FISH probe for detecting HIF3A gene, kit and application

Abstract

The invention relates to the technical field of medical detection, in particular to a FISH (fluorescence in situ hybridization) probe for detecting an HIF3A gene, and the nucleotide sequence of the FISH probe comprises: the 3'end is composed of a 20bp base sequence and is used for being combined with a pre-amplification probe; the 5'end consists of a base sequence of 19bp and can be specifically combined with mRNA of the HIF3A gene. The FISH probe is gradually combined with the pre-amplification probe and the amplification probe and is finally combined with the developing probe, so that a consistent fluorescence signal is displayed. Finally, the probe is combined with a developing probe carrying a specific fluorescent dye, and a detection result shows a corresponding fluorescent signal. The 5'end of the probe is composed of a 19bp base sequence and can be specifically combined with HIF3A gene mRNA, so that accurate detection is realized. The probe is small in molecular weight, can easily enter cells, can be used for detecting low-level expressed HIF3A genes in tissues and cells, is relatively high in specificity and sensitivity, and is beneficial to early screening and diagnosis of cerebral apoplexy.

Description

Technical Field

[0001] The present invention relates to the field of medical detection technology, and in particular to a FISH probe, a kit and applications for detecting the HIF3A gene. Background Art

[0002] The HIF3A gene (hypoxia-inducible factor 3 subunit A) plays an important role in biological functions, especially in the response of cells to hypoxic environments. Members of the HIF family generally serve as major regulators of cells under hypoxic conditions, and the HIF3A gene plays a key role in regulating these responses. In particular, studies have shown that changes in the expression of the HIF3A gene under hypoxic conditions are closely related to the pathological processes of various diseases, including stroke. Stroke is one of the leading causes of death and long-term disability worldwide, and hypoxia and ischemic injury are the key pathological features of stroke. The upregulation of the HIF3A gene under hypoxic conditions is believed to be involved in neuroprotective mechanisms, so the detection of its expression can provide a valuable biomarker to assist in early diagnosis and prognostic assessment after stroke.

[0003] However, current methods for HIF3A gene detection have certain limitations. Traditional detection methods such as RT-PCR (reverse transcription polymerase chain reaction) and Western Blot can provide information about gene expression levels, but these methods lack specificity and sensitivity. For example, although RT-PCR is a commonly used method for quantifying gene expression, it may be interfered with by nonspecific amplification when processing complex tissue samples, leading to false-positive results. In addition, Western Blot requires a large number of sample processing steps, is time-consuming, and may lack sensitivity for detecting low-abundance genes such as HIF3A. Therefore, although these traditional methods are still widely used in genetic testing, their scope of application is limited, especially in clinical diagnosis where high specificity and sensitivity are required.

[0004] Against this backdrop, fluorescence in situ hybridization (FISH), an emerging molecular detection tool, has demonstrated unique advantages in genetic testing. FISH uses fluorescently labeled probes to directly hybridize with target nucleic acid sequences in cells or tissues, enabling in situ visualization of gene presence and expression. This method not only provides quantitative information on target genes but also pinpoints their specific location within cells, making it irreplaceable in histological research. Another key advantage of FISH is its high specificity, achieved by designing probes that are highly complementary to the target sequence. Furthermore, FISH offers high sensitivity, enabling the detection of low-abundance gene expression, which is particularly important for genes such as HIF3A. Compared to RT-PCR and Western blotting, FISH offers higher detection efficiency and lower false-positive rates, demonstrating significant potential for clinical diagnosis, particularly in the early screening of complex diseases. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention provides a FISH probe, kit, and application for detecting the HIF3A gene. By designing a highly specific and sensitive FISH probe, the present invention accurately detects HIF3A gene expression, particularly for the early screening and diagnosis of stroke and other related diseases. Through its unique probe design, the present invention enables efficient, rapid, and accurate detection of the HIF3A gene in complex biological samples, providing a powerful tool for clinical diagnosis.

[0006] To achieve the above objectives, the present invention is implemented by the following technical solution: a FISH probe for detecting the HIF3A gene, wherein the nucleic acid sequence of the FISH probe comprises:

[0007] The 3' end consists of a 20 bp base sequence (GUACGGAGAGAGCAGUGAGG) for binding to the preamplification probe;

[0008] The 5' end consists of a 19bp base sequence (UCUGACAGGAGGACCAGCC) and can specifically bind to the HIF3A gene mRNA.

