Rabbit monoclonal antibody and application

Abstract

The invention belongs to the field of biology, and discloses a rabbit monoclonal antibody for resisting chicken IFN-gamma protein, the rabbit monoclonal antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of a heavy chain variable region of the monoclonal antibody is as shown in SEQ ID No.1; the amino acid sequence of the light chain variable region of the monoclonal antibody is as shown in SEQ ID No.2. The rabbit monoclonal antibody is named Ab-56, and has the following characteristics: 1, compared with the existing monoclonal antibody, the rabbit monoclonal antibody has very strong binding capacity with interferon; and 2, the compound also has very strong combining capacity with duck interferon. Therefore, a solid foundation is provided for evaluation of immune protection effects generated by novel vaccines such as mRNA vaccines, DNA vaccines or live virus vector vaccines and research on immune reaction mechanisms caused by virus infection, and meanwhile, the method is not only suitable for vaccine evaluation of chickens, but also suitable for vaccine evaluation of ducks and even other poultry and research on cellular immune protection mechanisms. Meanwhile, the invention also provides a monoclonal antibody and application.

Description

Technical Field

[0001] The present invention relates to the biological field, in particular to a rabbit-derived monoclonal antibody and its application. Background Art

[0002] Interferon (IFN) is a protein with broad-spectrum antiviral activity. IFNs primarily include three types: α, β, and γ. IFN-α and IFN-β are type I IFNs, while IFN-γ is a type II IFN. Type I and II IFNs are produced by different cells, leading to distinct signal transduction pathways and the resulting antiviral proteins. IFN-γ is an important cytokine secreted by immune cells such as T cells, natural killer cells (NK cells), and phagocytes. It plays a key role in immune responses, particularly in antiviral and antitumor activities, and in regulating immune responses. It also functions as a vaccine adjuvant. Chicken interferon-γ (chIFN-γ) was discovered by Lowen Thal et al. from mitogen-stimulated chicken splenic lymphocytes. Subsequently, Digby et al. successfully cloned the chIFN-γ gene. Further studies revealed that chIFN-γ shares the same immune functions as mammalian IFN-γ, exhibiting antiviral activity and vaccine adjuvant activity.

[0003] For the immunological detection of chIFN-γ, methods such as enzyme-linked immunospot assay (ELISPOT) and enzyme-linked immunosorbent assay (ELISA) can be established. ELISPOT is a highly sensitive immunoassay technology that combines cell culture technology with ELISA. This technology captures cytokines secreted by cultured cells and presents them in the form of enzyme-linked spot color development. It can detect the secretion of cytokines or immunoglobulins at the single-cell level and accurately reflect the activity level of cells in the immune system. This technology combines many advantages such as high sensitivity, high reliability, high throughput, single-cell level, functional detection and low cost. It is the best technology for detecting the cellular immunity level of organisms today. Therefore, it is widely used in vaccine development, immune monitoring of infectious diseases and autoimmune diseases.

[0004] Many avian infectious diseases (such as H9N2 subtype avian influenza, Marek's disease, and infectious bursal disease) rely not only on antibodies but also on cellular immune responses to clear the infection. T cells (particularly CD8+ cytotoxic T cells) play a key role in killing infected cells and inhibiting viral replication. Inactivated vaccines and certain subunit vaccines typically primarily induce humoral immune responses (antibodies), but cellular immune responses are equally crucial, and therefore, monitoring cellular immune responses is necessary to fully evaluate vaccine effectiveness. Using the ELISPOT technique to measure IFN-γ secretion, we can directly assess the response of immune cells, particularly T cells, to specific antigens, reflecting whether these cells have been activated and are playing an effective role in the immune response. This method can detect immune responses earlier and quantify their intensity, playing a vital role in infectious disease monitoring and the development and evaluation of related new vaccines.

