Marker combination for early screening of multiple cancers and application thereof

By detecting the target sequence methylation status of SHOX2 and ZKSCAN8P1 genes, using nucleic acid compositions of primers and probes, the problem of insufficient sensitivity and specificity of screening for multiple cancers in the prior art is solved, and efficient in vitro screening for multiple cancers is achieved, reducing screening costs.

CN120442797APending Publication Date: 2025-08-08BIOCHAIN BEIJING SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510661030.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-21
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

Existing early-stage cancer screening and diagnostic techniques such as imaging examinations and endoscopy have problems such as high false positive rates, high false negative rates, strong invasiveness, high cost and complex operations, which are difficult to meet the needs of large-scale popularization and efficient screening of many common high-incidence and high-death cancers.

Method used

Using a nucleic acid composition, sensitive and specific detection of various cancers is achieved by detecting the target sequence methylation status of the SHOX2 gene and/or ZKSCAN8P1 gene, primers and probes are used for in vitro screening, and treatment with DNA polymerase and bisulfite reagents.

Benefits of technology

It improves the sensitivity and specificity of in vitro screening of cancer, reduces screening costs, is suitable for physical examinations, and realizes convenient and fast screening of a variety of cancers. It is suitable for in vitro screening of six common high-incidence and high-death cancers, including lung cancer, liver cancer, gastric cancer, intestinal cancer, esophageal cancer, and ovarian cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005414314410000171
    Figure BDA0005414314410000171
  • Figure BDA0005414314410000181
    Figure BDA0005414314410000181
Patent Text Reader

Abstract

The invention provides a nucleic acid composition for simultaneously screening multiple cancers in vitro and application of the nucleic acid composition, the composition comprises nucleic acid for detecting the methylation state of a target gene, the methylation state of the target gene is characterized by methylation of a target sequence of the target gene, and the target gene is an SHOX2 gene and / or a ZKSCAN8P1 gene. The invention also provides a kit comprising the composition, and application of the composition in preparation of the kit for screening various cancers in vitro.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application belongs to the field of molecular biology and relates to gene detection, and specifically to a nucleic acid composition for in vitro screening of methylation of multiple cancer-related genes and its corresponding kit and use. Background Art

[0002] Currently, cancers with high morbidity and mortality rates worldwide include lung cancer, liver cancer, stomach cancer, intestinal cancer, esophageal cancer, and ovarian cancer. In clinical practice, early-stage cancers can be cured. However, because early cancer symptoms are not obvious, by the time patients present to a hospital with obvious clinical symptoms, most tumors are already in the middle or late stages, making treatment ineffective. The five-year survival rate after surgery is less than 30%. Therefore, early diagnosis and treatment are key to improving cancer patient survival.

[0003] Currently, the technical means used in clinical practice for early screening and diagnosis of lung cancer mainly include imaging examinations, hematological examinations, and pathological examinations, but these methods all have certain limitations: for example, obtaining lung cancer tissue for pathological examination through surgery or puncture is the gold standard for lung cancer diagnosis, but it is difficult to operate and highly traumatic to patients; low-dose spiral CT (LD-CT) chest scans can reduce the overall lung cancer mortality rate by increasing the detection rate of early lung cancer, but at the same time, its high false positive rate and possible radiation damage are worrying; serological tumor markers, such as the five lung cancer items (CEA, CYFRA21-1, SCC, Pro-GRP, NSE), are commonly used in clinical practice as auxiliary diagnostic methods for lung cancer, but these traditional serological tumor markers have low sensitivity for detecting early lung cancer and cannot meet the requirements of early screening.

[0004] Currently, the technical means used in clinical practice for early screening and diagnosis of liver cancer mainly include the traditional "abdominal ultrasound + blood alpha-fetoprotein" screening method. However, this method is far from meeting the needs of clinical screening for early HCC. There are problems such as low screening implementation rate, low sensitivity for early HCC screening, and changes in the underlying causes of liver cancer posing new challenges to HCC screening.

[0005] Currently, the technical means used clinically for early screening and diagnosis of gastric cancer mainly include gastroscopy (electronic gastroscopy, high-definition screening gastroscopy and magnetically controlled capsule gastroscopy, etc.) and serological screening (Hp testing, serum PG, G-17 and common tumor markers). Gastroscopy is an invasive examination with complex preoperative preparations. The cost of magnetically controlled capsule gastroscopy is higher than that of traditional electronic gastroscopy, and the effective and reasonable allocation of resources is limited. Common serum blood screening markers are not sensitive enough and have low specificity.

[0006] Currently, the main clinically used technologies for early screening and diagnosis of colorectal cancer include stool-based methods, including the fecal immunochemical test (FIT), and colonoscopy. FIT is the most widely used early screening technique for colorectal cancer, but its specificity is low and it has a high incidence of false positives. Colonoscopy is the most sensitive test for detecting intestinal tumors, but its detection rate is affected by factors such as bowel preparation, endoscopic technique, the examiner's ability to identify lesions, and examination time. Bowel preparation requires drinking large amounts of water before colonoscopy, and the risk of perforation during the examination limits colonoscopy as a primary method for large-scale screening. Fiberoptic sigmoidoscopy is only diagnostic for the portion of the colon being examined, and its application is limited. Digital rectal examination can effectively detect low-lying rectal tumors and is recommended for those undergoing physical examinations, but its value in screening for rectal tumors is unclear.

[0007] Currently, the main clinical techniques used for early screening and diagnosis of esophageal cancer include endoscopy and pathological biopsy. There is a lack of "pre-screening" measures for esophageal cancer similar to gastric cancer screening (such as serological testing), making it difficult to improve the screening positive rate. In addition, the combined operation of endoscopic iodine staining or electronic staining of the esophageal mucosa and indicative biopsy has become the most practical and effective screening method in my country at this stage. Previously used screening methods such as esophageal cytology and upper gastrointestinal barium examinations are no longer used for esophageal cancer screening due to low diagnostic efficiency and the risk of esophageal damage.

[0008] Currently, the main clinical methods for early screening and diagnosis of ovarian cancer include ultrasound and serum marker testing. However, existing research data based on the general population shows that neither carbohydrate antigen (CA) 125 nor transvaginal ultrasound screening alone, nor the combination of the two, achieves satisfactory screening results. Further exploration of screening methods for the general population is needed.

[0009] Large-scale clinical data analysis has found that for the six types of cancer mentioned above, imaging examinations have a high rate of false positives or false negatives, posing a risk of overdiagnosis or missed diagnosis. In addition, imaging examinations have certain limitations in terms of equipment costs, operating techniques, result interpretation, and radiation hazards. Various endoscopic examinations are highly invasive and unsuitable for large-scale popularization. If the general physical examination population wishes to complete screening and diagnosis of the six high-incidence and high-fatality cancers mentioned above, they need to register for examinations in the corresponding departments one by one, which is time-consuming, costly, and inefficient. Summary of the Invention

[0010] It has been confirmed that abnormal hypermethylation of the promoter region of tumor suppressor genes inhibits the transcription of corresponding tumor suppressor genes, reducing or silencing gene expression, leading to a weakening or loss of the gene's tumor suppressor function, and thus promoting the occurrence and progression of lung cancer. Abnormal DNA methylation often occurs in the very early stages of cancer and serves as a "seed" factor for tumor growth. Furthermore, as the cancer progresses, the DNA methylation state also undergoes dynamic changes, which can directly reflect the growth of tumor lesions. Therefore, the use of DNA methylation testing for early cancer screening and auxiliary diagnosis has great application potential.