[0009] Preferably, the FISH probe is gradually combined with a pre-amplification probe, an amplification probe, and finally with a color development probe, thereby displaying a consistent fluorescent signal.

[0010] Preferably, the FISH probes include the following:

[0011] Pre-amplification probe: Its nucleic acid sequence binds to the 20bp base sequence at the 3' end of the probe;

[0012] Amplification probe: Its nucleic acid sequence is complementary to the repeat sequence of the pre-amplification probe and binds to the colorimetric probe;

[0013] Colorimetric probe: The 5' end is modified with a fluorescent group and has a binding sequence that is complementary to the repeat sequence of the amplification probe.

[0014] Preferably, a kit for detecting the HIF3A gene, wherein the colorimetric probe in the kit can be combined with a colorimetric probe carrying a specific fluorescent dye, and the detection result displays a corresponding fluorescent signal.

[0015] The present invention provides a FISH probe, kit, and application for detecting the HIF3A gene, which has the following beneficial effects:

[0016] 1. The FISH probe for the HIF3A gene designed by the present invention is innovative in principle. The 3' end of the probe consists of a 20bp base sequence and is designed to bind to a pre-amplification probe. This design ensures that the probe can highly specifically recognize and bind to the target sequence of the HIF3A gene, avoiding non-specific binding with other genes. In addition, the 5' end of the probe consists of a 19bp base sequence, which can bind to the specific sequence of the HIF3A gene mRNA, thereby achieving accurate detection of HIF3A gene expression. By gradually combining with a series of pre-amplification probes and color development probes, the display of fluorescent signals is ultimately achieved. This layer-by-layer amplification and color development design greatly enhances the signal intensity of the detection, ensuring that the presence of the target gene can still be clearly detected under low-abundance expression conditions.

[0017] 2. The FISH probe of the present invention shows obvious advantages in many aspects. First, in terms of detection speed, the probe of the present invention can quickly enter cells and bind to the target sequence, greatly shortening the detection time. Secondly, in terms of signal intensity, through the combination of multiple amplifications and chromogenic probes, the detection signal is significantly enhanced, ensuring that a strong fluorescent signal can still be obtained under conditions of low expression levels. In addition, the probe design in the present invention takes into account the optimization of molecular weight, making it easier to penetrate the cell membrane, which not only improves the cell permeability of the probe, but also reduces the potential toxicity to cells and increases the safety of the detection. Therefore, the probe of the present invention not only performs well in laboratory studies, but also has potential clinical application value, particularly in the early screening and diagnosis of serious diseases such as stroke.

[0018] 3. By accurately detecting HIF3A gene expression, the present invention can help clinicians identify high-risk patients earlier, allowing for timely treatment and reducing the disease's mortality and disability rates. Furthermore, due to the high specificity and sensitivity of FISH technology, the probe of the present invention can also be used to diagnose other diseases involving HIF3A gene abnormalities, expanding its scope of application and possessing significant clinical and research value.

[0019] 4. This invention significantly improves the efficiency, accuracy, and safety of HIF3A gene testing through innovative probe design and detection methods, providing important technical support for the early diagnosis of serious diseases such as stroke. The probe's high specificity, high sensitivity, and small molecular weight give it significant advantages in clinical applications, opening up new possibilities for early disease screening and diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the mass spectrometry image of the FISH probe of the present invention;

[0021] Figure 2 Schematic diagram of the FISH probe used in the present invention to detect the expression intensity of HIF3A in cerebrospinal fluid cells;

[0022] Figure 3 This is a schematic diagram of the FISH probe of the present invention detecting the expression intensity of HIF3A in blood cells. DETAILED DESCRIPTION

[0023] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0024] The present invention provides a FISH probe for detecting the HIF3A gene. The nucleic acid sequence of the FISH probe includes:

[0025] The 3' end consists of a 20 bp base sequence (GUACGGAGAGAGCAGUGAGG) for binding to the preamplification probe;

[0026] The 5' end consists of a 19bp base sequence (UCUGACAGGAGGACCAGCC) and can specifically bind to the HIF3A gene mRNA.

