Microfluidic device based on MMPs-DNAzyme-PMPs compound and detection method

Abstract

The invention discloses a microfluidic device based on an MMPs-DNAzyme-PMPs compound and a detection method, and belongs to the technical field of biological detection. According to the invention, DNAzyme molecules are combined with magnetic particles (MMPs) and polystyrene particles (PMPs), and the obtained composite structure (MMPs-DNAzyme-PMPs) can trigger a DNAzyme cutting reaction in the presence of calcium ions, so that free PMPs are released. In combination with an automatic capillary tube driving micro-fluidic device, the PMPs are captured and accumulated by utilizing the characteristic that the aperture of the tail end of a particle dam is smaller than the diameter of the free PMPs, a visual length strip is formed, and rapid quantitative detection of the blood calcium ion concentration can be realized through naked eyes or a mobile phone camera. The enrichment and concentration visualization of the calcium ions can be realized only by using a trace amount of blood sample, and the method is suitable for instant detection of families and medical sites.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and particularly relates to a microfluidic device and a detection method based on a MMPs-DNAzyme-PMPs complex. Background Art

[0002] Calcium ions (Ca 2+ ) is a key regulator of human physiological activity, and its dynamic monitoring holds significant clinical value for early disease screening and therapeutic efficacy assessment. Microfluidics and biosensor technologies that enable point-of-care testing using calcium ions have emerged as key research approaches in recent years in biomedical testing, environmental monitoring, and drug screening. Currently, blood calcium testing relies primarily on ion-selective electrodes and enzymatic methods, requiring specialized equipment and personnel, making it difficult to implement and widely disseminate in non-laboratory settings. While existing microfluidic technologies simplify the testing process, they often rely on fluorescent markers for color development and require sophisticated optical equipment (such as fluorescence microscopes and spectrometers) to read the signal. Direct quantitative interpretation by the naked eye is impractical, resulting in complex processes and high equipment costs. Furthermore, the stability of fluorescent markers is significantly affected by ambient temperature and humidity, making readings prone to deviations in home settings. Traditional microfluidic chips driven by active pumping or capillary forces typically require pre-loaded dry or liquid reagents (such as enzymes and DNA probes), which can become inactivated during long-term storage due to fluctuations in ambient temperature and humidity. Traditional closed chips may retain trace amounts of moisture or contaminants during the manufacturing and packaging process, which can cause solvent evaporation or solute crystallization, blocking microchannels. Long-term storage may breed microorganisms or cause material aging.

[0003] Therefore, there is an urgent need to develop a blood calcium detection technology that does not require complex instruments and can be directly interpreted by the naked eye through color changes to meet the needs of family health monitoring and rapid screening in primary medical institutions. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a microfluidic device and detection method based on MMPs-DNAzyme-PMPs complex to solve the technical problems of complex operation and long detection time of existing blood calcium detection methods.

[0005] To achieve the above-mentioned objectives, the technical solution adopted by the present invention is: providing a microfluidic device based on the MMPs-DNAzyme-PMPs complex, comprising a polydimethylsiloxane (PDMS) chip body and a substrate layer, wherein the polydimethylsiloxane chip body and the substrate layer are encapsulated by plasma bonding to form a closed microchannel; the polydimethylsiloxane chip body comprises an injection hole, a capture channel, a microcolumn array and an air cavity, and a polystyrene microparticle (PMPs) interception area with a narrow structure is provided in the capture channel, the particle dam for interception has a width of 4 μm, the microchannel has a width of 200 μm and a depth of 20 μm for forming a visual strip, and the inner surface of the channel is plasma treated to enhance hydrophilicity; the microcolumn array is used to assist in fluid control and particle distribution.

[0006] On the basis of the above technical solution, the present invention can also be improved as follows: Furthermore, the preparation steps of the polydimethylsiloxane chip body include: UV lithography process of SU8-2015 photoresist template (650 rpm smearing for 18 seconds, 1300 rpm smearing for 60 seconds, and UV exposure for 12 seconds) and silanization treatment, and PDMS prepolymer and curing agent are mixed in a mass ratio of 8-12:1 and then cured at 55°C for 3-7 hours to form.