[0011] In response to the problems existing in the detection technology of the above-mentioned six common, highly prevalent and lethal cancers (lung cancer, liver cancer, gastric cancer, intestinal cancer, esophageal cancer, and ovarian cancer), the present application provides a nucleic acid composition for simultaneous in vitro screening of multiple cancers. The composition provided by the present application can sensitively and specifically detect lung cancer, liver cancer, gastric cancer, intestinal cancer, esophageal cancer, and ovarian cancer. The present application also provides a kit comprising the composition and its use in detecting the above-mentioned multiple cancers. The kit provided by the present application has good cancer detection sensitivity, can sample once, and conveniently, quickly, and effectively screen the above-mentioned six common, highly prevalent and lethal cancers at the same time.

[0012] The specific technical solutions of this application are as follows:

[0013] 1. A nucleic acid composition for simultaneous in vitro screening of multiple cancers, comprising:

[0014] Nucleic acid used to detect the methylation status of target genes,

[0015] Wherein, the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene,

[0016] Wherein, the target gene is SHOX2 gene and / or ZKSCAN8P1 gene.

[0017] 2. The composition according to item 1, wherein the target sequence of the SHOX2 gene is as shown in any one of SEQ ID NOs: 1-4, or the target sequence of the SHOX2 gene includes the sequence as shown in any one of SEQ ID NOs: 1-4.

[0018] 3. The composition according to item 1, wherein the target sequence of the ZKSCAN8P1 gene is as shown in any one of SEQ ID NOs: 5-8, or the target sequence of the ZKSCAN8P1 gene includes a sequence as shown in any one of SEQ ID NOs: 5-8.

[0019] 4. The composition according to any one of items 1 to 3, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0020] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene,

[0021] The fragment comprises at least one CpG dinucleotide sequence.

[0022] 5. The composition according to any one of items 1 to 4, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0023] A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions,

[0024] The fragment comprises at least one CpG dinucleotide sequence.

[0025] 6. The composition according to any one of items 1 to 5, further comprising:

[0026] A reagent that converts unmethylated cytosine bases at position 5 of the target sequence of the target gene into uracil.

[0027] 7. The composition according to any one of items 1 to 6, wherein

[0028] The fragment of at least 9 nucleotides is the sequence of SEQ ID NO: 9 and SEQ ID NO: 10, or the sequence of SEQ ID NO: 12 and SEQ ID NO: 13.

[0029] 8. The composition according to item 7, wherein the fragment of at least 15 nucleotides is the sequence of SEQ ID NO: 11 or the sequence of SEQ ID NO: 14.

[0030] 9. An oligonucleotide for in vitro screening of multiple cancers, comprising:

[0031] A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1-4 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or

[0032] A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 5-8 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

[0033] 10. The oligonucleotide according to item 9, further comprising:

[0034] A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 1-4 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence; and / or

[0035] A fragment that hybridizes to at least 15 nucleotides of the sequence shown in any one of SEQ ID NOs: 5-8 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence.

[0036] 11. An oligonucleotide for in vitro screening of multiple cancers, comprising:

[0037] The sequences of SEQ ID NO:9 and SEQ ID NO:10.

[0038] 12. The oligonucleotide according to item 11, further comprising:

[0039] The sequence of SEQ ID NO:11.

[0040] 13. An oligonucleotide for in vitro screening of multiple cancers, comprising:

[0041] Sequences of SEQ ID NO:12 and SEQ ID NO:13.

[0042] 14. The oligonucleotide according to item 13, further comprising:

[0043] The sequence of SEQ ID NO:14.

[0044] 15. A kit comprising the composition according to any one of items 1 to 8 or the oligonucleotide according to any one of items 9 to 14.

[0045] 16. The kit according to item 15, further comprising at least one other component selected from the group consisting of:

[0046] Nucleoside triphosphates, DNA polymerase, and buffer required for the function of the DNA polymerase.

[0047] 17. A kit according to claim 15 or 16, wherein the samples used for detection by the kit include: cell lines, histological sections, tissue biopsy / paraffin-embedded tissue, body fluids, feces, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.

[0048] 18. The kit according to any one of items 15 to 17, further comprising: instructions.

[0049] 19. Use of the composition according to any one of items 1 to 8 or the oligonucleotide according to any one of items 9 to 14 in preparing a kit for in vitro screening of multiple cancers.

[0050] 20. The use according to item 19, wherein the kit for in vitro screening of multiple cancers screens cancers by a method comprising the following steps:

[0051] 1) isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested;

[0052] 2) determining the methylation status of the target sequence of the target gene;

[0053] 3) The status of the biological sample is judged by the detection result of the methylation status of the target sequence of the target gene, thereby realizing in vitro screening of cancer.

[0054] 21. The use according to item 20, wherein the method comprises the steps of:

[0055] Extracting genomic DNA from the biological sample to be tested;

[0056] The extracted genomic DNA is treated with reagents to convert the unmethylated cytosine base at position 5 into uracil or other bases;

[0057] contacting the DNA sample treated with the reagent with a DNA polymerase and a primer of a target sequence of a target gene to perform a DNA polymerization reaction;

[0058] detecting the amplified product with a probe; and

[0059] Based on the presence or absence of the amplified product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.

[0060] 22. The use according to item 21, wherein the reagent is a bisulfite reagent.

[0061] 23. Use of the SHOX2 gene and / or the ZKSCAN8P1 gene in preparing a kit for in vitro screening of multiple cancers.

[0062] 24. The use according to item 23, wherein the target sequence of the SHOX2 gene is as shown in any one of SEQ ID NOs: 1-4 or the target sequence of the SHOX2 gene includes the sequence as shown in any one of SEQ ID NOs: 1-4.

[0063] 25. The use according to item 23, wherein the target sequence of the ZKSCAN8P1 gene is as shown in any one of SEQ ID NOs: 5-8 or the target sequence of the ZKSCAN8P1 gene includes the sequence as shown in any one of SEQ ID NOs: 5-8.