[0005] Reports on anti-chIFN-γ monoclonal antibodies and their use in ELISPOT assays can be found in the following literature:

[0006] Publication No. CN118497137A, the subject of which is the preparation and application of a monoclonal antibody that can be used in the chicken IFN-γ ELISPOT test, discloses a hybridoma cell line that can stably secrete a monoclonal antibody against chicken IFN-γ protein, and uses the secreted monoclonal antibody as a coating antibody for an ELISPOT test. The results show that the cells secrete chIFN-γ under phorbol ester + ionomycin stimulation and exhibit better reactivity than foreign chIFN-γ antibody pairs.

[0007] The problem to be solved in this case is: how to screen out a monoclonal antibody with better and more comprehensive performance. Summary of the Invention

[0008] The present invention aims to provide a rabbit-derived monoclonal antibody against the chIFN-γ protein, designated Ab-56. This rabbit-derived monoclonal antibody exhibits the following characteristics: 1. Compared to existing monoclonal antibodies, it has a stronger binding affinity to interferon; 2. It also has a strong binding affinity to duck interferon. This provides a solid foundation for evaluating the immune protection of novel vaccines, such as mRNA, DNA, or live viral vector vaccines, and for studying the mechanisms of immune responses following viral infection. Furthermore, this antibody is suitable not only for chickens but also for evaluating vaccines and studying the mechanisms of cellular immune protection in ducks and even other poultry.

[0009] At the same time, the present invention also provides monoclonal antibodies and applications.

[0010] To achieve the above object, the present invention provides the following technical solutions:

[0011] A rabbit-derived monoclonal antibody against chicken IFN-γ protein, comprising a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID No. 1; and the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID No. 2.

[0012] Furthermore, the full-length amino acid sequence of the heavy chain of the rabbit monoclonal antibody is shown in SEQ ID No. 8, and the full-length amino acid sequence of the light chain is shown in SEQ ID No. 9.

[0013] The invention also discloses the use of the rabbit-derived monoclonal antibody preparation kit.

[0014] In the above-mentioned use, the rabbit-derived monoclonal antibody is the coating antibody and / or detection antibody in the kit.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] 1. The rabbit monoclonal antibody of the present invention has a stronger binding ability to interferon than existing monoclonal antibodies;

[0017] 2. The rabbit monoclonal antibody prepared by the present invention also has a strong binding ability with duck interferon;

[0018] The above two characteristics provide a solid foundation for the evaluation of the cellular immune protection effects of some new mRNA vaccines, DNA vaccines or live virus vector vaccines and the study of the mechanism of cellular immune response after viral infection. At the same time, it is not only applicable to chickens, but also to ducks and even other poultry vaccine evaluation and cellular immune protection mechanism research. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the plasmid map of the prokaryotic expression vector pET21b-chIFN-γ of Example 1 of the present invention;

[0020] Figure 2 This is an SDS-PAGE gel electrophoresis diagram of prokaryotic expression of chIFN-γ in Example 1 of the present invention;

[0021] Figure 3 This is the plasmid map of the eukaryotic expression vector pRK5-chIFN-γ of Example 2 of the present invention;

[0022] Figure 4A This is the expression map of the anti-chIFN-γ rabbit monoclonal antibody expression vector carrying the antibody heavy chain constructed in Example 3 of the present invention;

[0023] Figure 4BThis is the expression profile of the anti-chIFN-γ rabbit monoclonal antibody expression vector carrying the light chain vector constructed in Example 3 of the present invention;

[0024] Figure 5 This is a graph showing the results of 96 B lymphocyte cultures sorted by ELISA in Example 3 of the present invention;

[0025] Figure 6A This is an SDS-PAGE gel electrophoresis diagram of the anti-chIFN-γ rabbit monoclonal antibody expressed in Example 3 of the present invention;

[0026] Figure 6B This is a graph showing the antibody titer of the anti-chIFN-γ rabbit monoclonal antibody expressed in Example 4 of the present invention;

[0027] Figure 6C The results of the affinity tests of the three monoclonal antibodies and foreign antibodies measured by ELISA in Example 4 of the present invention are as follows;

[0028] Figure 7 This is a WB result diagram of the detection of chicken chIFN-γ by the rabbit monoclonal antibody Ab-56 in Example 5 of the present invention;

