Fluorescent microsphere detection test paper for feline herpesvirus antibody and preparation method of fluorescent microsphere detection test paper

By using feline herpes virus gD protein and cat IgG embedding in fluorescent microsphere detection test strips, combined with Eu(III) chelated particles, the problems of low sensitivity and false positives in the existing detection methods are solved, and rapid and quantitative detection of feline herpes virus antibodies is achieved, which is suitable for primary clinical testing.

CN120446471APending Publication Date: 2025-08-08JILIN UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510686253.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

Existing feline herpes virus antibody detection methods such as colloidal gold test strips have low sensitivity, are prone to false positives, and are complex in operation, making it difficult to achieve high sensitivity, specificity and rapid quantitative analysis.

Method used

Fluorescent microsphere detection test strips were used to embed cat herpes virus gD protein on the detection line and cat IgG on the quality control line, combined with lateral chromatography immunoassay and Eu(III) chelated particles, and SPA was used to couple with fluorescent microspheres to improve the fluorescence value of the detection line and the fluorescence value of the quality control line, achieving accurate, rapid and quantitative detection of FHV antibodies in cat serum.

Benefits of technology

It realizes rapid and quantitative detection of FHV antibodies in cat serum, avoids false positive results, has short detection time, high sensitivity and specificity, and is suitable as a primary clinical detection method to ensure the health of the cat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120446471A_ABST
    Figure CN120446471A_ABST
Patent Text Reader

Abstract

The invention provides a feline herpesvirus antibody fluorescent microsphere detection test paper and a preparation method thereof, FHV gD protein is used as a specific capture antigen coating T line, feline IgG is used as a C line coating object, SPA and Eu (III) chelate particles are combined based on a lateral chromatography immunoassay method, and the fluorescent microsphere detection test paper for the feline herpesvirus antibody is obtained. The T-line fluorescence value, the C-line fluorescence value and the T / C value of the fluorescent microsphere detection test paper for the feline herpesvirus antibody are improved, accurate, rapid and quantitative indirect detection of the FHV antibody in feline serum is realized, and the sensitivity and the specificity of the detection test paper are improved. By testing a cat serum sample and a clinical sample, the detection result is consistent with that of a traditional standard method, and the reliability and effectiveness of the method in the aspect of on-site monitoring of the FHV antibody in the cat body are proved. Compared with a colloidal gold immunoassay method, generation of false positive results is avoided, and a feasible solution is provided for timely diagnosis and control of feline herpesvirus infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the field of antibody detection test paper, and in particular to a feline herpes virus antibody fluorescent microsphere detection test paper and a preparation method thereof. Background Art

[0002] Feline herpesvirus type 1 (FHV-1) is the causative agent of feline viral rhiontracheitis (FVR), primarily causing upper respiratory and ocular diseases in cats. Typical clinical symptoms include fever, depression, anorexia, ocular and nasal discharge, conjunctival congestion, sneezing, and less commonly, salivation and coughing. Secondary bacterial infections are common. FHV-1 infection accounts for approximately 50% to 75% of all viral upper respiratory tract infections in cats, and the mortality rate among kittens infected with FHV-1 is as high as 50%.

[0003] Vaccination is the best way to prevent FHV-1 infection in cats. Vaccines protect cats from severe disease by inducing humoral and cellular immunity, significantly improving their resistance to the disease. For FHV-1 infection, antibody titers correlate with protective efficacy. FHV-1 neutralizing antibody titers can be determined by serum neutralization antibody (SN) testing. Generally speaking, FHV-1 neutralizing antibody titers are low and, in some cases, undetectable after initial infection. However, low levels of neutralizing antibodies do not necessarily mean a lack of protection against the virus. Following further exposure to the virus, neutralizing antibodies often rise to a certain level and remain relatively stable thereafter. Therefore, testing FHV-1 antibody levels is of great value in protecting cats.

[0004] Currently, detection methods such as IFA (immunofluorescence assay) and ELISA (enzyme-linked immunosorbent assay), while highly sensitive and specific, are costly, time-consuming, and require high operator skill, hindering their widespread clinical use. A common clinical method for detecting FHV-1 antibodies is the colloidal gold test strip (GICA) (e.g., CN 117054650 A discloses a kit for detecting antibodies to feline herpesvirus type 1). While simple to use and rapid, this method requires visual inspection and is typically only suitable for qualitative or semi-quantitative analysis. This results in low sensitivity and can easily lead to false positives in cats with low viral loads, leading to misdiagnosis.

[0005] Therefore, it is imperative to establish a highly sensitive, specific, accurate and rapid detection method. Summary of the Invention

[0006] In view of this, the object of the present invention is to provide a feline herpes virus antibody fluorescent microsphere detection test paper and a preparation method thereof.

[0007] On the one hand, the present invention first provides a feline herpesvirus antibody fluorescent microsphere test strip, which is composed of a PVC base plate, a sample pad, a conjugation pad, a NC membrane and a water absorbent pad, wherein the detection line of the NC membrane is embedded with feline herpesvirus gD protein, the gene sequence of the feline herpesvirus gD protein is shown as SEQ ID NO.1, and the embedded amount of the feline herpesvirus gD protein is 1 mg / mL; the quality control line of the NC membrane is embedded with feline IgG, and the embedded amount of feline IgG is 1 mg / mL.