[0064] This application has the following beneficial effects:

[0065] This application utilizes the methylation markers, primer-probe compositions, nucleic acid sequences and their uses, as well as the above-mentioned detection methods, and realizes the use of target gene target sequence methylation biomarkers to simultaneously perform in vitro screening for multiple cancers by detecting the methylated nucleic acid sequences of target gene target sequences and their fragments, thereby effectively improving the sensitivity and specificity of in vitro cancer screening, and being non-invasive, and more suitable for use in physical examination populations, without the need for screening individual cancers one by one, saving screening costs. Therefore, the present application provides a nucleic acid composition, a kit, and a detection method that can be used for in vitro screening of multiple cancers, which can conveniently, quickly, and effectively screen the above-mentioned six cancers and has important clinical application value. DETAILED DESCRIPTION

[0066] The present application is described in detail below. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. Instead, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0067] Unless otherwise indicated, the implementation of this application will adopt conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry and genetics techniques, which are all within the scope of conventional technical means in this area. Such techniques are described in detail in the literature such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, 1984 edition); Animal Cell Culture (RI Freshney, 1987 edition); Methods in Enzymology series (Academic Press, Inc., USA); Current Protocols in Molecular Biology (FM Ausubel et al., 1987 edition, and regular updates); PCR: The Polymerase Chain Reaction (Mullis et al., 1994 edition). The primers, probes, and kits used in this application can be prepared using standard techniques well known in the art.

[0068] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0069] definition

[0070] The term "precancer" or "early stage cancer" as used herein refers to cells that are in the early stages of transformation into cancer cells or are prone to transformation into cancer cells. Such cells may exhibit one or more phenotypic traits characteristic of cancer cells.

[0071] As used herein, "stringent hybridization conditions" and "high stringency" refer to conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and are different in different environments. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, "A Review of Hybridization Principles and Nucleic Acid Assay Strategies," in Techniques in Biochemistry and Molecular Biology - Nucleic Acid Probe Hybridization. Typically, stringent conditions are about 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength pH. At the Tm temperature (defined ionic strength, pH, and nucleic acid concentration), 50% of the probes complementary to the target hybridize uniformly to the target sequence. Stringent conditions can also be achieved by adding destabilizing agents. For selective or specific hybridization, the positive signal is twice the background hybridization, preferably 10 times. Exemplary stringent hybridization conditions are as follows: hybridization in a solution of 50% formamide, 5x SSC and 1% SDS at 42°C, or hybridization in a solution of 5x SSC and 1% SDS at 65°C, followed by washing in a solution of 0.2x SSC and 0.1% SDS at 65°C.

[0072] Furthermore, nucleic acids that fail to hybridize under stringent conditions are still substantially similar if the polypeptides they encode are substantially similar. In such cases, nucleic acids are typically hybridized under moderately stringent hybridization conditions. By way of example, "moderately stringent hybridization conditions" include hybridization in a solution of 40% formamide, 1 M sodium chloride, and 1% SDS at 37°C, and washing in a solution of 1xSSC at 45°C. Guidance for achieving conditions that achieve the same degree of stringency will readily be available to those skilled in the art. For PCR, a temperature of approximately 36°C is typically suitable for low-stringency amplification, while annealing temperatures range from 32°C to 48°C, depending on primer length. For high-stringency PCR amplification, 62°C is generally used, while annealing temperatures for high-stringency hybridization range from 50°C to 65°C, depending on primer length and specificity. Cycling conditions for high stringency and low stringency amplifications typically include a denaturation phase at 90-95° C. for 30 seconds to 2 minutes, an annealing phase for 30 seconds to 2 minutes, and an extension phase at approximately 72° C. for 1 to 2 minutes. Tools and guidance for low and high stringency amplification reactions are available in the art.

[0073] " oligonucleotide " in the application refers to the molecule that is made up of two or more nucleotide, is preferably the molecule that is made up of more than three nucleotide, and its accurate size can rely on many factors, and these factors are in turn determined by the final function and the purposes of oligonucleotide.In some embodiments, oligonucleotide can comprise the length of 10 nucleotide to 100 nucleotide.In some embodiments, oligonucleotide can comprise the length of 10 nucleotide to 30 nucleotide, perhaps can have the length of 20 and 25 nucleotide.In some specific embodiments, it is also suitable to be shorter than the oligonucleotide of these lengths.

[0074] The application's " primer " means when placed under conditions that can induce the synthesis of primer extension products complementary to the nucleic acid chain, i.e., in the presence of nucleotides and an inducer such as DNA or RNA polymerase and at a suitable temperature and pH, an oligonucleotide that can serve as a synthesis starting point, whether naturally occurring or synthetically produced in a purified restriction digest. The primer can be single-stranded or double-stranded and must be long enough to induce the synthesis of the desired extension product in the presence of an inducer. The exact length of the primer depends on various factors, including temperature, primer source, and the method used. For example, for diagnosis and prognosis applications, according to the complexity of the target sequence, an oligonucleotide primer typically contains at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides, but it can contain fewer nucleotides or more nucleotides. The factors involved in determining the appropriate length of the primer are well known to those skilled in the art.

[0075] A "primer pair" as used herein refers to a primer pair that hybridizes to opposite strands of a target DNA molecule or to a region of the target DNA that flanks the nucleotide sequence to be amplified.

[0076] As used herein, a "primer site" refers to a region of a target DNA or other nucleic acid to which a primer hybridizes.

[0077] The "probe" of this application, when referring to a nucleic acid sequence, is used in its usual sense to refer to a selected nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. A probe is a single-stranded or double-stranded DNA with a length ranging from tens to hundreds or even thousands of base pairs. It can utilize the high accuracy of molecular denaturation, annealing, and base complementary pairing to hydrogen bond (hybridize) with complementary non-labeled single-stranded DNA or RNA in the sample to be tested to form a double-stranded complex (hybrid). It will be understood by those skilled in the art that in some cases, a probe can also be used as a primer, and a primer can be used as a probe.

[0078] "DNA methylation" in this application refers to the addition of a methyl group to the 5th position of cytosine (C), which is usually (but not necessarily) in the case of CpG (cytosine followed by guanine) dinucleotides. As a relatively stable modification state, under the action of DNA methyltransferase, it can be inherited to the newborn daughter DNA along with the DNA replication process, which is an important epigenetic mechanism. During DNA methylation, methylation of the gene promoter region can lead to transcriptional silencing of tumor suppressor genes, so it is closely related to the occurrence of tumors. Abnormal methylation includes hypermethylation of tumor suppressor genes and DNA repair genes, hypomethylation of repetitive sequence DNA, and loss of imprinting of certain genes, which are relevant to the occurrence of various tumors. As used herein, "increased methylation level" or "significant methylation level" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C is unmethylated in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues), and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.

[0079] In embodiments, a variety of different methods can be used to detect DNA methylation changes. The method for detecting DNA methylation includes, for example, utilizing Southern or polymerase chain reaction (PCR) analysis of methylation-sensitive restriction endonucleases (MSRE) assays, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high resolution melting (HRM) analysis, bisulfite sequencing, pyrophosphate sequencing, methylation-specific single-stranded conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarrays (MSO). These determinations can be PCR analysis, quantitative analysis using fluorescent labels, or Southern blot analysis.

