Application of recombinant flagellin FlaF in resisting Vibrio harveyi infection of aquatic animals
By preparing the recombinant flagellin FlaF subunit vaccine, the drug resistance and environmental damage problems of existing antibiotics to prevent and treat Vibrio Harves were solved, efficient immune protection and enzyme activity activation were achieved, and the resistance of aquatic animals to Vibrio Harves was significantly improved.
Patent Information
- Application Number
- CN202510749834.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-08-12
AI Technical Summary
The existing antibiotics to prevent and treat Vibrio Harves are prone to drug resistance and damage the environmental microecology. The immune prevention and control drug effect is maintained for a short time, making it difficult to effectively prevent and treat aquatic animal diseases caused by Vibrio Harvess.
The subunit vaccine was prepared by recombinant flagellin FlaF, and the prokaryotic expression vector pET32a was used to express and purify it in the Rosetta engineering strain. It was used to prepare aquatic animals anti-Vibromonas HAVIVI, which activates the innate immune response of fish body through immunity.
The immune protection rates of the recombinant flagellin FlaF vaccine against pearl gentian grouper were 83.33% and 60.87% after 4 and 8 weeks, respectively, significantly improving serum enzyme activity and specific antibody expression, and activate the inflammation and cellular immune response of fish body.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical fields of bioengineering and immunology, and particularly relates to application of recombinant flagellin in preparing anti-Vibrio harveyi drugs for aquatic animals. Background Art
[0002] Vibrio harveyi ( Vibrio harveyi Vibrio harveyi can cause a variety of diseases in marine aquaculture fish. Vibrio diseases develop rapidly and are difficult to control, resulting in severe economic losses to fisheries. Antibiotics are the primary method for the prevention and treatment of Vibrio harveyi, but they are prone to developing drug resistance and can also disrupt the environmental microbiome. Immunotherapy offers long-term efficacy and prevents the development of drug resistance, offering promising development prospects.
[0003] Flagella are long, wavy, curved filaments attached to bacterial cells. They serve as bacterial locomotion organs and are associated with pathogenicity. Flagella grow from the cell membrane and are free-floating. They consist of three parts: the basal body, the hook, and the filament. Flagellin molecules formed within the bacteria are continuously added to and accumulated at the ends of the flagella. Flagellin monomers (30-60 kDa, depending on the bacterial taxonomic group) are secreted from bacteria by the flagellin export system. Because flagellin is ubiquitous in various bacterial species and abundant in individual bacterial cells, bacterial flagella play a crucial role in the infection process. Summary of the Invention
[0004] The present invention aims to provide an application of recombinant flagellin in the preparation of anti-Vibrio harveyi drugs for aquatic animals.
[0005] To achieve the above object, the present invention adopts the following technical solutions: Application of recombinant flagellin in the preparation of anti-Vibrio harveyi drugs for aquatic animals; The amino acid sequence of the recombinant flagellin is shown in SEQ ID No. 2; The nucleotide sequence of the recombinant flagellin gene is shown in SEQ ID No. 1; The recombinant vector includes an expression vector and the gene of the recombinant flagellin; the expression vector is a prokaryotic expression vector pET32a; The recombinant bacteria include host bacteria and the recombinant vector; the host bacteria is a Rosetta engineering strain.
[0006] An anti-Vibrio harveyi drug comprises a recombinant flagellin; the amino acid sequence of the recombinant flagellin is shown in SEQ ID No. 2.
[0007] The beneficial effects of the present invention compared with the prior art are as follows: The subunit vaccine prepared using FlaF of Vibrio harveyi in the present invention has an immune protection rate of 83.33% for pearl gentian grouper at 4 weeks and 60.87% at 8 weeks, with strong protection. In addition, the prepared vaccine has low cost and high cost-effectiveness, does not contain other pathogenic components, is conducive to promotion and use, and has a certain effect on the prevention and treatment of Vibrio harveyi. BRIEF DESCRIPTION OF THE DRAWINGS
[0008] Figure 1 This is the SDS-PAGE detection diagram after purification of recombinant flagellin FlaF, 1: purified pET-32a (rTrx); 2: purified flagellin FlaF; M: protein marker.
[0009] Figure 2 Figure 4 shows the serum enzyme activity detection after fish were immunized with the recombinant flagellin FlaF subunit vaccine; Figure A shows alkaline phosphatase (AKP) activity; Figure B shows acid phosphatase (ACP) activity; Figure C shows lysozyme (LZM) activity; and Figure D shows superoxide dismutase (SOD) activity.