[0027] The 3' end of the probe consists of a 20bp base sequence (GTACGGAGAGAGCAGTGAGG), which is specifically designed to bind to the pre-amplification probe. This design ensures that the probe can efficiently bind to the specific sequence of the target gene and avoids nonspecific binding to other genes. In addition, the 5' end of the probe consists of a 19bp base sequence (UCUGACAGGAGGACCAGCC), which can specifically bind to the mRNA of the HIF3A gene, enabling accurate detection of target gene expression.

[0028] FISH probes gradually combine with pre-amplification probes, amplification probes, and finally with color development probes to display consistent fluorescent signals.

[0029] During the detection process, the probe first binds to the target sequence, then gradually binds to the pre-amplification probe and the amplification probe, ultimately binding to the chromogenic probe, resulting in a consistent fluorescent signal. This multi-stage amplification design not only enhances signal strength but also ensures the accuracy of the test results. The chromogenic probe carries a specific fluorescent dye, and the final test result is presented as a corresponding fluorescent signal, facilitating intuitive observation and analysis.

[0030] FISH probes include the following:

[0031] Pre-amplification probe: Its nucleic acid sequence binds to the 20bp base sequence at the 3' end of the probe;

[0032] Amplification probe: Its nucleic acid sequence is complementary to the repeat sequence of the pre-amplification probe and binds to the colorimetric probe;

[0033] Colorimetric probe: The 5' end is modified with a fluorescent group and has a binding sequence that is complementary to the repeat sequence of the amplification probe.

[0034] The probe design takes into account the HIF3A gene-specific base sequences, which differ significantly from those of other genes, ensuring detection specificity. Furthermore, through multiple signal amplification and the use of specific probes, the present invention achieves sensitive detection of low-abundance HIF3A genes. This feature makes the probe valuable for early disease screening, particularly for detecting genes with low expression levels.

[0035] Example 1:

[0036] The present invention provides a method for preparing a FISH probe for detecting the HIF3A gene, comprising the following steps:

[0037] Step 1: Probe sequence design

[0038] (1) Based on the mRNA sequence of the HIF3A gene, select a suitable specific region using bioinformatics software (such as Primer-BLAST). The designed probe should ensure high specificity and effective binding to the target sequence.

[0039] (2) The 3' end of the probe is designed to have a 20 bp base sequence: GTACGGAGAGAGCAGTGAGG, which is used to bind to the pre-amplification probe.

[0040] (3) The 5' end of the probe was designed to have a 19 bp base sequence: UCUGACAGGAGGACCAGCC, which is used to specifically bind to the HIF3A gene mRNA.

[0041] Step 2: Solid-phase synthesis of probes

[0042] (4) Use an automatic DNA / RNA synthesizer (such as ABI 394 DNA / RNA synthesizer) to synthesize the probe.

[0043] (5) The synthesis reaction adopts the standard phosphate triester method and is carried out as follows:

[0044] Deprotection: The DMT protecting group on the 5'-hydroxyl group was removed by treatment with 3% trichloroacetic acid (TCA) for 10 minutes.

[0045] Condensation: 0.1 M tetrazolium activator was used to react with the corresponding nucleotide phosphoryl chloride for 60 seconds.

[0046] Oxidation: Treat the synthesized oligonucleotide with 0.02 M iodine water to oxidize it into a stable phosphotriester bond. The reaction time is 60 seconds.

[0047] Deprotection and cleavage: Treat with concentrated ammonia and heat at 55°C for 4 hours to remove the base protecting groups and cleave the probe from the solid support.

[0048] Step 3: Probe purification

[0049] (6) The probe was purified by high performance liquid chromatography (HPLC) to ensure high purity. A C18 reverse phase column was used, with mobile phase A consisting of 100 mM triethylamine acetate buffer (pH 7.0) and mobile phase B consisting of acetonitrile. Gradient elution was performed: 0-5 min, 5% acetonitrile; 5-30 min, 5% to 50% acetonitrile.

[0050] (7) Collect the purified probe, remove the solvent using a rotary evaporator, and resuspend the probe in anhydrous ethanol.

[0051] Step 4: Fluorescent labeling of probes

[0052] (8) The purified probe was dissolved in 0.1 M NaHCO_3 buffer (pH 8.3) at a concentration of 1 mM.