[0080] A "methylation assay" as used herein refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.

[0081] "Detection" in this application refers to any process of observing a marker or marker change (such as a change in the methylation state of a marker or the expression level of a nucleic acid or protein sequence) in a biological sample, regardless of whether the marker or marker change is actually detected. In other words, the act of detecting a marker or marker change in a sample is "detection", even if the marker is determined to be absent or below a sensitivity level. Detection can be a quantitative, semi-quantitative or non-quantitative observation and can be based on comparison with one or more control samples. It should be understood that screening for the six cancers disclosed herein includes screening for precancerous cells that are beginning to develop into cancer cells or are about to develop into cancer cells, or have an increased tendency to develop into cancer cells. Screening for the above six cancers can also include screening for possible probability of death or possible prognosis of the disease condition.

[0082] "Homology", "identity" and "similarity" in this application refer to the sequence similarity between two nucleic acid molecules. "Homology", "identity" or "similarity" can be determined by comparing the positions in each sequence, and the sequences can be aligned for the purpose of comparison. When the equivalent position in the compared sequences is occupied by the same base, the molecules are identical at that position; when the equivalent site is occupied by the same or similar amino acid (for example, similar in spatial properties or charged properties) residue, the molecules can be said to be homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to a function of the number of identical or similar amino acids at the position shared by the compared sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity with the sequences of this application. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces identity and homology / similarity. In a specific embodiment, two or more sequences or subsequences are considered to be substantially or significantly homologous, similar or identical if their sequences are about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region as determined using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below or by manual alignment and visual inspection, for example, as provided online by the National Center for Biotechnology Information (NCBI). This definition also relates to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context herein, a nucleotide sequence that is complementary to a specified target sequence or a variant thereof is itself considered "similar" to the target sequence, for example, if the nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally as one or both of the complementary strands, and references to "similar" nucleic acid sequences include single-stranded sequences, their complementary sequences, double-stranded complexes, sequences that are capable of encoding the same or similar polypeptide products, and any permitted variants of any of the foregoing. Instances where similarity must be limited to analysis of a single nucleic acid strand sequence can include, for example, the detection and quantification of expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In embodiments, the identity or similarity can be over a region that is at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25, or more nucleotides in length, or over a region that is more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or more than about 100 nucleotides in length.

[0083] As used herein, "amplification" refers to the process of obtaining multiple copies of a particular genome of nucleic acid, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known means, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0084] The "fluorescence-based real-time PCR" in this application refers to a method in which a fluorescent group is added to the PCR reaction system, the entire PCR process is monitored in real time using the accumulation of fluorescent signals, and finally the unknown template is quantitatively analyzed using a standard curve. In this PCR technology, there is a very important concept, the cycle threshold, also known as the Ct value. C stands for Cycle, and t stands for threshold. The meaning of the Ct value is: the number of cycles experienced when the fluorescent signal in each reaction tube reaches the set threshold. For example, the method for setting the fluorescence threshold is as follows: the fluorescent signal of the first 15 cycles of the PCR reaction is used as the fluorescence background signal, and the default (default) setting of the fluorescence threshold is 10 times the standard deviation of the fluorescent signal of cycles 3-15.

[0085] The "real-time PCR cutoff value" herein refers to a critical ΔCt value (ΔCt = target gene Ct minus reference gene Ct) for determining the positive or negative status of a sample for a particular biomarker. According to certain embodiments of the present application, the "critical ΔCt value (cutoff value)" is obtained based on statistical processing of a certain number of sample data. This critical ΔCt value may vary depending on the desired sensitivity or specificity.

[0086] The "sensitivity" in this application refers to the proportion of cancer detected from a certain cancer sample, and its calculation formula is: sensitivity = (detected cancer / all cancers), while "specificity" refers to the proportion of normal detected in a certain healthy person sample, and its calculation formula is specificity = (detected negative / total negative).

[0087] As used herein, a "label" or "detectable moiety" is a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxigenin, or haptens and proteins can be made detectable, for example, by incorporating a radioactive label into the peptide or by detecting antibodies that specifically react with the peptide.

[0088] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blot, Northern blot or in situ hybridization). Specifically, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying target nucleic acids can be used for PCR reactions. PCR methods generally include the following steps: obtaining a sample, isolating nucleic acid (e.g., DNA, RNA or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers, which specifically hybridize to the template nucleic acid under conditions that enable template nucleic acid amplification to occur. In the presence of the template nucleic acid, an amplification product is produced. The conditions for nucleic acid amplification and amplification product detection are well known to those skilled in the art. A variety of improvements to basic PCR technology have been developed, including but not limited to anchored PCR, RACE PCR, RT-PCR and ligase chain reaction (LCR). The primer pairs in the amplification reaction must anneal to the relative strands of the template nucleic acid and should maintain a suitable distance from each other so that the polymerase can effectively polymerize across the region and can, for example, easily detect the amplification product using electrophoresis. For example, oligonucleotide primers can be designed using a computer program such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) to assist in designing primers with similar melting temperatures. Typically, oligonucleotide primers are 9-30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length), but oligonucleotide primers can be longer or shorter, as long as appropriate amplification conditions are used.

[0089] Detection of the amplification product or hybridization complex is typically achieved using a detectable label. The term "label," when referring to nucleic acids, is intended to include direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, as well as indirect labeling of nucleic acids by reacting with another reagent that is directly labeled with a detectable substance. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin. Examples of indirect labeling include end-labeling of a nucleic acid with biotin, such that the nucleic acid can be detected using fluorescently labeled streptavidin.

[0090] Details

[0091] Liquid biopsy technology uses body fluids such as blood, saliva, and urine as test materials and tumor markers as detection indicators to achieve early screening and diagnosis of cancer, assist in staging, prognosis and recurrence monitoring, and provide medication guidance. It has the advantages of being non-invasive, efficient, and accurate. Among them, using abnormal changes in DNA methylation levels as a marker for molecular diagnosis of tumors is one of the current research hotspots and is gradually becoming a consensus in the scientific and medical communities. DNA methylation is an important epigenetic modification and is involved in regulating various cellular processes, including embryonic development, gene transcription, X chromosome inactivation, genomic imprinting, and chromatin structure stability. Therefore, abnormal DNA methylation is closely related to the occurrence of complex human diseases. In normal cells, cytosines in CpG islands and some CG-rich sites are usually unmethylated, while cytosine bases in regions with a low CG ratio are mostly in a hypermethylated state. However, in many cancers, the methylation pattern is exactly the opposite. Multiple studies have shown that high methylation of CpG islands can inhibit or silence the expression of some tumor suppressor genes and DNA mismatch repair genes, while low methylation in other regions of the genome can promote the expression of proto-oncogenes, which can endow normal cells with carcinogenic properties and promote the occurrence of cancer. In addition, abnormal DNA methylation often occurs in the very early stages of cancer and is the "seed" factor of tumor growth. As the cancer progresses, the methylation status of DNA also changes dynamically, which can directly reflect the growth of tumor lesions. Therefore, the use of DNA methylation detection for early cancer screening and auxiliary diagnosis has great application potential.