[0010] Figure 3 This is the immune protection effect of the recombinant flagellin FlaF subunit vaccine on fish; Figure A shows the survival rate within 14 days after Vibrio harveyi challenge 4 weeks after vaccination; Figure B shows the survival rate within 14 days after Vibrio harveyi challenge 8 weeks after vaccination.
[0011] Figure 4 Detection of specific antibodies in the serum of fish after vaccination with recombinant flagellin FlaF subunit vaccine.
[0012] Figure 5 To detect the activation of related immune genes after vaccination with recombinant flagellin FlaF subunit vaccine. DETAILED DESCRIPTION
[0013] The technical solution of the present invention is further explained below through examples, but the protection scope of the present invention is not limited in any form by the examples.
[0014] After activating the Vibrio harveyi QT520 stored in the laboratory, single clones were picked by streaking and expanded for culture. At the same time, 16S sequencing was performed to ensure that the strain was not contaminated.
[0015] The genome of Vibrio harveyi was extracted using the bacterial DNA extraction kit from Tiangen Company. FWf The primer sequences are as follows: FWf F1: 5'-CCCGGGATGCTGAACCAATCCATGGA -3'; FWfR1: 5' - CCCGGGGCCAAGTAAGGTTAAAGCAAGGT -3'.
[0016] Using the extracted Vibrio harveyi DNA as a template, FWf F1 and FWf R1 was used for amplification. The reaction system was: 10× Buffer: 2.5 µL; 2.5 mM dNTPs: 2 µL; Taq enzyme: 0.2 µL; FWf F1 and FWf R1: 0.5 µL; DNA: 1 µL; ddH2O: 25 µL. Amplification program: 95°C for 5 min; 95°C for 30 s; 56°C for 60 s; 72°C for 60 s; 72°C for 10 min, 32 cycles from steps 2 to 4. After agarose gel electrophoresis, target fragments were cut and recovered using a Vazyme product recovery kit. The recovered target fragments were ligated with T1 Simple at room temperature for 10 min and transformed into DH5α competent cells. Culture overnight, and single colonies were picked for PCR the next day. Positive clones were saved and sequenced.
[0017] Example 2 Construction of recombinant expression vector The plasmid was extracted from the strain with the correct sequence in Example 1 and the restriction enzyme Sma I was used for enzyme digestion, and the prokaryotic expression vector pET32a was digested with restriction endonuclease Sma I was used for enzyme digestion, and the eukaryotic expression vector pCN3 was digested with restriction enzyme Sma I was used for enzyme digestion. The digested product was subjected to agarose gel electrophoresis, and the target band was excised for product purification. The recovered product was mixed in a 5:1 ratio, and 1 µL each of T4 ligase and its buffer was added, and the volume was made up to 10 µL with ddH2O. The ligation was carried out overnight in a 16°C metal bath. The next day, the cell was transformed into DH5α competent cells and cultured at 37°C until colony morphology was evident. Single colonies were selected for testing, and positive strains were sent for testing and stored for subsequent experiments.
[0018] Example 3 Expression and purification of recombinant protein A Rosetta (DE3) strain expressing pET-32a-FlaF was removed for activation and transferred to 100 mL of LB medium containing 1‰ Amp. The cells were cultured at 30°C to an OD600 of 0.6 and induced with IPTG to a final concentration of 0.1 mM for 12 hours. A Rosetta (DE3) strain transformed with the pET-32a plasmid served as a control (30°C in a shaker with 0.1 mM IPTG). The induced cells were collected by centrifugation at 6000 g for 15 minutes. The pellet was transferred to a 50 mL centrifuge tube and resuspended in 12 mL of lysis buffer. The 50 mL centrifuge tube was placed in an ice-water mixture and the cells were disrupted using an ultrasonic disruptor. The program was set to: 300 W power, 3 s per stroke, 10 s rest, repeated 70 times. The lysate was divided into 2 mL centrifuge tubes and centrifuged at 13000 g for 20 min. The supernatant was collected and the protein was purified by nickel column affinity chromatography. After purification, the protein was detected by SDS-PAGE (e.g. Figure 1 The purified protein was transferred to a dialysis bag using a pipette and placed in a PBS solution for 20 hours. The urea concentration was gradually reduced in multiples of 2 M, with the solution changed every 5 hours for a total of 20 hours. A small amount of the purified, dialyzed recombinant protein was removed for protein gel analysis and the protein concentration of the purified, dialyzed recombinant protein was determined using a Solarbio BCA protein concentration kit.