[0029] Figure 8 This is a WB result diagram of the detection of duck DuIFN-γ by the rabbit monoclonal antibody Ab-56 in Example 6 of the present invention;

[0030] Figure 9 This is a diagram showing the results of the monoclonal antibody combination screening of Example 8 of the present invention;

[0031] Figure 10 This is a diagram showing the screening results of the optimal coating antibody concentration and the color developing solution in Example 8 of the present invention;

[0032] Figure 11 This is a diagram showing the screening results of the optimal biotin-labeled detection antibody concentration in Example 8 of the present invention;

[0033] Figure 12 This is a diagram showing the screening results of the optimal HRP-labeled streptavidin concentration in Example 8 of the present invention. DETAILED DESCRIPTION

[0034] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention. Specific embodiment 1

[0036] A method for prokaryotic expression of recombinant chIFN-γ protein, comprising the following steps:

[0037] RNA was extracted from the spleen of 6-8 week old chickens using the Magen RNA extraction kit (Cat. No. R411102). RNA was then reverse transcribed using the Solebro Reverse Transcription Kit (M-MLV, Cat. No. 2641Q) using oligo-dT primers to generate cDNA for PCR amplification of the chIFN-γ gene. The PCR amplification primer sequences are:

[0038] chIFN-γ-F(GCGCCATTGCTAAATCTTGTTC,SEQ ID NO.14)

[0039] chIFN-γ-R(GGCCTCGAGGCAATTGCATCTCCTCTG,SEQ ID NO.15)

[0040] The PCR reaction system contained 4 μL of cDNA, 1 μL of forward primer (10 mM), 1 μL of reverse primer (10 mM), 6.5 μL of ddH₂O, and 12.5 μL of 2× Phanta Max Master Mix (Dye Plus) (Norvozymes, Cat. No. P525). The PCR program was 95°C denaturation for 5 min, followed by 30 cycles of denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 60 s. Extension at 72°C for 5 min was followed by a 4°C hold. The amplified band was 450 bp and represented the chIFN-γ protein sequence without the signal peptide. Sequencing results were consistent with the chIFN-γ gene accession number (X99774.1) in GenBank.

[0041] The chIFN-γ gene amplified by PCR and the pET21b(+) vector stored in the laboratory were double-digested with Nde I (Cat. No. R0111V) and Xho I (Cat. No. R0146V) purchased from NEB, and ligated with T4 ligase (Cat. No. M0202V) from NEB to construct the pET21b-chIFN-γ prokaryotic expression plasmid. This plasmid has a 6×His tag at the C-terminus of the chIFN-γ gene for protein purification (see the plasmid map for details). Figure 1 ).

[0042] Add the pET21b-chIFN-γ plasmid to an EP tube containing BL21DE3 competent cells (Biyuntian, Cat. No. C1400). Mix gently, then incubate on ice for 30 minutes. Heat shock the cells in a 42°C water bath for 45 seconds, and then incubate on ice for another 2 minutes. Add 500 μL of LB solution without antibiotics and incubate the cells at 37°C, 220 rpm, and shake for 45 minutes. Spread 150 μL of the bacterial solution onto ampicillin LB solid medium and incubate the cells at 37°C overnight. Pick five single colonies and incubate them in 1 mL of ampicillin LB medium. Incubate the cells at 37°C, shaking, for 4-6 hours. PCR is then performed using the chIFN-γ gene amplification primers and the bacterial solution as a template. Positive bacterial cultures are then sent for sequencing.

[0043] The correct bacterial suspension was inoculated with 10 mL of ampicillin LB culture medium at a ratio of 1:100 for overnight activation. The next day, it was transferred to 200 mL of ampicillin LB culture medium at a ratio of 1:50 and cultured at 37°C and 200 rpm until the OD 600nm About 0.6-0.8, add IPTG to a final concentration of 0.5mM, and induce at 37°C, 200rpm for 8h. Collect the bacterial solution by centrifugation, resuspend in PBS, and ultrasonically break the protein to release it. Centrifuge and take the supernatant. Purify according to the instructions of GenScript NI affinity chromatography column (Cat. No. L00250), remove impurities with 100mM imidazole, and elute with 200mM imidazole. A total of 10mg of prokaryotic expressed soluble chIFN-γ protein was obtained (SDS-PAGE gel electrophoresis is shown in Figure 2). Figure 2 ).