[0053] (9) Add fluorescent dyes (such as Alexa 488, concentration 1 mM), and the reaction was carried out at 25°C for 2 hours with gentle shaking to promote the reaction.

[0054] (10) After the reaction is completed, the probe-fluorescently labeled product is separated by a molecular sieve column (such as Sephadex G-25) to collect the fluorescently labeled probe.

[0055] Step 5: Probe Quantification and Storage

[0056] (11) Use a nanospectrophotometer (such as NanoDrop TM ) Measure the probe concentration, typically at 260 nm. The probe concentration should be between 50-100 μM to be suitable for subsequent experiments.

[0057] (12) The probe solution was divided into light-proof vials and stored at −20 °C to avoid photodegradation of the fluorescent dye.

[0058] Step 6: Probe Quality Verification

[0059] (13) The purity of the probe was verified by agarose gel electrophoresis (2% agarose gel, TBE buffer) to ensure that a single fluorescent band indicated successful synthesis and labeling of the probe.

[0060] (14) The functionality of the probe was further verified by FISH experiments to ensure that the fluorescence signal intensity after hybridization was sufficient to detect the target sequence.

[0061] Step 7: Prepare the probe for use

[0062] (15) Before experimental use, the probe should be diluted to an appropriate working concentration (usually 5–20 ng / μL) and prepared immediately before use to ensure probe activity.

[0063] Example 2:

[0064] The present invention provides a method for detecting HIF3A gene expression using a FISH probe, comprising the following steps:

[0065] Step 1: Collection and pretreatment of target cell or tissue samples

[0066] (1) Collection and fixation of cell samples:

[0067] Cells in the logarithmic growth phase were collected from the cell culture, digested with trypsin (0.25%), washed twice with PBS buffer (pH 7.4), and then centrifuged (500×g, 5 minutes) to collect the cell pellet.

[0068] The cell pellet was resuspended in 4% paraformaldehyde solution and fixed for 10 minutes at room temperature (about 25° C.) After fixation, the cells were washed three times with PBS buffer for 5 minutes each time.

[0069] (2) Collection and fixation of tissue samples:

[0070] Cut 3-5mm from fresh tissue 3 The small pieces were immediately placed in cold 4% paraformaldehyde solution for fixation for 24 hours at 4°C.

[0071] After fixation, the tissue was dehydrated and embedded in paraffin. The paraffin-embedded tissue was cut into 4 μm thick sections using a microtome and mounted on a slide.

[0072] (3) Cell permeabilization:

[0073] The cell samples were permeabilized with 0.5% Triton X-100 solution (prepared in PBS) at 4°C for 10 minutes to destroy the cell membrane and increase the probe permeability.

[0074] Wash 3 times for 5 min each using PBS buffer to remove the permeabilization agent.

[0075] (4) Tissue section permeabilization:

[0076] The tissue sections on glass slides were baked at 60°C for 30 minutes to remove the paraffin.

[0077] Dewax with xylene solution (room temperature) three times, 5 minutes each time, then dehydrate in 100%, 95%, and 70% ethanol in sequence, 5 minutes each time, and finally wash with distilled water.

[0078] Step 2: Hybridization of FISH probes to samples

[0079] (5) Preparation of hybridization solution:

[0080] Prepare hybridization buffer containing 50% formamide, 2×SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 10% skim milk powder, and 0.5% SDS. Dilute the probe (HIF3A gene probe) to a final concentration of 5-20 ng / μL and add it to the hybridization buffer.

[0081] (6) Mixing of probe and sample:

[0082] Pipette 20-30 μL of hybridization solution onto each sample on the slide, ensuring that the sample is completely covered. Gently cover with a coverslip to avoid the formation of bubbles.

[0083] (7) Sample hybridization:

[0084] Place the slides in a humidified chamber, add a small amount of distilled water to the bottom of the chamber to maintain humidity, and place the chamber in a 37°C incubator for 12-16 hours of hybridization reaction.

[0085] Step 3: Washing of samples after hybridization

[0086] (8) Preliminary washing after hybridization:

[0087] After hybridization, the slides were washed twice in 2×SSC solution preheated to 37°C for 5 minutes each time to remove unbound probes.

[0088] (9) High temperature washing:

[0089] The cells were then washed in 0.1×SSC solution at 55° C. in a water bath for 5 minutes to further remove non-specifically bound probes.