[0008] Furthermore, the preparation process of the feline herpesvirus gD protein is as follows: according to the gD protein gene sequence in the FHV-JX strain genome, cloning primers FHV-gD-F: CCAACTCCGCTAGCATGATGACCAGAC, FHV-gD-R: GATGGTGCTCGAGAGGGTGGTGGGTGG are designed, the gD gene is obtained by PCR amplification, and it is constructed into a pcDNA3.4 vector to obtain a recombinant expression plasmid pcDNA3.4-CHO-gD containing the FHV-JX strain gD protein gene sequence; the recombinant plasmid is expressed by the MetaCellTM CHO Transfectory transient protein expression system, and after suspension culture for 12 days after transfection, the cell expression supernatant is taken, the target protein is purified, and the FHV-JX strain gD protein is isolated.

[0009] Furthermore, the gD protein induction expression conditions are: 16° C., 12 hours.

[0010] Furthermore, the conjugate pad is sprayed with SPA protein coupled with fluorescent microspheres, and the coupling mass ratio of SPA protein to fluorescent microspheres is 6:100.

[0011] Furthermore, the coupling buffer for SPA protein and fluorescent microspheres is pH=8.0, 20 mM HEPES buffer.

[0012] Furthermore, the method of coupling fluorescent microspheres to SPA proteins includes:

[0013] (1) Fluorescent microsphere cleaning: 10 mg / mL fluorescent microspheres were added to pure water and centrifuged at 16,000 rpm, 9°C for 25 min for the first cleaning. The supernatant was removed and the microspheres were resuspended in pure water. The supernatant was centrifuged at 16,000 rpm, 9°C for 25 min for the second cleaning. The supernatant was removed and the microspheres were resuspended in labeling buffer. If the microspheres aggregated after centrifugation, they were dispersed by ultrasonication for 5 min. The labeling buffer was pH 5.3, 20 mM MES.

[0014] (2) Activation of fluorescent microspheres: Add 10 mg / ml EDC to the washed microspheres and mix quickly. Then add 10 mg / ml NHS to the microspheres and mix quickly. Ultrasonicate at 20W for 5 min. Incubate at 37°C with shaking for 30 min. Centrifuge at 16,000 rpm at 9°C for 25 min, remove the supernatant, and resuspend the microspheres in coupling buffer (pH 8.0, 20 mM HEPES). If the microspheres aggregate after centrifugation, disperse them by ultrasonication for 5 min.

[0015] (3) Coupling of fluorescent microspheres with proteins: Take SPA, add activated fluorescent microspheres, mix quickly, and incubate at room temperature for 2 hours; add bovine serum albumin (BSA) to a final concentration of 1%, mix quickly, and incubate at room temperature for 2 hours; centrifuge the blocked microsphere-protein mixture at 16,000 rpm and 9°C for 25 minutes; remove the supernatant, resuspend the microspheres with a resuspension solution, and store at 4°C for later use; the resuspension solution is prepared using the following reagents in parts by weight: 0.12 parts of Tris, 5 parts of sucrose, 2.5 parts of trehalose, 1.5 parts of BSA, and 40.88 parts of water, with a pH of 8.5; if the microspheres aggregate after centrifugation, disperse them by ultrasound for 5 minutes.

[0016] On the other hand, the present invention provides a method for preparing the above-mentioned feline herpes virus antibody fluorescent microsphere detection test paper, comprising the following steps:

[0017] S1. Fluorescent microspheres coupled with SPA protein:

[0018] (1) Fluorescent microsphere cleaning: 10 mg / mL fluorescent microspheres were added to pure water and centrifuged at 16,000 rpm, 9°C for 25 min for the first cleaning. The supernatant was removed and the microspheres were resuspended in pure water. The supernatant was centrifuged at 16,000 rpm, 9°C for 25 min for the second cleaning. The supernatant was removed and the microspheres were resuspended in labeling buffer. If the microspheres aggregated after centrifugation, they were dispersed by ultrasonication for 5 min. The labeling buffer was pH 5.3, 20 mM MES.

[0019] (2) Activation of fluorescent microspheres: Add 10 mg / ml EDC to the washed microspheres and mix quickly. Then add 10 mg / ml NHS to the microspheres and mix quickly. Ultrasonicate at 20W for 5 min. Incubate at 37°C with shaking for 30 min. Centrifuge at 16,000 rpm at 9°C for 25 min, remove the supernatant, and resuspend the microspheres in coupling buffer (pH 8.0, 20 mM HEPES). If the microspheres aggregate after centrifugation, disperse them by ultrasonication for 5 min.

[0020] (3) Coupling of fluorescent microspheres with proteins: Take SPA, add activated fluorescent microspheres, mix quickly, and incubate at room temperature with shaking for 2 hours; add BSA to a final concentration of 1%, mix quickly, and incubate at room temperature with shaking for 2 hours; centrifuge the blocked microsphere-protein mixture at 16,000 rpm and 9°C for 25 minutes; remove the supernatant, resuspend the microspheres with a resuspension solution, and store at 4°C for later use; the resuspension solution is prepared using the following reagents in parts by weight: 0.12 parts of Tris, 5 parts of sucrose, 2.5 parts of trehalose, 1.5 parts of BSA, and 40.88 parts of water; the pH of the resuspension solution is 8.5; if the microspheres aggregate after centrifugation, disperse them by ultrasonication for 5 minutes;

[0021] S2. Assembly of fluorescent microsphere test strips:

[0022] (1) Preparation: The sample pad was saturated with buffer solution containing 1% Triton X-100, 0.3% BSA, and 0.5% casein in 20 mM Tris-HCl, pH 8.0, air-dried for 2 hours, and stored in a sealed bag.