[0044] Example 2

[0045] A eukaryotic expression method for preparing recombinant chIFN-γ protein, comprising the following steps:

[0046] The chIFN-γ gene amplified in Example 1 was inserted into the commercial vector pRK5 stored in the laboratory, and the eukaryotic expression plasmid pRK5-chIFN-γ was constructed according to the method of Example 1 (refer to Figure 3 The constructed plasmid was transformed into Trans5α competent E. coli cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.). Positive single clones with correct sequences were identified by colony PCR and sequencing. Positive single clones were inoculated at a ratio of 1:100 into a test tube containing 20 mL of ampicillin LB broth and cultured overnight at 37°C and 200 rpm. The bacterial culture was harvested and the plasmid was extracted using an endotoxin-free plasmid extraction kit (OMEGA, Cat. No. D694302).

[0047] Two to three hours before transfection, seed 200 mL of HEK293F cells at a density of 2 × 10⁶ / mL in a sterile shake flask. Add 300 μg of plasmid DNA to 20 mL of fresh culture medium, mix thoroughly, and then add 900 μL of PEI transfection reagent (Qihang Liye, Cat. No. BYPS-24765). Mix thoroughly and let stand for 10-20 minutes to form a DNA-PEI complex, which is then evenly added to the transfection shake flask. Measure protein expression 60-72 hours after transfection.

[0048] Since chIFN-γ protein was well expressed in the cell supernatant, it was purified using a NI affinity chromatography column (GenScript, Cat. No. L00250) according to the manufacturer's instructions to obtain 2 mg of protein. The purified chIFN-γ was then labeled using a FITC labeling kit (Beyotime, Cat. No. P0639M) and used as an antigen for isolation of chIFN-γ-specific single B cells.

[0049] Example 3

[0050] Preparation of chIFN-γ-specific monoclonal antibodies using flow cytometry. The specific procedures are as follows:

[0051] Healthy adult New Zealand white rabbits weighing more than 2 kg were selected, and 1 mL of recombinant chIFN-γ protein containing 500 μg of prokaryotic expression was mixed with an equal volume of Freund's complete adjuvant (Sigma) and emulsified. Multiple immunizations were performed subcutaneously on both sides of the rabbit's spine. Two weeks later, a second immunization was performed, and incomplete Freund's adjuvant (Sigma) was used. The method and dosage were the same as the first immunization. On the 8th day after each immunization, 1 mL of blood was collected from the ear vein to separate the serum. The antibody titer was tested by ELISA. The antibody titer was greater than 10 6 End of immunity.

[0052] To perform flow cytometry sorting on rabbit spleen B lymphocytes and screen out chIFN-γ specific single B cells, rabbit spleen lymphocytes were isolated using a PBMC isolation kit (Solarbio, Cat. No. P8760), resuspended in ice-cold FACS buffer and adjusted to a cell concentration of 10 6 10 μg of phycoerythrin (PE)-labeled goat anti-rabbit secondary antibody (abcom, Catalog No. ab72465) and 20 μg of BV421-labeled eukaryotically expressed recombinant chIFN-γ protein prepared in Example 2 were added sequentially and incubated on ice for 30 minutes to allow the marker to fully bind to the cell surface antigen receptor.

[0053] After labeling, centrifuge at 400 g for 10 minutes, resuspend the cells in ice-cold FACS buffer and wash three times, adjust the volume to 500 μL FACS buffer, transfer to a sterile flow cytometer and place on ice. Optimize the conditions on the flow cytometer, set the sorting gate and flow rate, and use the sorting system to separate the PE + BV421 + The cells were sorted into a 96-well PCR plate containing reverse transcriptase and lysis buffer. These cells were chIFN-γ specific single B lymphocytes.