[0092] On the one hand, the present application provides a nucleic acid composition for in vitro screening of multiple cancers, the composition comprising a nucleic acid for detecting the methylation status within a target sequence of a target gene, wherein the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is the SHOX2 gene and / or the ZKSCAN8P1 gene.

[0093] The present application provides a set of target sequences of target genes that are abnormally methylated in various cancers, including target sequences of the SHOX2 gene and the ZKSCAN8P1 gene. The target sequence of the SHOX2 gene is shown in any one of SEQ ID NOs: 1-4, or includes a sequence as shown in any one of SEQ ID NOs: 1-4. The target sequence of the ZKSCAN8P1 gene is shown in any one of SEQ ID NOs: 5-8, or includes a sequence as shown in any one of SEQ ID NOs: 5-8.

[0094] Those skilled in the art will also understand that the target sequence of the SHOX2 gene and / or ZKSCAN8P1 gene is not limited to the specific sequences listed above. The target sequence of the SHOX2 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 1-4, but are still substantially functionally identical thereto, and also include sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 1-4, and also include sequences that delete one or more nucleotides, add one or more nucleotides, or replace one or more nucleotides based on the nucleotide sequence shown in any one of SEQ ID NOs: 1-4 but have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 1-4. The target sequence of the ZKSCAN8P1 gene should include a sequence comprising one, two, or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 5-8, but having substantially the same essential function as the sequence shown in any one of SEQ ID NOs: 5-8, a sequence having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 5-8, and a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 5-8 by deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides.

[0095] The target sequences of SHOX2 (5'-3') are as follows:

[0096] CTTCTGCCAAATAGCAGTTAAGAAATAAGTTCCCTTCCTCTTTTTCTCTCCCGTTTGTCTTTCGATTTTTTTGTTTGCTCATTTTTTCATTGTTAACAAGATTTTTTTTTCTATGCAAGAGTCCATCGTTGCAGCTTTGCGGTGAGCCAAACTCCGCGGTTCCAGCACTCCCCTGTCCAGTCTCTCTCCAGACTCCCCCAAACCCGCTCCTACAAAACCCAATTCTAGGCCCTCGAGTAGGAAAACGGGCAGGAGCCACGGAGCCTGCGTGCCTCGTGAGATCCCTGGTCCTGCGTGGAGTCTGGCTTTCCGAGTCCAAGATGCGATAGGGGACGAGGGATGGTCAGTGAGGCGGGAAGAGGGCCGGCTCCCGAGGTCTCAAAGGGGTAA(SEQ ID NO:1)

[0097] The reverse complementary sequences of the target sequences of SHOX2 (5'-3') are as follows:

[0098] TTACCCCTTTGAGACCTCGGGAGCCGGCCCTCTTCCCGCCTCACTGACCATCCCTCGTCCCCTATCGCATCTT GGACTCGGAAAGCCAGACTCCACGCAGGACCAGGGATCTCACGAGGCACGCAGGCTCCGTGGCTCCTGCCCGTTTTCCTACTCGAGGGCCTAGAATTGGGTTTTGTAGGAGCGGGTTTGGGGGAGTCTGGAGAGAGACTGGACAGGGGAGTGCTGGAACCGCGGAGTTTGGCTCACCGCAAAGCTGCAACGATGGACTCTTGCATAGAAAAAAAAATCTTGTTAACAATGAAAAAATGAGCAAACAAAAAAATCGAAAGACAAACGGGAGAGAAAAAGAGGAAGGGAACTTATTTCTTAACTGCTATTTGGCAGAAG(SEQ ID NO:2)

[0099] The sequences of SHOX2 target sequences after bisulfite treatment (5'-3') are as follows:

[0100] TTTTTGTTAAATAGTAGTTAAGAAATAAGTTTTTTTTTTTTTTTTTTTTTTCGTTTGTTTTTCGATTTTTTTGTTTGTTTATTTTTTTATTGTTAATAAGATTTTTTTTTTTATGTAAGAGTTTATCGTTGTAGTTTTGCGGTGAGTTAAATTTCGCGGTTTTAGTATTTTTTTGTTTAGTTTTTTTTTAGATTTTTTTAAATTCGTTTTTATAAAATTTAATTTTAGGTTTTCGAGTAGGAAAACGGGTAGGAGTTACGGAGTTTGCGTGTTTCGTGAGATTTTTGGTTTTGCGTGGAGTTTGGTTTTTCGAGTTTAAGATGCGATAGGGGACGAGGGATGGTTAGTGAGGCGGGAAGAGGGTCGGTTTTCGAGGTTTTAAAGGGGTAA(SEQ ID NO:3)

[0101] The reverse complementary sequence of the target sequence of SHOX2 after bisulfite treatment (5'-3') is as follows:

[0102] TTATTTTTTTGAGATTTCGGGAGTCGGTTTTTTTTTCGTTTTATTGATTATTTTTCGTTTTTTATCGTATTTTGGATTCGGAAAGTTAGATTTTACGTAGGATTAGGGATTTTACGAGGTACGTAGGTTTCGTGGTTTTTGTTCGTTTTTTTATTCGAGGGTTTAGAATTGGGTTTTGTAGGAGCGGGTTTGGGGGAGTTTGGAGAGAGATTGGATAGGGGAGTGTTGGAATCGCGGAGTTTGGTTTATCGTAAAGTTGTAACGATGGATTTTTGTATAGAAAAAAAAATTTTGTTAATAATGAAAAAATGAGTAAATAAAAAAATCGAAAGATAAACGGGAGAGAAAAAGAGGAAGGGAATTTATTTTTTAATTGTTATTTGGTAGAAG(SEQ ID NO:4)

[0103] The target sequence of the ZKSCAN8P1 gene (5'-3') is as follows:

[0104] CAGTATCGCAGTCATGTTTTGAAAATATTGTTCTTGGTTCTTGTCTCTAATCTTTGAGAAAGCACACAGGATATAGTGTGTTGGCTTTCAGATCACTAATAATTAAGACCAGAGTTCTGTGGCCCCGTGTGTCGCTTTAAGGGATCCTGTAGGGCCCACACGAGAAATTTCACCAACTGCACTATCTTTAAATTCCAACATACACGGGTGGTCCTGCCCTGGATAAAACTCA (SEQ ID NO: 5)

[0105] The reverse complementary sequence (5'-3') of the target sequence of the ZKSCAN8P1 gene is as follows:

[0106] TGAGTTTTATCCAGGGCAGGACCACCCGTGTATGTTGGAATTTAAAGATAGTGCAGTTGGTGAAATTTCTCGTGTGGGCCCTACAGGATCCCTTAAAGCGACACACGGGGCCACAGAACTCTGGTCTTAATTATTAGTGATCTGAAAGCCACACACTATATCCTGTGTGCTTTCTCAAAGATTAGAGACAAGAACCAAGAACAATATTTTCAAAACATGACTGCGATACTG(SEQ ID NO:6)