[0023] (2) Gold spraying: Set the spraying parameters of the film sprayer to 10 μL / cm, spray the fluorescent microsphere-coupled SPA onto the conjugate pad, and let it dry for 1-2 hours; after drying, place the conjugate pad in a sealed bag and store it for future use;

[0024] (3) NC membrane streaking: Set the sprayer parameters to 1 μL / cm, and spray gD protein and cat IgG onto the NC membrane as the test line and quality control line, respectively, with a spacing of 3.5 mm between the two lines; dry the streaked NC membrane for 30 min; place the dried NC membrane in a sealed bag and store for future use;

[0025] (4) Test strip assembly and cutting: First, stick the NC membrane to the middle of the PVC board, stick the absorbent pad to the C-line end of the PVC base plate, and press the edge of the absorbent pad on the NC membrane and overlap it with the NC membrane by 2 mm; stick the conjugation pad sprayed with fluorescent microsphere-coupled SPA to the T-line end of the NC membrane, and press the edge of the conjugation pad on the NC membrane and overlap it with the NC membrane by 2 mm; finally, stick the sample pad on the other side of the conjugation pad, and press the edge of the sample pad on the conjugation pad and overlap it by 2 mm; cut the PVC base plate into 3.9 mm wide test strips with a strip cutter, place them in a sealed bag, and store them.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention uses a large number of experimental screenings to coat the T line with FHV gD protein as a specific capture antigen and cat IgG as a C line coating. Based on the lateral flow immunoassay (LFIA), SPA is combined with Eu(III) chelated particles, and gD protein is used to capture FHV antibodies. This improves the T-line fluorescence value, C-line fluorescence value, and T / C value of the feline herpesvirus antibody fluorescent microsphere test paper. The more antibodies within the test strip's tolerance range, the higher the fluorescence value that the instrument can detect, thereby achieving accurate, rapid, and quantitative indirect detection of FHV antibodies in cat serum. In addition, by adjusting the embedding amount of the T line and C line, the T / C value of the test strip shows the best correlation with the serum SN titer, thereby improving the sensitivity and specificity of the test strip.

[0028] This method uses Eu(III) chelated microparticles as a fluorescent reporter, is extremely simple to operate, and the entire detection process is short (about 15 minutes). The limit of detection (LOD) for the SN titer of anti-FHV in cat serum is 1:2 -1 , the detection range (LOQ) is 1:2 5 ~1:2 0 This shows that the fluorescent microsphere test strips have a faster reaction speed and higher sensitivity, and can detect the presence of antibodies in a short time.

[0029] The detection limit of the fluorescent microsphere test strip based on Eu(III)-chelated microparticles was evaluated using feline serum and clinical samples, and its high sensitivity, specificity, accuracy, reproducibility, and stability for FHV antibodies were verified. The test results were consistent with those of traditional standard methods, demonstrating its reliability and effectiveness for on-site monitoring of FHV antibodies in cats. Compared with colloidal gold immunoassays, it avoids the occurrence of false-positive results.

[0030] In summary, the present invention has successfully developed a fluorescent microsphere test strip for feline herpesvirus antibodies based on Eu(III)-chelated microparticles. This test strip, which requires no expensive equipment, complex procedures, or pretreatment, simply dilutes serum in sample buffer, drips onto the test strip, and waits 15 minutes to quantitatively detect FHV antibody levels in feline serum. Its simplicity, high sensitivity, and accuracy make it ideal for use as a primary care clinical testing method, providing a viable solution for the timely diagnosis and control of feline herpesvirus infection and ensuring the health of cats. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The results of amplifying FHV-gD and FHV-gB gene fragments in Example 1 of the present invention are as follows;

[0032] Figure 2This is the expression identification result of the plasmid in Example 1 of the present invention;

[0033] Figure 3 This is the induced expression result of the target protein in Example 2 of the present invention;

[0034] Figure 4 The results of gD and gB protein purification in Example 2 of the present invention are as follows;

[0035] Figure 5 The results of selecting different conjugates and T-line coatings provided in Example 3 of the present invention;

[0036] Figure 6 The results of selecting different C-line coatings provided in Example 3 of the present invention;

[0037] Figure 7 The detection time selection result of the fluorescent microsphere test strip provided in Example 3 of the present invention;

[0038] Figure 8 The test results of different coupling buffers provided in Example 3 of the present invention;

[0039] Figure 9 This is the optimization result of the coupling amount of fluorescent microspheres and SPA provided in Example 3 of the present invention;

[0040] Figure 10 This is the T-line coating optimization result provided in Example 3 of the present invention;

[0041] Figure 11 This is the C-line coating amount optimization result provided in Example 3 of the present invention;

[0042] Figure 12 The neutralizing antibody titer-T / C fluorescence value calibration curve provided in Example 4 of the present invention;

[0043] Figure 13 The repeatability test results provided in Example 4 of the present invention are as follows;

[0044] Figure 14 The stability test results provided for Example 4 of the present invention. DETAILED DESCRIPTION

[0045] In order to further illustrate the present invention, the test paper and the preparation method thereof of the present invention are described in detail below with reference to the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0046] The feline herpesvirus (FHV) used in this study was isolated and identified in our laboratory and stored at -80°C. DH5α competent cells were purchased from TransGen Biotech Co., Ltd. Fluorescent microspheres (FCEU002, PS-COOH Europium Chelate Microspheres, europium chelate microspheres, excitation: 340 nm; emission: 620 nm) were commercially available. SPA antibodies were purchased from Sangon Biotech (Shanghai) Co., Ltd.; feline IgG was purchased from Suzhou Biolong Technology Co., Ltd.

[0047] Example 1 Amplification of gD and gB genes and construction of recombinant expression plasmids

[0048] 1. Amplification of FHV-gD and FHV-gB gene fragments

[0049] The FHV gene was extracted according to the instructions of the nucleic acid extraction kit. The primer sequences are as follows (Table 1).