[0054] Single specific single B cells in a 96-well PCR plate were lysed at room temperature, and the heavy and light chain variable region mRNAs were reverse transcribed into cDNA templates using oligo-dT primers. Two rounds of nested PCR were performed using primers provided by Yantai Teke Biotechnology Co., Ltd. to obtain the antibody heavy and light chain variable region DNA genes. The amplified products were sequenced to obtain the VH and VL amino acid sequences. The selected VH and VL genes were cloned into plasmid expression vectors (pTT5CH, pTT5CL) with light and heavy chain constant regions, respectively, and inserted upstream of the CH and CL genes to obtain light and heavy chain gene expression vectors. The vector contains IL-2 secretion signal peptide (SEQ ID No.7: MYRMQLLSCIALSLALVTNS), leader sequence, promoter sequence, poly (A) sequence, rabbit monoclonal antibody heavy chain constant region (CH) and light chain constant region (CL) genes and other elements. Vector map is shown in Figure 4A and Figure 4B The constructed vector was transformed into Trans5α competent E. coli cells to prepare sufficient plasmid for subsequent transfection and expression.

[0055] 1 μg of plasmid containing heavy and light chain genes was transferred into HEK293T cells in a 24-well plate at a ratio of 1:1. The cells expressed the heavy and light chains and assembled them into a complete antibody structure and released it into the culture medium. After 60-72 hours of culture, the supernatant contained recombinant rabbit monoclonal antibodies that could recognize chIFN-γ. Figure 5 It can be seen that 27 of the 96 cell supernatants were chIFN-γ positive. After removing non-specifically reactive B lymphocytes, 8 chIFN-γ-specific single B lymphocyte strains were obtained. The antibodies produced by them were named Ab-6, Ab-24, Ab-38, Ab-48, Ab-56, Ab-66, Ab-68, and Ab-75. The three strains with the highest affinity (Ab-38, Ab-56, and Ab-68 antibodies) were selected for subsequent experiments. The amino acid sequences of their variable regions are as follows:

[0056] Ab-56 antibody, the amino acid sequence of the heavy chain variable region is shown in SEQ ID No. 1, the amino acid sequence of the light chain variable region is shown in SEQ ID No. 2, the full-length amino acid sequence of the heavy chain is shown in SEQ ID No. 8, and the full-length amino acid sequence of the light chain is shown in SEQ ID No. 9;

[0057] Ab-68 antibody, the heavy chain variable region is shown in SEQ ID No. 3, the light chain variable region is shown in SEQ ID No. 4, the full-length amino acid sequence of the heavy chain is shown in SEQ ID No. 10, and the full-length amino acid sequence of the light chain is shown in SEQ ID No. 11;

[0058] The Ab-38 antibody has a heavy chain variable region as shown in SEQ ID No. 5, a light chain variable region as shown in SEQ ID No. 6, a full-length amino acid sequence of its heavy chain as shown in SEQ ID No. 12, and a full-length amino acid sequence of its light chain as shown in SEQ ID No. 13.

[0059] Referring to the method in Example 2, HEK293F cells were used to express the three monoclonal antibodies mentioned above in large quantities. Protein A affinity gel resin was used to purify the monoclonal antibodies from the supernatant, and the antibody expression was identified by SDS-PAGE gel electrophoresis. The results are shown in FIG. Figure 6A As shown, all antibodies showed distinct bands at 55 kDa and 25 kDa, indicating successful antibody expression. Antibodies were concentrated to 1 mg / mL using a 30 kDa concentrator tube and stored in a -20°C freezer until use.