[0007] Furthermore, the air cavity was formed by fixing metal pins with epoxy resin and integrated with the PDMS chip by curing at 50-60 °C for 22-26 h.

[0008] Furthermore, the bonding between the PDMS chip and the substrate layer is achieved by oxygen plasma treatment for 30-90 seconds, and the packaging is completed by baking at 50-60°C for 22-26 hours after bonding.

[0009] Furthermore, the probe molecule used in the capture channel is an MMPs-DNAzyme-PMPs complex, and the preparation steps of the MMPs-DNAzyme-PMPs complex include: S1. Mix the molecular chain S and the base chain E at a molar ratio of 0.5-1.5:1-2, react at 90-100°C for 5-10 minutes, then reduce the temperature to 42°C and continue the reaction for 20-40 minutes to form a DNAzyme; S2. Magnetic microparticles (MMPs) and single-stranded P1 are mixed at a volume ratio of 1.5-2.5:0.5-1.5, and polystyrene microparticles (PMPs) and single-stranded P2 are mixed at a volume ratio of 1-2:1-2, respectively. The mixture is then reacted at room temperature for 20-40 minutes to obtain MMP-P1 and PMP-P2. The streptavidin coating on the surface of the microspheres (MMPs and PMPs) can bind to the biotin-modified single-stranded DNA strands P1 (3'-end biotin) and P2 (5'-end biotin), resulting in the distribution of several P1 and P2 strips on the surface of the MMPs and PMPs, respectively. S3. DNAzyme, MMP-P1 and PMP-P2 are mixed in a volume ratio of 1-2:1-2:1-2, and the mixture is reacted at 42°C for 30-45 minutes. The sequences at both ends of the DNAzyme molecular chain are complementary to the single-stranded P1 and single-stranded P2 bases to obtain an MMPs-DNAzyme-PMPs complex.

[0010] Furthermore, the nucleotide sequence of the molecular chain S is shown in SEQ ID NO: 1, the nucleotide sequence of the base chain E is shown in SEQ ID NO: 2, the nucleotide sequence of the single chain P1 is shown in SEQ ID NO: 3, and the nucleotide sequence of the single chain P2 is shown in SEQ ID NO: 4.

[0011] The present invention also discloses the application of the microfluidic device based on the MMPs-DNAzyme-PMPs complex in detecting metal ions.

[0012] On the basis of the above technical solution, the present invention can also be improved as follows: Furthermore, the metal ion is a calcium ion.

[0013] Furthermore, the above-mentioned microfluidic device is also suitable for the quantitative detection of environmental pollutants or biomarkers, and multi-target adaptation can be achieved by replacing the modified probe molecules in the capture channel.

[0014] The present invention also discloses a method for detecting calcium ions in a solution using the above-mentioned microfluidic device based on the MMPs-DNAzyme-PMPs complex, comprising the following steps: S1. Mix the MMPs-DNAzyme-PMPs complex with a series of calcium ion standard solutions at a volume ratio of 1-2:1-2. Uncleaved MMPs-DNAzyme-PMPs complexes are then removed by magnetic attraction, and the supernatant is used as the sample solution. PMPs are not free in the solution, but are magnetically attracted as a complex formed by the combination of MMPs, DNAzyme, and PMPs. Calcium ions have a specific cleavage effect on DNAzyme, which hydrolyzes it. DNAzyme cannot serve as a bridge for MMPs and PMPs to connect, reducing the number of PMPs attached to MMPs and increasing the number of free PMPs in the suspension. This results in the PMPs remaining free in the solution, unaffected by magnetic attraction.