[0090] (10) Wash at room temperature:

[0091] Finally, the slides were placed in room temperature PBS buffer and gently washed three times for 5 minutes each.

[0092] Step 4: Hybridization of chromogenic probes and signal enhancement

[0093] (11) Preparation and application of chromogenic probes:

[0094] The colorimetric probe (such as Alexa 555 colorimetric probe) was diluted to a concentration of 5-10 ng / μL and mixed into hybridization buffer (50% formamide, 2×SSC, 0.5% SDS).

[0095] The colorimetric probe solution was dropped onto the sample on the slide, covered with a cover glass, and incubated in a 37°C humidified chamber for 2 hours.

[0096] (12) Washing of colorimetric probe:

[0097] After the hybridization of the color probe is completed, the sample is washed twice with 2×SSC solution at 37°C for 5 minutes each time.

[0098] The cells were then washed in 0.1×SSC solution at 55°C for 5 minutes to remove unbound chromogenic probe.

[0099] Step 5: Sample observation and analysis

[0100] (13) Sealing of samples:

[0101] After washing, rinse the slides with PBS buffer. ) to avoid weakening of the fluorescence signal.

[0102] (14) Fluorescence microscopy observation:

[0103] Observe the sample using a fluorescence microscope (e.g., Leica DM6000B). Select appropriate filter combinations (e.g., FITC and TRITC filters) to distinguish signals from probes labeled with different fluorescent markers.

[0104] The expression of the HIF3A gene in different samples was compared, and the expression level of the target gene was determined by observing the intensity and distribution of the fluorescence signal.

[0105] Step 6: Data Analysis

[0106] (15) Fluorescence intensity quantification:

[0107] Use image analysis software (such as ImageJ) to analyze the fluorescence images, quantitatively measure the intensity of the fluorescence signal, and standardize the results.

[0108] The results were compared with the control group to assess the relative changes in HIF3A gene expression.

[0109] (16) Experimental repeatability verification:

[0110] To ensure the reliability of the experimental results, repeat the above experimental steps at least three times, statistically analyze the fluorescence intensity data, and calculate the mean and standard error to ensure the repeatability and reliability of the experiment.

[0111] Example 3:

[0112] The present invention provides a method for verifying the specificity and sensitivity of HIF3A gene expression detection, comprising the following steps:

[0113] Step 1: Cell line preparation

[0114] (1) Select a HeLa cell line that overexpresses the HIF3A gene and a HEK293 cell line that underexpresses the HIF3A gene. Culture each cell line until the logarithmic growth phase.

[0115] Step 2: FISH detection

[0116] (2) According to the steps of Example 2, FISH detection was performed on the two cell lines, and the intensity of the fluorescence signal was recorded respectively.

[0117] Step 3: Data Analysis

[0118] (3) By quantitative analysis of fluorescence intensity, the differences in fluorescence signals in cell lines with different expression levels were compared to verify the specificity and sensitivity of the probe.

[0119] Example 4:

[0120] The present invention provides a method for applying a HIF3A gene FISH probe in clinical diagnosis, comprising the following steps:

[0121] Step 1: Clinical sample collection

[0122] (1) Collection of blood samples:

[0123] Draw 5-10 mL of venous blood from patients suspected of having a stroke. Collect the sample in an EDTA-anticoagulant tube to prevent blood clotting. Store the sample immediately at 4°C and process within 2 hours if possible.

[0124] (2) Collection of cerebrospinal fluid samples:

[0125] Under strict aseptic conditions, 1-2 mL of cerebrospinal fluid samples were collected by lumbar puncture. The samples were placed in sterile tubes and immediately stored at 4°C. Ensure that they were processed within 1 hour to prevent sample degradation.

[0126] Step 2: Sample processing and FISH detection

[0127] (3) Blood sample processing:

[0128] Centrifuge the blood sample at 1500 × g for 10 minutes at 4°C to separate the plasma and discard. Resuspend the remaining cell pellet in 1 mL of PBS buffer and repeat the wash three times to ensure removal of residual plasma components.

[0129] The treated cell suspension was fixed in 4% paraformaldehyde solution for 15 minutes, and then washed three times with PBS buffer for 5 minutes each time. Finally, the cell pellet was resuspended in 500 μL PBS buffer for later use.