[0060] Example 4

[0061] The binding ability of the prepared monoclonal antibody to chIFN-γ was determined by ELISA as follows:

[0062] The prokaryotically expressed chIFN-γ protein was diluted to 1 μg / ml with PBS and coated on a 96-well ELISA plate at 100 μL / well at 4°C overnight. The plate was washed three times with 200 μL PBST for 3 minutes each time, and 200 μL of PBS containing 5% skim milk was added to each well and blocked at 37°C for 2 hours. The plate was washed again with 200 μL PBST three times for 3 minutes each time. The antibody to be tested was added at 100 μL / well in a 2-fold gradient (starting from 1:400) and allowed to stand at 37°C for 1 hour. The plate was washed three times with 200 μL PBST for 3 minutes each time. HRP-labeled goat anti-rabbit IgG antibody was diluted 1:5000 with PBS containing 2.5wt% skim milk powder, 100 μL was added to each well, and allowed to stand at 37°C for 1 hour. The plate was washed three times with 200 μL PBST for 3 minutes each time. Add 100 μL of commercial TMB colorimetric solution to each well, react at room temperature in the dark for 15 min, then add 50 μL of 2M H2SO4 to terminate the reaction and read with a microplate reader. Absorbance value.

[0063] Foreign antibody (MT7C10) was used as a positive control and the same steps were followed, but the secondary antibody was HRP-labeled goat anti-mouse IgG antibody.

[0064] 2.1 times the negative control The value is the CUT OFF value, the result is shown in Figure 6B As shown, the titers of Ab-38, Ab-56, and Ab-68 antibodies were all greater than 1:819200, which were higher than the titer of the foreign antibody (MT7C10).

[0065] The affinity dissociation constant (KD value) of an antibody is an important indicator for measuring the binding affinity between an antibody and an antigen. Its value varies with different antibody-antigen pairs and is generally around 10 -6 -10 -12 mol / L, the smaller the KD value, the higher the affinity. Plot a scatter plot using absorbance as the ordinate and antibody concentration as the abscissa, generating a logarithmic trend line and corresponding formula. Substituting half of the maximum absorbance (this value is considered the absorbance at which the antigen-antibody binding rate is 50%) into the above formula, the antibody concentration is calculated, and this concentration value is the antibody affinity dissociation constant (KD).

[0066] The results are as follows Figure 6C As shown. After calculation, the KD of the four monoclonal antibodies are as follows:

[0067] Ab-38 strain: 8.08×10 -11 mol / L;

[0068] Ab-56 strain: 6.49×10 -11 mol / L;

[0069] Ab-68 strain: 7.16×10 -11 mol / L;

[0070] Foreign antibody (MT7C10): 2.05×10 -10 mol / L.

[0071] The KD values of the above four monoclonal antibodies are all within the high affinity range, and therefore they are all high-affinity antibodies.

[0072] Among them, the KD values of Ab-38, Ab-56 and Ab-68 strains are relatively close, and their affinity levels are comparable; the KD values of foreign antibodies are relatively large, and although they are within the range of high-affinity antibodies, their affinity is slightly lower than that of the three antibodies provided by the present invention.

[0073] Example 5

[0074] The binding ability of the prepared monoclonal antibodies to chIFN-γ was determined by Western Blot.

[0075] The specific operations are as follows:

[0076] (1) Dilute the prokaryotically expressed chIFN-γ to a concentration of 0.5 mg / mL. Take 50 μL of the sample and mix it with 10 μL of 6× protein loading buffer. Boil it at 100°C for 10 min. Take 10 μL of the sample and apply it to SDS-PAGE gel electrophoresis. Since the target protein is approximately 15 kDa, the protein gel concentration used is 12 wt%. Transfer the protein to a PVDF membrane by Western blotting. After transfer, remove the PVDF membrane, rinse with PBS, and block it with 10 mL of PBS containing 5 wt% skim milk at 37°C for 2 h.

[0077] (2) The blocked PVDF membrane was washed three times with PBST for 5 minutes each time, and 10 mL of Ab-56 antibody diluted 1:5000 with 2.5 wt% skim milk in PBS was added and incubated overnight at 4°C. A control was also performed with a foreign anti-chIFN-γ antibody.