[0019] Example 4 Vaccine preparation and immunization and effect detection 1. Vaccine preparation: Mix the dialyzed protein with aluminum hydroxide colloid in a 1:1 ratio to obtain the FlaF subunit vaccine.
[0020] 2. Immunization: Pearl grouper weighing 17 g ± 4 g were divided into three groups and injected with FlaF subunit vaccine, control rTrx and PBS respectively, and boosted immunization was performed 2 weeks later.
[0021] 3. Detection 3.1 Serum enzyme activity test: After vaccination, blood was collected from three fish every two weeks. After the blood was allowed to stand for a period of time, it was centrifuged at low temperature to obtain serum. The activity of AKP, ACP, LZM and SOD was measured using a kit established in Nanjing. The results are shown in the attached figure. Figure 2 As shown, AKP activity was significantly increased compared with the control group at 4 and 6 weeks after subunit vaccine immunization ( Figure 2 A). ACP activity increased significantly 4, 6, and 8 weeks after subunit vaccine immunization ( Figure 2 B). As attached Figure 2C, LZM activity was significantly increased compared with the control group 2, 4, and 6 weeks after subunit vaccine immunization. SOD activity was significantly increased 2, 4, 6, and 8 weeks after subunit vaccine immunization ( Figure 2 D).
[0022] 3.2 Immune protection effect detection: Four and eight weeks after vaccination, Vibrio harveyi was cultured to the logarithmic phase, washed three times with PBS, and diluted to 1×10 6 CFU / mL, and 100 µL of bacterial solution was injected intraperitoneally into each fish. The mortality of each group of fish was recorded daily, and the relative protection rate (RPS) of the two vaccines was calculated according to the formula: RPS = 100% × (1 - mortality rate of experimental group / mortality rate of control group). Figure 3 As shown, 4 weeks after immunization, the survival rate of fish in the subunit vaccine group was 90.00%, that is, 4 weeks after immunization, the RPS of fish in the subunit vaccine group was 83.33%; 8 weeks after immunization, the survival rate of fish in the subunit vaccine group was 70.00%, and the RPS was 60.87%.
[0023] 3.3 ELISA detection of serum antibodies: After serum collection, it was diluted 20 times for detection. FlaF protein was coated on a 96-well plate overnight, washed 3 times with PBST, and then blocked with skim milk powder at room temperature for 1 hour. Then, diluted serum was added, incubated at room temperature for 1 hour, and then washed 3 times with PBST. Then, mouse anti-grouper IgM antibody was added for incubation. After washing with PBST, goat anti-mouse IgG antibody was added. After incubation at room temperature for 1 hour, TMB colorimetric solution was added and the absorbance at 450 nm was measured. The results are shown in the attached figure. Figure 4 As shown, the recombinant flagellin FlaF subunit vaccine can produce specific antibodies 3-8 weeks after immunization, and the antibodies produced reach a peak at the 7th week after immunization.
[0024] 3.4 Immune-related gene detection: Four weeks after vaccination, fish were stimulated with Vibrio harveyi for 24 hours. The spleen of the fish was extracted using a kit to extract RNA. After conversion to cDNA, the expression of immune genes was detected by fluorescence quantitative analysis. β-actin was used as an internal reference. The results are shown in the attached figure. Figure 5 As shown, after immunization with subunit vaccine TLR5M 、 TLR5S 、 IL-1β 、 CD8α 、 IgM 、 TNF-α 、 IFN γ 、 MHCIα 、 MHC IIα were significantly increased.
Claims
1. A use of recombinant flagellin in the preparation of a drug for the treatment of Vibrio harveyi in aquatic animals, characterized in that The amino acid sequence of the recombinant flagellin is shown in SEQ ID No. 2; The nucleotide sequence of the recombinant flagellin gene is shown in SEQ ID No. 1; The recombinant vector includes an expression vector and the gene of the recombinant flagellin; the expression vector is a prokaryotic expression vector pET32a; The recombinant bacteria include host bacteria and the recombinant vector; the host bacteria is a Rosetta engineering strain.
2. An anti-Vibrio harveyi drug comprising recombinant flagellin; the amino acid sequence of the recombinant flagellin is shown in SEQ ID No. 2.