[0107] The target sequence of the ZKSCAN8P1 gene after bisulfite treatment (5'-3') is as follows:

[0108] TAGTATCGTAGTTATGTTTTGAAAATATTGTTTTTGGTTTTTGTTTTTAATTTTTGAGAAAGTATATAGGATATAGTGTGTTGGTTTTTAGATTATTAATAATTAAGATTAGAGTTTTGTGGTTTCGTGTGTCGTTTTAAGGGATTTTGTAGGGTTTATACGAGAAATTTTATTAATTGTATTATTTTTAAATTTTAATATATACGGGTGGTTTTGTTTTGGATAAAATTTA (SEQ ID NO: 7)

[0109] The complementary sequence of the target sequence of the ZKSCAN8P1 gene after bisulfite treatment (5'-3') is as follows:

[0110] TGAGTTTTATTTAGGGTAGGATTATTCGTGTATGTTGGAATTTAAAGATAGTGTAGTTGGTGAAATTTTTCGTGTGGGTTTTATAGGATTTTTTAAAGCGATATACGGGGTTATAGAATTTTGGTTTTTAATTATTAGTGATTTGAAAGTTAATATATTATATTTTGTGTTTTTTTAAAGATTAGAGATAAGAATTAAGAATAATATTTTTTAAAATATGATTGCGATATTG (SEQ ID NO: 8)

[0111] The target sequences and related sequences of SHOX2 gene and ZKSCAN8P1 gene are shown in Table 1:

[0112] Table 1: Target sequences and related sequences of each gene

[0113] Target sequence name Serial number SHOX2 target sequence SEQ ID NO: 1 Reverse complement of the SHOX2 target sequence SEQ ID NO:2 SHOX2 target sequence after bisulfite treatment SEQ ID NO:3 The reverse complement of the SHOX2 target sequence after bisulfite treatment SEQ ID NO:4 Target sequence of the ZKSCAN8P1 gene SEQ ID NO:5 Reverse complementary sequence of the target sequence of the ZKSCAN8P1 gene SEQ ID NO:6 Target sequence of the ZKSCAN8P1 gene after bisulfite treatment SEQ ID NO:7 The reverse complementary sequence of the target sequence of the ZKSCAN8P1 gene after bisulfite treatment SEQ ID NO:8

[0114] Preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides in the target sequence of the target gene, wherein the fragment comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, if bisulfite is used to convert the test sample DNA, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment comprises at least one CpG dinucleotide sequence.

[0115] More preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderate stringency or stringent conditions, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence. In certain preferred embodiments, if bisulfite is used to convert the test sample DNA, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, that hybridizes to the target sequence of the target gene after bisulfite conversion under moderate stringency or stringent conditions, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.

[0116] Preferably, the composition further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil. More preferably, the reagent is bisulfite.

[0117] Preferably, the composition comprises one or more of the primers and probes shown in Table 2:

[0118] Table 2 Sequences of primers and probes used in this application

[0119] Sequence number sequence name Specific nucleotide sequence (5'-3') SEQ ID NO:9 SHOX2_F TAGGATTAGGGATTTTACGAGGTAC SEQ ID NO: 10 SHOX2_R CTAAACCCTCGAATAAAAAAACG SEQ ID NO:11 SHOX2_P CGTAGGTTTCGTGGTTTTTGTTCG SEQ ID NO:12 ZKSCAN8P1_F AGATAGTGTAGTTGGTGAAATTTTTC SEQ ID NO:13 ZKSCAN8P1_R CAAAATTCTATAACCCCGTATATCG SEQ ID NO:14 ZKSCAN8P1_P CGTGTGGGTTTTATAGGATTTTTTAAAGCG

[0120] In Table 2, "F" represents a forward primer; "R" represents a reverse primer; and "P" represents a probe.

[0121] In certain embodiments, the composition further comprises an agent that converts the unmethylated cytosine base at position 5 of the gene into uracil. Preferably, the agent is bisulfite. Bisulfite modification of DNA is a known tool for assessing the methylation status of CpGs. In the DNA of eukaryotic cells, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior as cytosine. In addition, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The method most commonly used to analyze the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, unmethylated cytosine is converted to uracil, which corresponds to thymine in pairing behavior; but under these conditions, 5-methylcytosine remains unmodified. Thus the original DNA is transformed in this way so that the 5-methylcytosine, which originally could not be distinguished from cytosine in its hybridization behavior, can now be detected as the only remaining cytosine by conventional known molecular biology techniques, such as by amplification and hybridization. All of these techniques are based on different base pairing properties and can now be fully utilized. Therefore, typically, the application provides the combined use of bisulfite technology and one or more methylation assays to determine the methylation state of the CpG dinucleotide sequence in the target sequence of the target gene. In addition, the method of the present application is suitable for analyzing heterogeneous biological samples, such as low-concentration tumor cells in blood or feces. Therefore, when analyzing the methylation state of the CpG dinucleotide sequence in this sample, those skilled in the art can use quantitative determination methods to determine the methylation level (such as percentage, number, ratio, proportion or degree) of the specific CpG dinucleotide sequence, rather than the methylation state. Accordingly, the term methylation status or methylation state should also be considered to refer to the value reflecting the methylation state of the CpG dinucleotide sequence.

[0122] On the other hand, the present application provides oligonucleotides for in vitro screening of multiple cancers, comprising: a fragment of at least 9 nucleotides of a sequence shown in any one of SEQ ID NOs: 1-4, or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence shown in any one of SEQ ID NOs: 5-8, or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

[0123] Preferably, the oligonucleotides for in vitro screening of multiple cancers include: a fragment of at least 9 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 1-4 or a complementary sequence thereof; and / or a fragment of at least 9 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 5-8 or a complementary sequence thereof and containing at least one CpG dinucleotide sequence.

[0124] The oligonucleotides for in vitro screening of multiple cancers of the present application also include: a fragment that hybridizes to at least 15 nucleotides of a sequence shown in any one of SEQ ID NOs: 1-4 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence; and / or a fragment that hybridizes to at least 15 nucleotides of a sequence shown in any one of SEQ ID NOs: 5-8 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence.

[0125] Preferably, the oligonucleotides for in vitro screening of multiple cancers include: a fragment of at least 15 nucleotides that hybridizes under moderately stringent or stringent conditions to a sequence after bisulfite conversion of the sequence shown in any one of SEQ ID NOs: 1-4 or its complementary sequence and comprises at least one CpG dinucleotide sequence; and / or a fragment of at least 15 nucleotides that hybridizes under moderately stringent or stringent conditions to a sequence after bisulfite conversion of the sequence shown in any one of SEQ ID NOs: 5-8 or its complementary sequence and comprises at least one CpG dinucleotide sequence.