[0130] (4) Cerebrospinal fluid sample processing:

[0131] The cerebrospinal fluid samples were centrifuged at 2000×g for 5 minutes at 4°C, the supernatant was discarded, and the cell pellet was collected.

[0132] Resuspend the pelleted cells in 500 μL of PBS buffer and gently pipette to mix. Place the cell suspension dropwise onto a slide pre-coated with polylysine. After drying, fix the slides with 4% paraformaldehyde for 15 minutes. Wash the slides three times with PBS buffer for 5 minutes each.

[0133] (5) FISH test preparation:

[0134] Following the procedures described in the previous example, cells were permeabilized with 0.5% Triton X-100 solution at 4°C for 10 minutes, followed by three 5-minute washes with PBS. Cell samples were then dehydrated in 70%, 85%, and 100% ethanol, sequentially for 5 minutes each, and finally air-dried at room temperature.

[0135] (6) Hybridization step:

[0136] Prepare FISH hybridization solution using a HIF3A gene-specific probe at a concentration of 10 ng / μL. The hybridization solution consists of 50% formamide, 2× SSC, 10% skim milk powder, and 0.5% SDS. Add the hybridization solution to the sample, cover with a coverslip, and place in a humidified chamber for hybridization at 37°C for 12-16 hours.

[0137] (7) Washing step:

[0138] After hybridization, the slides were washed twice with 2× SSC solution preheated to 37°C for 5 minutes each to remove unbound probes, then washed in 0.1× SSC solution at 55°C for 5 minutes, and finally washed three times with PBS buffer at room temperature for 5 minutes each.

[0139] Step 3: Result analysis and diagnosis

[0140] (8) Fluorescence microscopy observation:

[0141] Mount the treated slides with a mounting solution containing an anti-fluorescence attenuation agent and observe under a fluorescence microscope. Select appropriate filter combinations to observe the FITC and TRITC signals, respectively, and record the fluorescence intensity of the probe binding site.

[0142] (9) Clinical symptoms combined analysis:

[0143] Combined with the patient's clinical symptoms (such as sudden headache, speech disorders, hemiplegia, etc.) and the strength and distribution of the fluorescence signal, the expression and cellular localization changes of the HIF3A gene can be judged, providing a basis for early diagnosis.

[0144] (10) Data recording and personalized treatment plan formulation:

[0145] Image analysis software is used to quantitatively analyze the fluorescence signal and generate a data report. The analysis results are recorded in the patient's medical record, and based on the changes in HIF3A gene expression and cell localization, doctors are assisted in formulating personalized treatment plans, such as whether to perform thrombolytic therapy or antiplatelet therapy. Figure 2 As shown, the expression intensity of HIF3A in blood cells detected by FISH probe is as follows Figure 3 shown.

[0146] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A FISH probe for detecting the HIF3A gene, characterized in that: The nucleic acid sequence of the FISH probe includes: The 3' end consists of a 20 bp base sequence (GUACGGAGAGAGCAGUGAGG) for binding to the preamplification probe; The 5' end consists of a 19bp base sequence (UCUGACAGGAGGACCAGCC) and can specifically bind to the HIF3A gene mRNA.

2. A FISH probe for detecting the HIF3A gene according to claim 1, characterized in that: The FISH probe is gradually combined with a pre-amplification probe, an amplification probe, and finally with a color development probe, thereby displaying a consistent fluorescent signal.

3. A FISH probe for detecting the HIF3A gene according to claim 2, characterized in that: The FISH probes include the following: Pre-amplification probe: Its nucleic acid sequence binds to the 20bp base sequence at the 3' end of the probe; Amplification probe: Its nucleic acid sequence is complementary to the repeat sequence of the pre-amplification probe and binds to the colorimetric probe; Colorimetric probe: The 5' end is modified with a fluorescent group and has a binding sequence that is complementary to the repeat sequence of the amplification probe.

4. A kit for detecting the HIF3A gene according to any one of claims 1 to 3, characterized in that: The colorimetric probe in the kit can be combined with a colorimetric probe carrying a specific fluorescent dye, and the detection result shows a corresponding fluorescent signal.

5. Use of a FISH probe for detecting the HIF3A gene according to any one of claims 1 to 3 in the preparation of a reagent and / or kit for stroke diagnosis.

Images