[0050] Table 1 Primers for amplifying gD sequences

[0051]

[0052] Using the viral DNA provided by the kit as a template, PrimeSTAR Max DNA Polymerase high-fidelity enzyme was used to amplify the gD gene fragment. The target fragment size was approximately 1122 bp, and the gB target fragment size was 2844 bp. The PCR reaction program was: 98°C pre-denaturation for 1 min, followed by 35 cycles of denaturation at 98°C for 10 s, annealing at 57°C for 10 s, and extension at 72°C for 30 s. The reaction was then continued at 72°C for another 7 min, and then stored at 4°C. The PCR reaction system is shown in Table 2. The amplified product size was appropriate, as shown in the following results. Figure 1 As shown, Figure 1 In the equation, A is gB and B is gD.

[0053] Table 2 PCR reaction system

[0054]

[0055] 2. Plasmid pcDNA3.4-IL2-HIS expression

[0056] All PCR products were subjected to agarose gel electrophoresis, and positive fragments were removed and recovered using a gel recovery kit. The recovered products were double-digested with NheI and XhoI restriction endonucleases. The gene fragments recovered from the digests were ligated to the plasmid fragment using T4 DNA ligase, and the reaction system was incubated at 16°C for 12 hours. The ligation products were added to DH5α competent cells, incubated on ice for 30 minutes, heat-shocked at 42°C for 60 seconds, and incubated on ice for 2 minutes. Non-resistant LB medium was added, and the cells were shaken at 37°C for 1 hour before being plated onto LB agar plates containing ampicillin resistance. The plates were incubated at 37°C for 12-15 hours. A single colony was selected and transferred to 4 mL of LB medium containing ampicillin resistance and shaken at 37°C for 12 hours. The culture medium was then used to extract the plasmid using an endotoxin-free plasmid miniprep kit and stored at -20°C.

[0057] 3. Identification of plasmid pcDNA3.4-IL2-HIS

[0058] The recombinant plasmids were double digested with restriction endonucleases NheI and XhoI, and the correctly identified recombinant plasmids were sent to the company for sequencing to verify the correctness of the gD and gB gene sequences. The sequences were 100% homologous to those published by NCBI. The gD sequence is shown in SEQ ID NO.1, and the gB sequence is shown in SEQ ID NO.2. The recombinant plasmids were named pcDNA3.4-CHO-gD and pcDNA3.4-CHO-gB, respectively. The results are shown in Figure 3. Figure 2 As shown, Figure 2 In the equation, A is gB and B is gD.

[0059] Example 2 Expression and purification of feline herpesvirus gD and gB proteins

[0060] 1. Induced expression and identification of target protein

[0061] The recombinant plasmid was expressed using the MetaCellTM CHO Transfectory transient protein expression system. After suspension culture for 12 days after transfection, the cell expression supernatant was collected for Western blot analysis: the sample was electrophoresed on 12% SDS-PAGE and transferred to NC membrane. Western blot analysis was performed using a feline anti-FHV-1 polyclonal antibody as the primary antibody (1:1000 dilution) and HRP-labeled goat anti-cat IgG (1:5000 dilution) as the secondary antibody. The results are shown in Figure 2. Figure 3 As shown, Figure 3 In the figure, A is gB protein and B is gD protein.

[0062] 2. Purification of gD and gB proteins

[0063] 100 mL of cell expression supernatant was collected 12 days after suspension culture and transfection, and the target protein was purified according to the QIAGEN Ni-NTA Agarose purification column kit. The purified product was identified by 12% SDS-PAGE, and the concentration of purified gD and gB proteins was determined by BCA protein detection kit.

[0064] The purity of target protein gD is 100%, and the concentration of gD protein is 2.55 mg / mL; the purity of target protein gB is 98%, and the concentration of gB protein is 2.35 mg / mL. Figure 4 As shown, Figure 4 In the figure, A is gB protein and B is gD protein.

[0065] Example 3 Optimization of assembly conditions for fluorescent microsphere test strips

[0066] 1. Selection of fluorescent microsphere conjugates and T-line coatings

[0067] gB (envelope glycoprotein B) and gD (envelope glycoprotein D) proteins are the main immunogenic antigens of feline herpesvirus and are highly conserved. They can induce and activate the body's immune system to produce an immune response and induce host cells to produce neutralizing antibodies. The present invention uses different conjugates, 80μg SPA, 80μg FHV gB protein and 80μg FHV gD protein, and adds 1000μg activated microspheres respectively. FHV gB protein and FHV gD protein are then used as T-line coatings to make test strips. 100μL of positive serum samples diluted 100 times with 10mM PBS buffer are added dropwise to each of two fluorescent microsphere test strips, and the T and C line fluorescence values are detected after 15 minutes. The higher the fluorescence value, the better the coupling effect.

[0068] The results are as follows Figure 5 As shown, a comparison revealed that coupling SPA with T-line coated with FHV gD protein significantly improved T-line fluorescence and T / C values. However, the fluorescence values of the combinations of SPA with T-line coated with gB protein, gB protein with T-line coated with gD protein, and gD protein with T-line coated with gB protein were significantly lower than those of the combination of SPA with T-line coated with FHV gD protein. This is because after FHV antibodies are captured by SPA, the FHV Fab region can specifically recognize the gD protein of the T-line, fixing the complex to the T-line and generating a fluorescent signal. Therefore, the present invention uses SPA as the conjugate and FHV gD protein as the T-line coating.

[0069] 2. Fluorescent microspheres and SPA coupling method

[0070] (1) Washing of fluorescent microspheres: 100 μL of microspheres (1 mg) were added to 900 μL of pure water and centrifuged at 16,000 rpm, 9°C for 25 min for the first wash. The supernatant was removed and the microspheres were resuspended in 1000 μL of pure water. The supernatant was centrifuged at 16,000 rpm, 9°C for 25 min for the second wash. The supernatant was removed and the microspheres were resuspended in 1000 μL of labeling buffer (20 mM MES, pH = 5.3). If the microspheres aggregated after centrifugation, they were dispersed by ultrasonication for 5 min.