[0126] In a specific embodiment, the oligonucleotides for in vitro screening of multiple cancers include the sequences of SEQ ID NO: 9 and SEQ ID NO: 10 and also include the sequence of SEQ ID NO: 11.

[0127] In another specific embodiment, the oligonucleotides for in vitro screening of multiple cancers include the sequences of SEQ ID NO: 12 and SEQ ID NO: 13 and also include the sequence of SEQ ID NO: 14.

[0128] In another aspect, the present application provides a kit comprising the composition, wherein the kit further comprises at least one other component selected from the group consisting of nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0129] Typically, the kit also includes a container for holding a patient's biological sample. In addition, the kit also includes instructions for use and interpretation of the test results.

[0130] The present application also relates to the use of the above composition and oligonucleotide in preparing a kit for in vitro screening of various cancers.

[0131] The present application also relates to the use of one or more of the SHOX2 gene and the ZKSCAN8P1 gene in preparing a kit for in vitro screening of multiple cancers.

[0132] The SHOX2 gene, located on human chromosome 3q25.32, specifically on the long arm of chromosome 3, belongs to the PRD family of homeobox genes. The SHOX2 gene encodes a transcription factor that plays an important role in embryonic development, particularly in the regulation of skeletal development and cardiac function. Mutations in this gene are associated with a variety of congenital anomalies and developmental disorders, including skeletal dysplasia and cardiac malformations, but its detailed mechanism of action and interactions with other genes remain to be further explored.

[0133] The ZKSCAN8P1 gene (Zinc Finger Protein 192 Pseudogene 1) is a pseudogene located on chromosome 6 (6p22.1). An important paralog of this gene is ZFP2, which is predicted to have metal ion binding activity.

[0134] In another aspect, the present application provides a method for in vitro screening of multiple cancers, comprising the following steps:

[0135] 1) Isolating the target sequence or fragment of the target gene in the biological sample to be tested;

[0136] 2) determining the methylation status of the target sequence of the target gene;

[0137] 3) The status of the biological sample is judged by the detection result of the methylation status of the target sequence of the target gene, thereby realizing in vitro screening of various cancers.

[0138] According to certain preferred embodiments, the method further comprises the following steps:

[0139] 1) Extracting genomic DNA from the biological sample to be tested;

[0140] 2) treating the DNA sample obtained in step 1) with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases, that is, converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil or other bases, wherein the converted base has a different hybridization property from the unmethylated cytosine base at position 5 and is detectable;

[0141] 3) contacting the DNA sample treated in step 2) with a DNA polymerase and a primer for the target sequence of the target gene, so that the treated target sequence of the target gene is amplified to produce an amplified product or is not amplified; if the treated target sequence of the target gene undergoes a DNA polymerization reaction, an amplified product is produced; if the treated target sequence of the target gene does not undergo a DNA polymerization reaction, it is not amplified;

[0142] 4) detecting the amplified product with a probe; and

[0143] 5) determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplified product.

[0144] Preferably, a typical primer includes a fragment of the target sequence of the target gene, and the fragment of the target sequence of the target gene comprises a fragment of at least 9 nucleotides that is identical, complementary, or hybridizes under moderately stringent or stringent conditions to any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 5-8.

[0145] Preferably, a typical probe includes a fragment of the target sequence of the target gene, and the fragment of the target sequence of the target gene contains a fragment of at least 15 nucleotides that is identical, complementary, or hybridizes under moderately stringent or stringent conditions to any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 5-8.

[0146] Preferably, one or more of the primers and probes are as shown in Table 2 above.

[0147] Furthermore, the contacting or amplifying comprises using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplification product nucleic acid molecules with a detectable label.

[0148] Preferably, methylation status is determined by PCR, such as "fluorescence-based real-time PCR technology", methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP) and methylated CpG island amplification (MCA) and other assay methods are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene. Among them, "fluorescence-based real-time PCR" assay is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and does not require further operation after the PCR step. In brief, the "fluorescence-based real-time PCR" method starts with a mixed sample of genomic DNA, which is converted into a mixed pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Subsequently, fluorescence-based PCR is performed in a "biased" reaction (using PCR primers that overlap known CpG dinucleotides). Sequence differences can be generated at the amplification level and at the fluorescence detection amplification level. "Fluorescence-based real-time PCR" assay can be used as a quantitative test for methylation status in genomic DNA samples, where sequence differentiation occurs at the probe hybridization level. In this quantitative approach, the PCR reaction provides methylation-specific amplification in the presence of a fluorescent probe that overlaps a specific CpG dinucleotide. A non-biased control for the starting DNA amount is provided by a reaction in which neither the primer nor the probe overlaps any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as "TaqMan," "Lightcycler," and the like. The TaqMan probe is dual-labeled with a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) and is designed to be specific for regions of relatively high GC content, melting at a temperature approximately 10°C higher than that of the forward or reverse primer during the PCR cycle. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension step. As the Taq polymerase enzymatically synthesizes new chains in the PCR, it eventually encounters the annealed TaqMan probe. The Taq polymerase's 5' to 3' endonuclease activity then displaces the TaqMan probe by digesting it, releasing the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescence detection system. Typical reagents used for "fluorescence-based real-time PCR" analysis may include, but are not limited to: target sequence PCR primers for the target gene; TaqMan or Lightcycler probes; optimized PCR buffer and deoxynucleotides; and Taq polymerase, etc.

[0149] In certain preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined by a critical ΔCt value of a real-time PCR reaction. This method of analyzing DNA in a biological sample using real-time PCR conveniently enables detection of the methylation status of the target sequence of the target gene. Furthermore, the critical ΔCt value of the PCR reaction can be used to quickly and conveniently determine whether the sample is positive for methylation, thereby providing a non-invasive and rapid in vitro screening method for the aforementioned six cancers.

[0150] The biological sample is selected from the group consisting of cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof. The preferred biological sample is plasma.

[0151] The inventors of the present application have discovered that there are significant differences in the methylation status of the target sequences of the SHOX2 gene and / or the ZKSCAN8P1 gene in the above six cancer tissues and the methylation status of the target sequences of the said genes in normal tissues: in the above six cancer tissues, the target sequences of the SHOX2 gene and / or the ZKSCAN8P1 gene are methylated, while in normal tissues, the target sequences of the SHOX2 gene and / or the ZKSCAN8P1 gene are not methylated. Therefore, the present application provides a method for in vitro screening of multiple cancers (lung cancer, liver cancer, gastric cancer, intestinal cancer, esophageal cancer, ovarian cancer) by detecting the methylation status of one or more gene target sequences of the SHOX2 gene and the ZKSCAN8P1 gene in a sample. The method provided by the present application can non-invasively and rapidly screen the above six cancers.

[0152] Example

[0153] This application provides general and / or specific descriptions of the materials and experimental methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., percentage by weight. All reagents or instruments used without manufacturer indication are commercially available conventional reagents.