[0015] S2. Press the air cavity in the above-mentioned microfluidic device, then release the air cavity, and generate negative pressure by pressing the exhaust to drive the liquid flow. At the same time, inject 3-5μL of sample solution through the injection hole. Because the diameter of the free PMPs is larger than the aperture size of the opening at the end of the downstream particle dam, the polystyrene microparticles (PMPs) with a diameter of 15.3μm are intercepted by the narrow opening, captured and accumulated in the capture channel, accumulating to form a visible strip. The magnetic microparticles (MMPs) with a smaller diameter continue to flow through the narrow opening. Therefore, the cumulative length of PMPs can reflect the amount of free PMPs that did not form the "MMPS-DNAzyme-PMPS" complex due to the hydrolysis of DNAzyme by calcium ions. Finally, observe and obtain the cumulative strip length A of PMPs corresponding to the calcium ion standard solution at different concentrations in the capture channel. S3. Construct a standard curve with the concentration of the calcium ion standard solution as the horizontal axis and the cumulative band length A as the vertical axis; S4. Replace the calcium ion standard solution in S1 with the sample to be tested, repeat steps S1 and S2 to obtain the cumulative band length A1, and calculate the calcium ion concentration in the sample to be tested using the standard curve.

[0016] On the basis of the above technical solution, the present invention can also be improved as follows: Furthermore, the concentrations of the calcium ion standard solutions were 3 mM, 2.5 mM, 2.0 mM, 1.5 mM and 1.0 mM, respectively.

[0017] The beneficial effects of the present invention are: 1. This invention combines DNAzyme molecules with magnetic microparticles (MMPs) and polystyrene microparticles (PMPs). The resulting composite structure (MMPs-DNAzyme-PMPs) triggers a DNAzyme cleavage reaction in the presence of calcium ions, releasing free PMPs. Incorporating this into an automated capillary-driven microfluidic device, the pore diameter at the end of the particle dam is smaller than that of free PMPs, capturing and accumulating PMPs to form a visible strip. This allows for rapid quantitative detection of blood calcium concentration using the naked eye or a mobile phone camera.

[0018] 2. The microfluidic device chip used in the present invention adopts a liquid flow method driven by pressing the air cavity. Compared with traditional microfluidic chips driven by active pumping or capillary force, the press-driven method significantly improves the storage stability and shelf life of the chip by avoiding pre-stored reagents, reducing internal contamination, reducing the risk of material aging, and preventing microchannel blockage, making it more suitable for commercial production and long-term storage.

[0019] 3. The detection method of the present invention has the advantages of simple operation, high sensitivity, and no need for complex instruments. It only requires a small amount of blood sample to achieve calcium ion enrichment and concentration visualization, and is suitable for instant detection at home and in medical settings. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the synthesis of MMPs-DNAzyme-PMPs complex; Figure 2 Schematic diagram of the binding of DNAzyme molecular chain with single chains P1 and P2; Figure 3 Figure 1 is a structural diagram of the microfluidic device; Figure 4 is the cumulative band length of PMPs under the microscope; Figure 5 is the corresponding relationship between the concentration of calcium ions and the cumulative length of PMPs. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. In the examples, where specific conditions are not specified, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used where the manufacturer is not specified are conventional products that can be purchased commercially. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. It is obvious to those skilled in the art that various modifications are within the spirit and scope of the present invention as defined and determined by the appended claims, and all inventions and creations utilizing the present invention are protected.

[0022] The nucleotide sequences of the molecular chain S, base chain E, single chain P1 and single chain P2 used in the following examples are as follows: Molecular chain S: CGTGATAGGCGTGGTCACGAGTCACTATrAGGAAGATGGCGTGTAATGCTGAT (SEQ IDNO: 1); Base strand E: GCCATCTTTTCTCACAGCGTACTCGCTAAGGTTGTTAGTGACTCGTGAC (SEQ ID NO: 2); Single-stranded P1: CACGCCTATCACG (SEQ ID NO: 3); Single-stranded P2: ATCAGCATTACAC (SEQ ID NO: 4).

