and the second capture sequence have breakage sites; Optionally, the cleavage site is at least one of a photocleavable site, a chemical cleavable site, and an enzyme cleavage site; Optionally, when the break site is an enzyme cleavage site, the barcode sequence does not contain the same sequence as the break site; Optionally, the chip substrate is a plane, a spherical surface or other irregular surface; Optionally, the chip substrate has a nanowell or nanopore, and the single-stranded nucleic acid amplification cluster is fixed in the nanowell or nanopore; Optionally, the space chip has two or more chip substrates, and the chip substrates are fixed on the surface of the solid phase carrier according to a preset arrangement.

7. Application of the spatial chip prepared by the method according to claims 1-4 or the spatial chip according to any one of claims 5-6 in the field of spatial omics.

8. A composition, characterized in that The invention comprises a space chip, wherein the space chip comprises a chip substrate, at least one surface of the chip substrate comprises a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and different single-stranded nucleic acid amplification clusters have different nucleotide sequences; The single-stranded nucleic acid amplification cluster has known physical coordinates relative to the spatial chip, and the single-stranded nucleic acid molecule includes a barcode sequence with a known sequence, and a first acquisition sequence and a second capture sequence respectively connected to both ends of the barcode sequence, wherein the first acquisition sequence is connected to the surface of the chip substrate, and the barcode sequence of each first single-stranded nucleic acid molecule corresponds to the physical coordinates one by one; Optionally, the space chip is the space chip according to any one of claims 5 or 6; Optionally, the composition further comprises a second single-stranded nucleotide library, wherein the second single-stranded nucleotide library comprises a first base sequence, a second base sequence, and a capture portion, wherein the first base sequence is a known sequence, the second base sequence is a tag sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the tag sequence is different; Optionally, the first base sequence, the second base sequence and the capture portion are connected in sequence, wherein the first base sequence is complementary to the second capture sequence, and the capture portion is a primer sequence; Optionally, the primer sequence is poly-dT, poly-dA, random primer or target molecule primer; Optionally, the capture portion is a transposase, and the first base sequence and the second base sequence are located in the transposase; Optionally, the first base sequence, the second base sequence and the capture part are connected in sequence, wherein the first base sequence is complementary to the second capture sequence, and the capture part is a nucleic acid aptamer, a protein, an enzyme or an antibody.

9. A spatial reverse transcription method, characterized in that: The steps include: A space chip and a second single-stranded nucleotide library are provided, wherein the space chip includes a chip substrate, at least one surface of the chip substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different, the single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first capture sequence and a second capture sequence respectively connected to both ends of the barcode sequence, the first capture sequence is connected to the surface of the chip substrate, and the barcode sequence of each first single-stranded nucleotide molecule corresponds to the physical coordinates one by one; the second single-stranded nucleotide library includes a first base sequence, a second base sequence and a capture portion connected in sequence, the first base sequence is a known sequence complementary to the second capture sequence, the second base sequence is a tag sequence, the capture portion is a primer sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the tag sequence is different; contacting the cell or tissue sample to be tested with the spatial chip and the second single-stranded nucleotide library, so that RNA in the cell or tissue sample to be tested is bound to the spatial chip through the second single-stranded nucleotide library; Excising the space chip and collecting the excision products; sequencing the excision products and analyzing the obtained sequencing data; Optionally, when the cell or tissue sample to be tested is a tissue sample, the tissue sample is a tissue section; Optionally, the thickness of the tissue section is less than or equal to 50 μm; Optionally, the step of contacting the cell or tissue sample to be tested with the spatial chip and the second single-stranded nucleotide library includes: After the cell or tissue sample to be tested is brought into contact with the spatial chip, the second single-stranded nucleotide library is added; Optionally, analyze the obtained sequencing data, including: Based on the sequencing data, obtaining position information of the barcode sequence in the excised product in the spatial chip; Based on the position information, the excision product is spatially restored to achieve spatial reverse transcription analysis.

10. An ATAC sequencing method, characterized in that The steps include: A space chip and a second single-stranded nucleotide library are provided, wherein the space chip includes a chip substrate, at least one surface of the chip substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different, the single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first capture sequence and a second capture sequence respectively connected to both ends of the barcode sequence, the first capture sequence is connected to the surface of the chip substrate, and the barcode sequence of each first single-stranded nucleotide molecule corresponds to the physical coordinates one by one; the second single-stranded nucleotide library includes a first base sequence, a second base sequence and a capture portion, the first base sequence is a known sequence, the second base sequence is a tag sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the tag sequence is different, the capture portion is a transposase, and the first base sequence and the second base sequence are located in the transposase; contacting the cell or tissue sample to be tested with the spatial chip and the second single-stranded nucleotide library, so that ATAC in the cell or tissue sample to be tested is bound to the spatial chip through the second single-stranded nucleotide library; Excising the space chip and collecting the excision products; sequencing the excision products and analyzing the obtained sequencing data; Optionally, when the cell or tissue sample to be tested is a tissue sample, the tissue sample is a tissue section; Optionally, the thickness of the tissue section is less than or equal to 50 μm; Optionally, the step of contacting the cell or tissue sample to be tested with the spatial chip and the second single-stranded nucleotide library includes: After the cell or tissue sample to be tested is brought into contact with the spatial chip, the second single-stranded nucleotide library is added; Optionally, analyze the obtained sequencing data, including: Based on the sequencing data, obtaining position information of the barcode sequence in the excised product in the spatial chip; Based on the position information, the excision products are spatially restored to achieve ATAC sequencing analysis.

11. A spatial protein analysis method, characterized in that: The steps include: A space chip and a second single-stranded nucleotide library are provided, wherein the space chip includes a chip substrate, at least one surface of the chip substrate has a plurality of separated single-stranded nucleic acid amplification clusters, the single-stranded nucleic acid molecules in the single-stranded nucleic acid amplification clusters have the same nucleotide sequence, and the nucleotide sequences of different single-stranded nucleic acid amplification clusters are different, the single-stranded nucleic acid amplification clusters have known physical coordinates relative to the space chip, and the single-stranded nucleic acid molecules include a barcode sequence with a known sequence, and a first capture sequence and a second capture sequence respectively connected to both ends of the barcode sequence, and the first capture sequence is connected to the surface of the chip substrate; the second single-stranded nucleotide library includes a first base sequence, a second base sequence and a capture portion connected in sequence, the first base sequence is a known sequence complementary to the second capture sequence, the second base sequence is a tag sequence, and the first base sequence of each nucleotide in the second single-stranded nucleotide library is the same, but the tag sequences are different; contacting a cell or tissue sample to be tested with the space chip and the second single-stranded nucleotide library, so that the target in the sample to be tested that is bindable to the capture portion is bound to the space chip through the second single-stranded nucleotide library; Excising the space chip and collecting the excision products; sequencing the excision products and analyzing the obtained sequencing data; Optionally, the capture moiety is a nucleic acid aptamer, protein, enzyme or antibody; Optionally, the sample to be tested is a cell or tissue sample to be tested; Optionally, when the cell or tissue sample to be tested is a tissue sample, the tissue sample is a tissue section; Optionally, the thickness of the tissue section is less than or equal to 50 μm; Optionally, the step of contacting the cell or tissue sample to be tested with the spatial chip and the second single-stranded nucleotide library includes: After the cell or tissue sample to be tested is brought into contact with the spatial chip, the second single-stranded nucleotide library is added; Optionally, analyze the obtained sequencing data, including: Based on the sequencing data, obtaining position information of the barcode sequence in the excised product in the spatial chip; Based on the position information, the excision products are spatially restored to achieve spatial protein analysis.

Images