[0071] (2) Activation of fluorescent microspheres: Prepare EDC solution and NHS solution immediately. Add 25 μL of EDC (10 mg / ml) to the washed microspheres and mix quickly. Then, add 25 μL of NHS (10 mg / ml) to the microspheres and mix quickly. Ultrasonicate at 20 W for 5 min. Incubate at 37°C with shaking for 30 min. Centrifuge at 16,000 rpm and 9°C for 25 min. Remove the supernatant and resuspend the microspheres in 1000 μL of coupling buffer (20 mM HEPES, pH = 8.0). If the microspheres aggregate after centrifugation, disperse them by ultrasonication for 5 min.

[0072] (3) Fluorescent microspheres coupled to proteins: Take 80 μg of SPA, add 1000 μg of activated microspheres, mix quickly, and incubate at room temperature with shaking for 2 h. Add BSA to a final concentration of 1%, mix quickly, and incubate at room temperature with shaking for 2 h. Centrifuge the blocked microsphere-antibody mixture at 16,000 rpm, 9°C for 25 min. Remove the supernatant, resuspend the microspheres in 1000 μL of resuspension solution (Tris, 0.12 g; sucrose, 5 g; trehalose, 2.5 g; BSA, 1.5 g; water, 40.88 g, pH = 8.5), and store at 4°C until use. If the microspheres aggregate after centrifugation, disperse them by ultrasonication for 5 min.

[0073] 3. Selection of C-line coating

[0074] Different C-line coatings (cat IgG 0.5 mg / mL and dog IgG 0.5 mg / mL) were used to draw the T-line, and gD protein (1.3 mg / mL) was used to draw the T-line. Test strips were then made. 100 μL of a positive serum sample diluted 100-fold with 10 mM PBS buffer was added to the two fluorescent microsphere test strips. After 15 minutes, the T and C-line fluorescence values were measured. The higher the fluorescence value, the better the C-line coating. The results are shown in Figure 2. Figure 6 As shown, cat IgG is the best C-line coating.

[0075] 4. Fluorescent microsphere test strip assembly method and determination of detection time

[0076] (1) Preparation: The sample pad was saturated with buffer solution containing 1% Triton X-100, 0.3% BSA, and 0.5% casein in 20 mM Tris-HCl, pH 8.0, air-dried for 2 hours, and stored in a sealed bag.

[0077] (2) Gold spraying: Set the sprayer parameters (10 μL / cm) and spray the fluorescent microsphere-SPA complex onto the conjugate pad. Place the conjugate pad in a drying oven and dry it for 1-2 hours. Place the dried conjugate pad in a sealed bag, mark it, and store it dry at room temperature until ready for use.

[0078] (3) Streaking nitrocellulose (NC) membrane: Set the sprayer parameters (1 μL / cm) and spray gD protein and feline IgG onto the NC membrane as the test line (T) and control line (C), respectively, with a 3.5 mm interval between the two lines. Place the strung NC membrane in an incubator to dry for 30 min. After drying, place the conjugate pad in a sealed bag, mark it, and store it dry at room temperature until ready for use.

[0079] (4) Test strip assembly and cutting: The test strip consists of a PVC base plate, a sample pad, a NC membrane, a conjugation pad, and a water-absorbing pad. The specific steps for assembling the test strip are as follows: first, stick the NC membrane in the middle of the PVC plate, stick the water-absorbing pad to the C-line end of the PVC base plate, on the NC membrane, and overlap it with the NC membrane by 2mm. Stick the conjugation pad sprayed with fluorescent microspheres-SPA complex to the T-line end, overlapping it with the NC membrane by 2mm, and finally stick the sample pad, overlapping it with the conjugation pad by 2mm. Cut the PVC base plate into 3.9mm wide test strips with a strip cutting machine, place them in a sealed bag, add desiccant to seal, mark them, and store them under dry conditions at room temperature.

[0080] 100 μL of serum sample diluted 100 times with 10 mM PBS buffer was added to the sample pads of 5 test strips. The fluorescence value of each test strip was detected every minute to obtain the trend of the fluorescence value of the fluorescent microsphere test strip over time, the time required for the T / C value to reach the stable stage, and the duration (such as Figure 7 The T / C value fluctuated greatly before 10 minutes, was relatively stable during the 15-20 minute period, and changed after 20 minutes on some test strips. In summary, it was decided to measure the T / C value within 15-20 minutes of adding the sample.

[0081] 5. Selection of coupling buffer

[0082] SPA (8 μg / 100 μg fluorescent microspheres) was coupled to test strips using different coupling buffers: Tris buffer (20 mM Tris-HCl, pH 8.0) and HEPES (4-hydroxyethylpiperazineethanesulfonic acid) buffer (20 mM HEPES, pH 8.0). 100 μL of a positive serum sample diluted 100-fold with 10 mM PBS buffer (SN titer of 1:2048 before dilution) was added to the two fluorescent microsphere test strips. After 15 minutes, the T and C line fluorescence values were measured. Higher fluorescence values indicate better coupling efficacy.

[0083] Test results such as Figure 8 As shown in the figure, there was no difference in the fluorescence value of C line between HEPES group and Tris group, but the T line and T / C value of HEPES group were higher than those of Tris group, so HEPES buffer was selected.