[0023] Example 1 A microfluidic device based on an MMPs-DNAzyme-PMPs complex includes a polydimethylsiloxane (PDMS) chip body and a substrate layer. The PDMS chip body and the substrate layer are encapsulated by plasma bonding to form a closed microchannel. The PDMS chip body includes an injection hole, a capture channel, a microcolumn array, and an air cavity. A narrow-mouthed polystyrene microparticle (PMPs) interception area is provided in the capture channel. The particle dam for interception is 4 μm wide. The microchannel is 200 μm wide and 20 μm deep for forming a visual strip. The inner surface of the channel is plasma treated to enhance hydrophilicity. The microcolumn array is used to assist in fluid control and particle distribution.

[0024] The preparation steps of the polydimethylsiloxane chip body include: UV lithography process of SU8-2015 photoresist template (650 rpm for 18 seconds, 1300 rpm for 60 seconds, and UV exposure for 12 seconds) and silanization treatment. PDMS prepolymer and curing agent are mixed in a mass ratio of 10:1 and then cured at 55°C for 5 hours to form the chip.

[0025] The bonding between the PDMS chip and the substrate was achieved by oxygen plasma treatment for 60 seconds, and the packaging was completed by baking at 55°C for 24 hours after bonding.

[0026] The air cavity was formed by fixing metal pins with epoxy resin and integrated with the PDMS chip by curing at 55 °C for 24 h.

[0027] The probe molecules used in the capture channel are MMPs-DNAzyme-PMPs complexes, such as Figure 1 As shown, the steps for preparing the MMPs-DNAzyme-PMPs complex include: S1, molecular chain S and base chain E were mixed in a molar ratio of 1:1, reacted at 95°C for 5 minutes, then lowered to 42°C and continued to react for 30 minutes to form DNAzyme; S2, respectively, mixing magnetic microparticles MMPs and single-chain P1 at a volume ratio of 2:1, and polystyrene microparticles PMPs and single-chain P2 at a volume ratio of 1:1, followed by reaction at room temperature for 30 min to obtain MMP-P1 and PMP-P2; S3. DNAzyme, MMP-P1 and PMP-P2 were mixed at a volume ratio of 1:1:1 and reacted at 42°C for 35 min. Figure 2 As shown, the partial sequences at both ends of the DNAzyme molecular chain complementarily pair with the single-stranded P1 and single-stranded P2 bases to obtain the MMPs-DNAzyme-PMPs complex.

[0028] Example 2 A method for detecting calcium ions in a solution using the microfluidic device based on the MMPs-DNAzyme-PMPs complex disclosed in Example 1 comprises the following steps: S1. Mix the MMPs-DNAzyme-PMPs complex and a series of calcium ion standard solutions with a concentration gradient (3 mM, 2.5 mM, 2.0 mM, 1.5 mM and 1.0 mM) at a volume ratio of 1:1. Then, remove the uncleaved MMPs-DNAzyme-PMPs complex by magnetic attraction, and take the supernatant as the sample solution. S2, such as Figure 3 As shown, the air cavity in the microfluidic device is pressed and then released. The negative pressure generated by pressing and exhausting the air cavity drives the liquid flow. At the same time, 3μL of sample solution is injected through the injection hole. Polystyrene microparticles (PMPs) are intercepted by the narrow opening and accumulated to form a visible strip. Magnetic microparticles (MMPs) with smaller diameters continue to flow through the narrow opening. The cumulative strip length A of PMPs corresponding to calcium ion standard solutions at different concentrations in the capture channel is observed and obtained respectively. S3. Construct a standard curve with the concentration of the calcium ion standard solution as the horizontal axis and the cumulative band length A as the vertical axis; S4, replace the calcium ion standard solution in S1 with the sample to be tested, repeat steps S1 and S2, and obtain the cumulative band length A1 ( Figure 4 ), the calcium ion concentration in the sample to be tested was calculated using the standard curve.