[0078] (3) Wash three times with PBST for 5 min each time, add 10 mL of commercial HRP-labeled goat anti-rabbit IgG antibody (Biyuntian, Catalog No. A0208) diluted 1:5000 with 2.5 wt% skim milk in PBS, and incubate at 37°C for 1 h. The secondary antibody used in the control group (foreign anti-chIFN-γ antibody group) was HRP-labeled goat anti-mouse IgG antibody (Biyuntian, Catalog No. A0216).

[0079] (4) Wash three times with PBST, 5 min each time, add ECL luminescent solution, and react for 1 min at room temperature in the dark. Photograph and analyze using a chemiluminescence imaging system.

[0080] The results are as follows Figure 7 As shown, Ab-56 showed distinct positive bands at 16 kDa and 32 kDa (chIFN-γ dimer), indicating that the antibody Ab-56 of the present invention reacts well with chIFN-γ and can provide important materials for Western blot detection of chIFN-γ. The foreign antibody (MT7C10) showed similar detection performance to Ab-56.

[0081] Example 6

[0082] The amino acid sequence similarity between chIFN-γ and mammalian IFN-γ differs significantly. For example, the similarity with rabbit IFN-γ is only 25.5%, but the similarity with duck IFN-γ (duIFN-γ) is 66.1%. This suggests that the two share a certain degree of similarity, and some epitopes may be recognized by chIFN-γ monoclonal antibodies.

[0083] A prokaryotic expression vector of DuIFN-γ was constructed and the DuIFN-γ protein was expressed according to the method in Example 1. Then, the binding ability of the prepared monoclonal antibody to DuIFN-γ was determined by Western Blot according to the steps in Example 5.

[0084] like Figure 8 As shown in the figure, the results show that Ab-56 antibody also has strong binding ability to DuIFN-γ. At the same time, compared with the foreign antibody (MT7C10), Ab-56 antibody has significantly stronger binding ability to DuIFN-γ than the foreign antibody. Therefore, Ab-56 antibody has great potential for the detection of DuIFN-γ.

[0085] Example 7

[0086] Exploration of ELISPOT kit conditions

[0087] In Example 4, Ab-38 antibody, Ab-56 antibody, and Ab-68 antibody were screened out as having the highest affinity; these three antibodies were labeled with HRP, HRP-Ab-38 (corresponding to Ab-38 antibody), HRP-Ab-56 (corresponding to Ab-56 antibody), and HRP-Ab-68 (corresponding to Ab-68 antibody), and their effectiveness as detection antibodies was evaluated by ELISA.

[0088] The specific operations are:

[0089] (1) Dilute the purified chIFN-γ to a concentration of 1 μg / mL with PBS at a 3-fold dilution ratio, add 100 μL per well to a 96-well ELISA plate, and incubate at 4°C overnight.

[0090] (2) Wash three times with PBST, 200 μL each time, add PBST containing 5 wt% skim milk to each well, 200 μL / well, and block at 37°C for 1 h.

[0091] (3) Wash three times with PBST, 200 μL each time, and add 1 mg / mL HRP-Ab-38, HRP-Ab-56, and HRP-Ab-68 diluted 1:2000, 100 μL / well to each well, and incubate at 37°C for 1 h.

[0092] (4) Wash 3 times with 200 μL of PBST each time, develop with 100 μL of TMB colorimetric solution at room temperature in the dark for 15 min, add 50 μL of 3M H2SO4 to terminate the reaction, and read the OD value using a microplate reader. 450nm The following readings.

[0093] As shown in Table 1, all three antibodies have strong binding ability to interferon at different coating concentrations. In the absence of chIFN-γ coating, antibody No. 38 has a high background value as a detection antibody and is therefore not recommended for use as a detection antibody.

[0094] Table 1. Test results of chIFN-γ binding ability of different antibodies

[0095]

[0096]

[0097] Example 8

[0098] Determination of optimal antibody pairs

[0099] (1) Use Ab-38, Ab-56, or Ab-68 as coating antibodies at a concentration of 5 μg / mL, with 100 μL per well coated on an ELISPOT filter plate.