[0084] 6. Optimization of the coupling amount of fluorescent microspheres and SPA

[0085] In the coupling step of fluorescent microspheres and SPA, 20, 40, 60, and 80 μg of SPA were added to 1000 μg of activated microspheres (i.e., 2, 4, 6, and 8 μg / 100 μg of fluorescent microspheres) for coupling. 100 μL of a positive serum sample diluted 100 times with 10 mM PBS buffer (the SN titer before dilution was measured to be 1:2048) was added dropwise to two fluorescent microsphere test strips with different coupling amounts (2, 4, 6, and 8 μg / 100 μg of fluorescent microspheres). The optimal coupling ratio was selected based on the fluorescence value obtained after 15 minutes of detection. The results are shown in Figure 2. Figure 9 As shown, 6 μg SPA / 100 μg fluorescent microspheres is the optimal coupling ratio.

[0086] 7. Optimization of T-line coating

[0087] Different concentrations of gD protein (0.5, 1.0, and 1.5 mg / mL) were used to draw the T line, and cat IgG (1.5 mg / mL) was used to draw the C line. Eight test strips of each type were taken and divided into four groups. 100 μL of the positive sample diluted with 10 mM PBS buffer at titers of 1:128, 1:16, 1:2, and the negative sample was dripped onto each test strip. After 15 minutes, the fluorescence values of the T and C lines were measured. The results are shown in the figure below. Figure 10 As shown in the figure, when the T-line embedding amount was 1.0 mg / mL, the T / C value had a good correlation with the neutralizing antibody titer.

[0088] 8. C-line coating optimization

[0089] Use gD protein (1.0 mg / mL) to draw the T line, and use different concentrations of cat IgG (1.5, 1.0, 0.5 mg / mL) to draw the C line. Take 8 test strips of each type and divide them into 4 groups. Take 100 μL of the positive sample diluted with 10 mM PBS buffer with a titer of 1:128, 1:16, 1:2, and negative samples and drop them on each test strip. After 15 minutes, the fluorescence values of the T and C lines are detected. The results are as follows. Figure 11 As shown, when the C-line embedding amount was adjusted to 1.0 mg / ml cat IgG, the test strip detection had a good correlation with the neutralizing antibody titer, and the positive T / C value was greater than 1 and the negative value was less than 0.5.

[0090] Example 4 Performance Evaluation of Fluorescent Microsphere Test Strips

[0091] 1. Sensitivity test

[0092] Using serial two-fold dilutions of FHV positive serum (determined neutralizing antibody titer of 1:2 11 ), that is, the titer of diluted serum is 1:2 5 , 1:2 4 , 1:2 3 , 1:2 2 , 1:2 1 , 1:2 0 , 1:2 -1 , the sensitivity of the fluorescent microsphere test strip was evaluated, and each dilution was tested five times. The results are shown in Table 3. The minimum detection limit (LOD) of the fluorescent microsphere test strip for the SN titer of cat FHV antibodies was 1:2 -1 .

[0093] Table 3 Sensitivity test data

[0094]

[0095] 2. Establish a neutralizing antibody titer-T / C fluorescence value standard curve

[0096] The equation: log(agonist) vs. response—a variable slope (four parameters) was used to fit the data to more accurately describe the relationship between the T / C value of each sample and its neutralizing antibody titer, and a neutralizing antibody titer-T / C fluorescence value calibration curve was constructed.

[0097] The results are as follows Figure 12 As shown. Using log(agonist) vs. response - a variable slope (four-parameter) model to determine the antibody titer standard curve (Y = Bottom + (Top-Bottom) / (1 + 10^((LogEC50-X)*HillSlope)), R 2=0.9996, Bottom=0.238, Top=1.177, LogEC50=2.512, HillSlope=1). The effective detection range of the fluorescent microsphere test strip, i.e., the limit of quantitation (LOQ), is 1:2. -5 ~1:2 0 .

[0098] 3. Specificity test

[0099] The specificity of the fluorescent microsphere test strips was evaluated by testing serum samples with positive neutralizing titers for antibodies against closely related feline viruses, such as feline parvovirus and feline calicivirus, using the prepared fluorescent microsphere test strips. The specificity of the fluorescent microsphere test strips was tested using feline parvovirus and feline calicivirus sera. The results showed that the fluorescent microsphere test strips could detect FHV-positive sera while showing no cross-reactivity with other sera. The T / C values of the test results for sera positive for antibodies to other viruses were similar to those for negative sera.

[0100] 4. Repeatability test

[0101] In order to evaluate the intra-batch and inter-batch reproducibility of fluorescent microsphere test strips, three batches of fluorescent microsphere test strips were prepared and used to measure serum samples with different SN titers (1:2 4 , 1:2 2 , 1:2 0 ) T / C value. Each serum sample was measured five times, and the results were as follows Figure 13 The intra-assay and inter-assay CV values were both lower than 10% (as shown in Table 4), meeting the precision requirements.

[0102] Table 4 Repeatability test data

[0103]

[0104] 5. Clinical sample testing

[0105] Ninety-two clinical samples from Changchun, Jilin Province, China were analyzed. Clinical serum samples were diluted 100-fold using 10 mM PBS buffer. Subsequently, 100 μL of the diluted sample was dripped onto the sample pad of a fluorescent microsphere test strip. After 15 minutes, fluorescence intensity at the T and C lines of the test strip was measured using a dry immunofluorescence analyzer for quantitative analysis. These samples were also tested for SN for comparative evaluation.

[0106] The results are shown in Table 5. Of the 92 clinical samples tested, 71 were positive for FHV antibodies and 21 were negative. Neutralizing antibody testing detected 71 FHV antibody-positive samples and 21 negative samples. Clinical trial results demonstrated that the fluorescent microsphere test strips produced consistent results with traditional standard methods, demonstrating their reliability and effectiveness in on-site monitoring of FHV antibodies in cats and avoiding false-positive results.