[0029] Experimental example Under the conditions of MMPs:PMPs=2:1 (volume ratio) and constant temperature of 42°C, two groups of solutions with different standard concentrations of Ca ions (0mM and 3mM) were tested to explore whether the cumulative length of PMPs is directly proportional to the concentration of calcium ions. Figure 5 As shown in the figure, when the Ca ion concentration is 0mM, the average cumulative length of PMPs is 3.4mm, and when the Ca ion concentration is 3mM, the average cumulative length of PMPs reaches 10.5mm. It can be seen that the cumulative length of PMPs is proportional to the calcium ion concentration.

Claims

1. A microfluidic device based on MMPs-DNAzyme-PMPs complex, characterized in that: The device comprises a polydimethylsiloxane chip body and a base layer, which are encapsulated by plasma bonding to form a closed microchannel. The polydimethylsiloxane chip body comprises an injection hole, a capture channel, a microcolumn array and an air cavity. A polystyrene microparticle interception area is provided in the capture channel to form a visual strip.

2. The microfluidic device based on the MMPs-DNAzyme-PMPs complex according to claim 1, characterized in that: The probe molecule used in the capture channel is an MMPs-DNAzyme-PMPs complex. The preparation steps of the MMPs-DNAzyme-PMPs complex include: S1. Mix the molecular chain S and the base chain E at a molar ratio of 0.5-1.5:1-2, react at 90-100°C for 5-10 minutes, then reduce the temperature to 42°C and continue the reaction for 20-40 minutes to form a DNAzyme; S2, respectively, mixing magnetic microparticles MMPs and single-chain P1 at a volume ratio of 1.5-2.5:0.5-1.5, and polystyrene microparticles PMPs and single-chain P2 at a volume ratio of 1-2:1-2, and then reacting at room temperature for 20-40 minutes to obtain MMP-P1 and PMP-P2; S3. DNAzyme, MMP-P1 and PMP-P2 are mixed in a volume ratio of 1-2:1-2:1-2, and the mixture is reacted at 42°C for 30-45 minutes. The sequences at both ends of the DNAzyme molecular chain are complementary to the single-stranded P1 and single-stranded P2 bases to obtain an MMPs-DNAzyme-PMPs complex.

3. The microfluidic device based on the MMPs-DNAzyme-PMPs complex according to claim 2, characterized in that: The nucleotide sequence of the molecular chain S is shown in SEQ ID NO: 1, the nucleotide sequence of the base chain E is shown in SEQ ID NO: 2, the nucleotide sequence of the single chain P1 is shown in SEQ ID NO: 3, and the nucleotide sequence of the single chain P2 is shown in SEQ ID NO:

4.

4. Use of the microfluidic device based on the MMPs-DNAzyme-PMPs complex according to any one of claims 1 to 3 in detecting metal ions.

5. The use according to claim 4, characterized in that The metal ion is a calcium ion.

6. A method for detecting calcium ions in a solution using the microfluidic device based on the MMPs-DNAzyme-PMPs complex according to any one of claims 1 to 3, characterized in that: The following steps are involved: S1. Mix the MMPs-DNAzyme-PMPs complex and a series of calcium ion standard solutions with a concentration gradient at a volume ratio of 1-2:1-2, then magnetically aspirate and take the supernatant as the sample solution; S2. Press the air cavity in the microfluidic device according to any one of claims 1 to 3, then release the air cavity, and simultaneously inject 3-5 μL of sample solution through the injection port, and observe and obtain the cumulative band length A of the PMPs corresponding to the calcium ion standard solution at different concentrations in the capture channel; S3. Construct a standard curve with the concentration of the calcium ion standard solution as the horizontal axis and the cumulative band length A as the vertical axis; S4. Replace the calcium ion standard solution in S1 with the sample to be tested, repeat steps S1 and S2 to obtain the cumulative band length A1, and calculate the calcium ion concentration in the sample to be tested using the standard curve.

7. The method for detecting calcium ions in a solution according to claim 6, wherein The concentrations of the calcium ion standard solutions are 3 mM, 2.5 mM, 2.0 mM, 1.5 mM and 1.0 mM respectively.

Images