[0100] (2) Wash with sterile PBS three times, add 10 μL of PHA stimulation to each well (200 μL each time) as the positive well, add 10 μL of PBS to the control group (negative control), add 1×10^6 chicken PBMC cells / well, and culture at 37°C, 5% CO2 for 48 hours.

[0101] (3) Wash three times with PBS, 200 μL each time, and use bio-Ab-56 (biotin-labeled Ab-56 detection antibody) and bio-Ab-68 (biotin-labeled Ab-68 detection antibody) at a concentration of 1 μg / mL as detection antibodies, 100 μL / well, and incubate at 37°C for 1 h.

[0102] (4) Wash three times with PBS, 200 μL each time, add 1:2000 diluted HRP-labeled streptavidin to each well, 100 μL / well, and incubate at 37°C for 1 h.

[0103] (5) Wash three times with PBS (200 μL each time), develop with TMB colorimetric solution for 15 min at room temperature, and rinse four times with deionized water. Discard the liquid, place in a ventilated place away from light to dry, and photograph the corresponding wells using a plate reader.

[0104] as follows Figure 9As shown, when Ab-56 was used as the coating antibody and bio-Ab-68 was used as the detection antibody, the number of spots was the largest and clearest, the staining background color was light, and there were no obvious spots in the control group.

[0105] Optimal coating antibody concentration and color development solution selection

[0106] The Ab-56 antibody protein was diluted to six concentrations of 10 μg / mL, 5 μg / mL, 2.5 μg / mL, 1.25 μg / mL, 0.625 μg / mL, and 0.3125 μg / mL with PBS buffer, and 100 μL per well was coated on the ELISPOT plate. Then, the ELISPOT-related steps were continued, and finally different color development solutions were used for color development.

[0107] Depend on Figure 10 As can be seen, at a 5 μg / mL dilution (500 ng / well), the number of spots was appropriate and clear, with a light background color. The control group had no obvious spots. At various concentrations, the number of spots produced by the AEC chromogen (solarbio, Cat. No. A2010) was consistently lower than that of the TMB chromogen (Mabtech, Cat. No. 3651-10), indicating its higher sensitivity. Therefore, the TMB chromogen was selected as the final chromogen.

[0108] Selection of optimal biotinylated detection antibody concentration

[0109] Bio-Ab-68 was diluted to 5 working concentrations of 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, 0.125 μg / mL, and 0.0625 μg / mL using PBS containing 0.5% FBS. ELISPOT was then performed. The results were judged based on the number of spots in the experimental group and the appropriate light background color of the staining, and the absence of obvious spots in the control group. Figure 11 , and finally determined that the optimal detection antibody bio-Ab-68 concentration was 0.5 μg / mL.

[0110] Selection of the optimal HRP-conjugated streptavidin concentration

[0111] Perform ELISPOT-related operations according to the conditions explored above. After incubation with bio-Ab-68 for 1 hour, wash three times with PBS, 200 μL each time. Dilute HRP-labeled streptavidin (Mabtech, product number 3310-9-1000) with PBS containing 0.5% FBS at a ratio of 1:1000, 1:2000, 1:4000, 1:8000, and 1:16000, respectively. Add 100 μL to each well and incubate at 37°C for 1 hour. Then continue the ELISPOT color development and termination operations. The judgment criteria are the appropriate number of spots in the experimental group, the light background color of the staining, and the absence of obvious spots in the control group. Reference Figure 12 As a result, the optimal HRP-labeled streptavidin dilution ratio was finally determined to be 1:1000.

[0112] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the invention can be embodied in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the invention is defined by the appended claims, not the foregoing description, and all variations within the meaning and range of equivalents of the claims are intended to be included therein. Any reference sign in a claim should not be construed as limiting the claim to which it relates.

Claims

1. A rabbit monoclonal antibody against chicken IFN-γ protein, characterized in that: The rabbit monoclonal antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID No. 1; the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID No.

2.

2. Use of the kit for preparing rabbit monoclonal antibodies according to claim 1.

3. The use according to claim 2, characterized in that The rabbit-derived monoclonal antibody is the coating antibody and / or detection antibody in the kit.

Images