[0107] Table 5 Comparison of fluorescent microsphere test strips and SN detection

[0108]

[0109] 6. Stability test

[0110] The assembled fluorescent microsphere test strips were sealed with desiccant in an aluminum foil bag and stored at 25°C for 0, 1, and 3 months using diluted serum with known SN titer (1:2 5 , 1:2 4 , 1:2 3 , 1:2 2 , 1:2 1 , 1:2 0 ) evaluated the T / C value and conducted a stability test on the fluorescent microsphere test strips. The results were as follows Figure 14 As shown, the CV values were all less than 15%.

[0111] Through the above research, the present invention developed a simple and rapid fluorescent microsphere test strip. Based on the lateral flow immunoassay (LFIA) method and combined with Eu(III)-chelated microparticles, it can quantitatively measure FHV antibody titers in serum. The specificity of the fluorescent microsphere test strip depends on the FHV gD protein coated on the T-line and the SPA coupled to the fluorescent microspheres. In this study, we constructed a pcDNA3.4-IL2-HIS expression plasmid. The gD protein expression was induced at 16°C for 12 hours, achieving the highest protein expression. Under the culture and purification conditions, the gD protein was isolated by Ni-NTA affinity chromatography. The gD protein concentration was determined to be 2.55 mg / mL.

[0112] When selecting test strip preparation conditions, we first compared different conjugates with T-line coatings. This comparison revealed that conjugation with SPA and T-line coating with FHV gD protein increased T-line fluorescence and T / C ratios, whereas conjugation with SPA and T-line coating with gB protein, gB protein and T-line coating with gD protein, and gD protein and T-line coating with gB protein decreased T-line fluorescence and T / C ratios. This is because when FHV antibodies are captured by SPA, the FHV Fab region specifically recognizes the gD protein on the T-line, immobilizing the complex on the T-line and generating a fluorescent signal. Therefore, SPA was used as the conjugate and FHV gD protein as the T-line coating. Next, different C-line coatings were selected: feline IgG and canine IgG. The results showed that feline IgG increased C-line fluorescence, while canine IgG decreased it. Therefore, feline IgG was selected as the optimal C-line coating. We also compared the effects of two different coupling buffers, Tris and HEPES, on the coupling of fluorescent microspheres to SPA. Comparison revealed that HEPES buffer increased the fluorescence value and T / C ratio of the T line, while Tris buffer decreased them. This is likely due to HEPES buffer maintaining the stability and activity of the fluorescent microspheres, allowing more T lines to bind to them. Therefore, we selected HEPES buffer as the optimal coupling buffer. Next, we investigated the effects of different coupling amounts on the fluorescent microsphere test strips and found that the T line fluorescence value and T / C ratio reached their highest values when 6 μg of SPA was coupled to 100 μg of fluorescent microspheres. However, when the coupling amount was too high or too low, the T line fluorescence value and T / C ratio decreased. This is because, on the one hand, insufficient SPA on the fluorescent microspheres prevented effective binding to the FHV gD protein, while on the other hand, excessive SPA on the microspheres led to fluorescence quenching or aggregation, affecting the fluorescence signal output. Therefore, we selected 6 μg SPA / 100 μg of fluorescent microspheres as the optimal coupling amount. Finally, we optimized the embedding volume of the T and C lines on the test strips and found that when the embedding volume of the T line was 1.0 mg / mL gD protein and the C line was 1.0 mg / mL feline IgG, the T / C ratio of the test strip showed the best correlation with the serum SN titer, with positive T / C values greater than 1 and negative T / C values less than 0.5, indicating good interpretation. This may be because the embedding volume of the T and C lines can affect the capture efficiency of the fluorescent microspheres and the intensity of the background signal. Excessive or insufficient embedding volume can reduce the sensitivity and specificity of the test strip. Therefore, we selected 1.0 mg / mL gD protein and 1.0 mg / mL feline IgG as the optimal embedding volume.

[0113] The test using this test strip is based on a direct competitive immunoassay performed on a lateral flow test strip with a detection time of approximately 15 minutes and a limit of detection (LOD) of 1:2 for the SN titer of anti-FHV in cat serum. -1, the detection range (LOQ) is 1:2 5 ~1:2 0 This demonstrates that the fluorescent microsphere test strips have a fast reaction speed and high sensitivity, enabling rapid detection of antibodies. Serum dilution with PBS buffer covers the range of FHV antibody SN titers found in healthy cat serum, as well as high antibody levels caused by infection or immunization. The test strips achieved intra- and inter-batch coefficients of variation (CV) below 15%, demonstrating satisfactory repeatability and stability.

[0114] Furthermore, clinical trial results demonstrated that the fluorescent microsphere test strips' results were consistent with those of traditional standard methods, demonstrating their reliability and effectiveness in on-site monitoring of FHV antibodies in cats. This test strip will provide valuable testing for clinical applications. Finally, we conducted stability tests on the test strips, storing them at 25°C for 0, 1, and 3 months and testing them with sera of varying SN titers. The results showed that the CV values of the test strips were all less than 15%, indicating that the test strips maintained good stability with no significant performance degradation during storage.

[0115] In summary, we have successfully developed an immunochromatographic test strip based on Eu(III)-chelated microparticles. This method, which requires no expensive equipment, complex procedures, or pretreatment, can quantitatively detect FHV antibody levels in feline serum by simply diluting serum in sample buffer, adding the sample to the test strip, and waiting for 15 minutes. Its simplicity, high sensitivity, and accuracy make it ideal for use as a primary care clinical test, providing a viable solution for the timely diagnosis and control of feline herpesvirus infection and ensuring the health of cats.