[0154] Example 1: Primer and probe testing

[0155] Normal human WBC cell line genomic DNA is usually in a low / unmethylated state. Whole genome amplification is performed on this genomic DNA. Since the amplification process does not introduce new methylation, the methylation level of the whole genome amplification product (UM) is theoretically extremely low, and it can be used as a negative reference for detecting the methylation status of the target gene target sequence. The amount of DNA used in this example is 25 ng / reaction; the product of human genomic DNA methyltransferase treatment is usually in a high / full methylation state. In this embodiment, the product of human genomic DNA methyltransferase treatment (M) can be used as a positive reference for detecting the methylation status of the target gene target sequence. The amount of DNA used in this example is 400 pg / reaction.

[0156] DNA samples were first bisulfite-converted. Real-time PCR amplification was performed using the converted BisDNA as a template using the aforementioned primers and probes. Each sample was subjected to at least one real-time PCR run, using the β-actin (ACTB) gene as an internal reference. In some embodiments, two or three real-time PCR runs were performed. The PCR systems used for the primer and probe tests are shown in Table 3.

[0157] Table 3

[0158] Volume (μl) Final concentration Taq DNA Polymerase (Biochain) 1.2 / 4.2×buffer(Biochain) 11.9 1× Forward primer F (10 μM) 1 200nM Reverse primer R (10 μM) 1 200nM Probe P (10 μM) 0.75 150nM Internal reference gene ACTB forward primer F (10 μM) 0.25 50nM Internal reference gene ACTB reverse primer (10 μM) 0.25 50nM Internal reference gene ACTB probe P (10 μM) 0.25 50nM Template BisDNA 5 <![CDATA[H2O]]> 28.4 Total 50

[0159] Note: “F” indicates forward primer; “R” indicates reverse primer; “P” indicates probe.

[0160] The PCR amplification program used was: 94°C, 20 min; 45 cycles (60°C, 35 s—read the fluorescence signal; 93°C, 30 s); 40°C, 10 s.

[0161] The test results are shown in Table 4:

[0162] Table 4

[0163] Ct value summary: M UM NTC in conclusion: SHOX2 methylation level 32.3 45 45 Available ZKSCAN8P1 methylation level 31.8 45 45 Available

[0164] As can be seen from Table 4, the nucleic acid composition and detection method provided by the present application are negative for the whole genome amplification product (UM) of normal human WBC cell line DNA, and are positive for the detection result (M) of the human genome DNA methyltransferase treatment product.

[0165] Example 2: Comparison of the performance of universal tumor markers in peripheral blood buffy coat (WBC) tests of six common and lethal cancers and normal subjects

[0166] Peripheral blood buffy coat (WBC) samples from 16 lung cancer, 16 liver cancer, 16 gastric cancer, 16 intestinal cancer, 16 esophageal cancer, and 16 ovarian cancer patients, as well as 48 normal subjects, were used as test materials. Genomic DNA was extracted and converted to BisDNA via sulfite. The methylation status of the SHOX2 and ZKSCAN8P1 genes was detected using the PCR reaction system and reaction procedure described in Example 1, using 25 ng of template per reaction. Finally, the real-time PCR Ct values for the target gene sequence and the internal reference gene sequence were measured for all WBC samples, and the ΔCt was calculated, where ΔCt = target gene Ct - internal reference gene Ct. Based on the PCR results, the critical value of the ΔCt value of the marker SHOX2 was selected as ≤11, and the critical value of the ΔCt value of the marker ZKSCAN8P1 was selected as ≤7.5. As shown in Table 5 below, the combined use of SHOX2 and ZKSCAN8P1 genes is greater than using either marker alone, and has higher sensitivity and specificity than commonly used universal tumor markers in clinical practice. Therefore, the results show that these two markers can be used for early screening of various cancers.

[0167] Table 5

[0168]

[0169]

[0170] In summary, the present application utilizes the above-mentioned methylation markers, primer-probe compositions, nucleic acid sequences, kits and uses thereof, as well as the above-mentioned detection methods, to detect the methylated nucleic acid sequences of target gene target sequences and fragments thereof, thereby realizing the use of target gene target sequence methylation biomarkers for in vitro screening of various cancers, thereby effectively improving the sensitivity and specificity of in vitro cancer screening, and is more suitable for use in physical examination populations, without the need to detect individual cancers one by one, saving screening costs. The markers of this patent application are multi-cancer or pan-cancer markers, and other cancers not mentioned in the examples, such as thyroid cancer, pancreatic cancer, breast cancer, bile duct cancer, urothelial carcinoma, prostate cancer, endometrial cancer, cervical cancer, leukemia, brain glioma, etc., are also among the applicable cancers protected.

[0171] The above description is merely a preferred embodiment of the present application and does not constitute any other form of limitation to the present application. Any person skilled in the art may utilize the above disclosed technical content to modify or modify the present application into equivalent embodiments with equivalent variations. Any simple modification, equivalent variation, or modification of the above embodiment made in accordance with the technical essence of the present application without departing from the technical solution of the present application shall still fall within the scope of protection of the technical solution of the present application.

Claims

1. A nucleic acid composition for simultaneous in vitro screening of multiple cancers, comprising: Nucleic acid used to detect the methylation status of target genes, Wherein, the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, Wherein, the target gene is SHOX2 gene and / or ZKSCAN8P1 gene.

2. The composition according to claim 1, wherein The target sequence of the SHOX2 gene is as shown in any one of SEQ ID NOs: 1-4, or the target sequence of the SHOX2 gene includes the sequence as shown in any one of SEQ ID NOs: 1-4.

3. The composition according to claim 1, wherein The target sequence of the ZKSCAN8P1 gene is as shown in any one of SEQ ID NOs: 5-8, or the target sequence of the ZKSCAN8P1 gene includes the sequence as shown in any one of SEQ ID NOs: 5-8.

4. An oligonucleotide for in vitro screening of multiple cancers, comprising: A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1-4 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 5-8 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

5. An oligonucleotide for in vitro screening of multiple cancers, comprising: The sequences of SEQ ID NO:9 and SEQ ID NO:

10.

6. An oligonucleotide for in vitro screening of multiple cancers, comprising: Sequences of SEQ ID NO:12 and SEQ ID NO:

13.

7. A kit comprising the composition according to any one of claims 1 to 3 or the oligonucleotide according to any one of claims 4 to 6.

8. Use of the composition according to any one of claims 1 to 3 or the oligonucleotide according to any one of claims 4 to 6 in the preparation of a kit for in vitro screening of multiple cancers.

9. The use according to claim 8, wherein The kit for in vitro screening of multiple cancers screens cancers by a method comprising the following steps: 1) isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested; 2) determining the methylation status of the target sequence of the target gene; 3) The status of the biological sample is judged by the detection result of the methylation status of the target sequence of the target gene, thereby realizing in vitro screening of cancer.

10. Use of the SHOX2 gene and / or the ZKSCAN8P1 gene in preparing a kit for in vitro screening of multiple cancers.