[0116] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A feline herpes virus antibody fluorescent microsphere test strip, consisting of a PVC base plate, a sample pad, a conjugate pad, an NC membrane and a water-absorbing pad, characterized in that: The detection line of the NC membrane is embedded with feline herpesvirus gD protein, the gene sequence of the feline herpesvirus gD protein is shown in SEQ ID NO.1, and the embedded amount of the feline herpesvirus gD protein is 1 mg / mL; the quality control line of the NC membrane is embedded with feline IgG, and the embedded amount of feline IgG is 1 mg / mL.

2. Feline herpes virus antibody fluorescent microsphere detection test paper according to claim 1, is characterized in that, The preparation process of the feline herpesvirus gD protein is as follows: according to the gD protein gene sequence in the FHV-JX strain genome, cloning primers FHV-gD-F: CCAACTCCGCTAGCATGATGACCAGAC and FHV-gD-R: GATGGTGCTCGAGAGGGTGGTGGGTGG, the gD gene was obtained by PCR amplification and constructed into the pcDNA3.4 vector to obtain the recombinant expression plasmid pcDNA3.4-CHO-gD containing the FHV-JX strain gD protein gene sequence; the recombinant plasmid was expressed by the MetaCellTM CHO Transfectory transient protein expression system, and the cell expression supernatant was obtained after suspension culture for 12 days after transfection, and the target protein was purified to isolate the FHV-JX strain gD protein.

3. Feline herpes virus antibody fluorescent microsphere detection test paper according to claim 2, is characterized in that, The induction conditions for gD protein expression were: 16°C for 12 hours.

4. Feline herpes virus antibody fluorescent microsphere detection test paper according to claim 1, is characterized in that, The conjugate pad is sprayed with SPA protein coupled with fluorescent microspheres, and the coupling mass ratio of SPA protein to fluorescent microspheres is 6:

100.

5. Feline herpes virus antibody fluorescent microsphere detection test paper according to claim 4, is characterized in that, The coupling buffer for SPA protein and fluorescent microspheres was pH=8.0, 20 mM HEPES buffer.

6. A method for preparing a feline herpes virus antibody fluorescent microsphere test paper according to any one of claims 1 to 5, characterized in that: The following steps are involved: S1. Fluorescent microspheres coupled with SPA protein: (1) Fluorescent microsphere cleaning: 10 mg / mL fluorescent microspheres were added to pure water and centrifuged at 16,000 rpm, 9°C for 25 min for the first cleaning. The supernatant was removed and the microspheres were resuspended in pure water. The supernatant was centrifuged at 16,000 rpm, 9°C for 25 min for the second cleaning. The supernatant was removed and the microspheres were resuspended in labeling buffer. If the microspheres aggregated after centrifugation, they were dispersed by ultrasonication for 5 min. The labeling buffer was pH 5.3, 20 mM MES. (2) Activation of fluorescent microspheres: Add 10 mg / ml EDC to the washed microspheres and mix quickly. Then add 10 mg / ml NHS to the microspheres and mix quickly. Ultrasonicate at 20W for 5 min. Incubate at 37°C with shaking for 30 min. Centrifuge at 16,000 rpm at 9°C for 25 min, remove the supernatant, and resuspend the microspheres in coupling buffer (pH 8.0, 20 mM HEPES). If the microspheres aggregate after centrifugation, disperse them by ultrasonication for 5 min. (3) Coupling of fluorescent microspheres with proteins: Take SPA, add activated fluorescent microspheres, mix quickly, and incubate at room temperature with shaking for 2 hours; add BSA to a final concentration of 1%, mix quickly, and incubate at room temperature with shaking for 2 hours; centrifuge the blocked microsphere-protein mixture at 16,000 rpm and 9°C for 25 minutes; remove the supernatant, resuspend the microspheres with a resuspension solution, and store at 4°C for later use; the resuspension solution is prepared using the following reagents in parts by weight: 0.12 parts of Tris, 5 parts of sucrose, 2.5 parts of trehalose, 1.5 parts of BSA, and 40.88 parts of water; the pH of the resuspension solution is 8.5; if the microspheres aggregate after centrifugation, disperse them by ultrasonication for 5 minutes; S2. Assembly of fluorescent microsphere test strips: (1) Preparation: Saturate the sample pad with buffer, air-dry for 2 hours, and store in a sealed bag. The buffer was 20 mM Tris-HCl containing 1% Triton X-100, 0.3% BSA, and 0.5% casein at pH 8.0; (2) Gold spraying: Set the spraying parameters of the film sprayer to 10 μL / cm, spray the fluorescent microsphere-coupled SPA onto the conjugate pad, and let it dry for 1-2 hours; after drying, place the conjugate pad in a sealed bag and store it for future use; (3) NC membrane streaking: Set the sprayer parameters to 1 μL / cm, and spray gD protein and cat IgG onto the NC membrane as the test line and quality control line, respectively, with a spacing of 3.5 mm between the two lines; dry the streaked NC membrane for 30 min; place the dried NC membrane in a sealed bag and store for future use; (4) Test strip assembly and cutting: First, stick the NC membrane to the middle of the PVC board, stick the absorbent pad to the C-line end of the PVC base plate, and press the edge of the absorbent pad on the NC membrane and overlap it with the NC membrane by 2 mm; stick the conjugation pad sprayed with fluorescent microsphere-coupled SPA to the T-line end of the NC membrane, and press the edge of the conjugation pad on the NC membrane and overlap it with the NC membrane by 2 mm; finally, stick the sample pad on the other side of the conjugation pad, and press the edge of the sample pad on the conjugation pad and overlap it by 2 mm; cut the PVC base plate into 3.9 mm wide test strips with a strip cutter, place them in a sealed bag, and store them.

Citation Information

Patent Citations

  • Kit for detecting feline herpesvirus type I antibody

    CN117054650A