A porcine rotavirus reverse genetic system and application thereof

By constructing a porcine rotavirus reverse genetics system, 11 gene fragments were recombined into the pOK-T7 vector and NSP2 and NSP5 were merged to successfully rescue the G9P[23] genotype porcine rotavirus, solving the problem of rescuing viruses of different genotypes and promoting the study of viral protein function and vaccine development.

CN120464587BActive Publication Date: 2025-10-17HARBIN VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES (CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER HARBIN BRANCH CENTER)
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510977065.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-16
Publication Date
2025-10-17
Estimated Expiration
2045-07-16

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively establish reverse genetic systems for different genotypes of porcine rotavirus, especially for the rescue of the G9P[23] genotype of porcine rotavirus, which has limited the research on viral protein function and vaccine development.

Method used

A reverse genetic operating system was constructed by recombining 11 gene segments of porcine rotavirus into the pOK-T7 vector to form 10 infectious recombinant plasmids, in which the NSP2 and NSP5 gene segments were merged into one plasmid (pOK-T7-NSP2/5) and co-transfected with the auxiliary plasmid C3P3-G1, successfully rescuing the G9P[23] genotype porcine rotavirus NMTL strain.

Benefits of technology

Efficient rescue of G9P[23] genotype porcine rotavirus was achieved, and the recombinant virus strain rNMTL was obtained, supporting further research on viral protein function and vaccine development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464587B_ABST
    Figure CN120464587B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a rotavirus reverse genetic system and application thereof in rescuing NMTL porcine rotavirus strain. The application finds that the reverse genetic operation system used in the rescue work of rotavirus of different genotypes is significantly different. For the G9P[23] genotype porcine rotavirus strain of the application, 11 gene fragments of porcine rotavirus are recombined into pOK-T7 carriers to obtain 10 porcine rotavirus infectious recombinant plasmids. In the application, the genes encoding virus NSP2 and NSP5 are placed into a plasmid to obtain a pOK-T7-NSP2 / 5 plasmid, and finally a reverse genetic system based on the 10 porcine rotavirus infectious recombinant plasmids is formed. The system can successfully rescue the G9P[23] genotype porcine rotavirus NMTL strain to obtain a rNMTL porcine rotavirus recombinant strain.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a rotavirus reverse genetic system and application thereof in rescuing NMTL porcine rotavirus strains. BACKGROUND

[0002] Porcine rotavirus is a member of the Rotavirus genus of the Reoviridae family, which is a non-enveloped, segmented double-stranded RNA virus. The porcine rotavirus particle is icosahedral symmetry, and the genome contains 11 segments, which encode 6 structural proteins (VP1, VP2, VP3, VP4, VP6, VP7) and 6 non-structural proteins (NSP1, NSP2, NSP3, NSP4, NSP5, NSP6).

[0003] According to the antigenicity of the viral capsid protein VP6, it is divided into 11 groups (Group A -E, G-L), among which A, B and C groups are the most common pathogenic types in pigs, especially Group A, which is prevalent worldwide, with a prevalence rate of 3.3%~67.3%, and the infection rate in large-scale farms is as high as 61%~74% (Presence and characterization of pig group A and C rotaviruses in feces of Belgian diarrheic suckling piglets[J]. Virus Res.2016;213:172-183.). Studies have shown that there are at least 9 G genotypes in China, including: G1, G2, G3, G4, G5, G9, G11, G12, G26; 5 P genotypes, including: P[3], P[6], P[7], P

[13] , P

[23] . However, it is difficult to isolate rotaviruses, especially rare genotype strains. Currently, only G1, G3, G4, G5, G9, G11, G12 strains can be isolated, while G2 and G26 cannot be isolated. The detection rate of G26 began to increase in 2024. Since the strains cannot be isolated, the study of the biological characteristics of these strains is blank, and G11 and G26 strains cannot be prevented by vaccination.

[0004] Virus reverse genetics system (RGS) is an important technical means to promote the research of virus protein function, pathogenic mechanism and vaccine development. In 2010, Troupin et al. reported a rotavirus reverse genetics method based on rearranged gene fragments preferentially packaged (Rearranged genomic RNA segments offer a new approach to the reverse genetics of rotaviruses [J]. J Virol. 2010; 84(13): 6711-6719.). However, it is still difficult to develop a complete plasmid-based reverse genetics system. In 2017, Kanai et al. disclosed a rotavirus reverse genetics system based on monkey rotavirus SA11 strain. The system includes 14 plasmids, of which 11 plasmids encode 11 gene fragments of simian rotavirus, and the remaining 3 plasmids are auxiliary plasmids (pCAG-FAST, pCAG-D1R, pCAG-D12L). However, the 14-plasmid system has the problem of extremely low virus rescue efficiency (Entirely plasmid-based reverse genetics system for rotaviruses [J]. Proc Natl Acad Sci U S A. 2017; 114(9): 2349-2354.). In order to improve the virus rescue rate, the Pattona laboratory tried to change the 3 auxiliary plasmids into 1 auxiliary plasmid. The plasmid expresses African swine fever virus capping enzyme gene NP868R , and the virus rescue efficiency is significantly higher than that of the 14-plasmid system (Generation of Recombinant Rotavirus Expressing NSP3-UnaG Fusion Protein by a Simplified Reverse Genetics System [J]. J Virol. 2019; 93(24): e01616-19.). Subsequently, Sánchez-Tacuba et al. further improved the auxiliary plasmid, and NP868RThe T7 polymerase is added on the basis to form the NP868R-T7 fusion protein (C3P3-G1), the improved auxiliary protein is capped by the capping enzyme immediately after transcription, and the capping efficiency of the viral mRNA is improved (An Optimized Reverse Genetics System Suitable for Efficient Recovery of Simian, Human, and Murine-Like Rotaviruses [J]. J Virol. 2020; 94 (18): e01294-20.).

[0005] The reverse genetic studies of the above-mentioned rotaviruses are all based on human and monkey rotaviruses as research objects, and the establishment of a porcine rotavirus reverse genetics system has not been reported for a long time. In March 2025, Jiangxi Agricultural University disclosed a porcine rotavirus isolate PoRV-AY01 reverse genetics system based on the SA11 strain reverse genetics system. The system replaces the 11 fragments of the PoRV-AY01 strain infectious recombinant plasmid into the corresponding plasmid of the SA11 strain to rescue, and successfully rescues 11 rSA11-AY01 recombinant strains (Porcine Rotavirus Jiangxi Isolate AY01 Reverse Genetics System Establishment and Chimeric Antigen Recombinant Rotavirus Cross-Neutralization Research [D]. Jiangxi Agricultural University, 2024.).

[0006] The porcine rotavirus AY01 strain reported by the above-mentioned research belongs to the G5 type rotavirus, and rotaviruses of different genotypes have certain specificity, and there are differences in the research strategies when conducting virus protein function research, pathogenic mechanism and vaccine development. Therefore, the establishment of reverse genetics systems for different genotypes of porcine rotaviruses and the rescue of different genotypes of porcine rotaviruses are still difficult to overcome. SUMMARY

[0007] The present application finds that the reverse genetic operation system used for the rescue work of different genotypes of porcine rotaviruses will be significantly different. For the G9P

[23] genotype porcine rotavirus strain, the present application finds a specific reverse genetics system for rescuing the virus. Based on this, the present application is completed.

[0008] In a first aspect, the present application provides a porcine rotavirus recombinant strain, which is obtained by the following method, specifically comprising the following steps:

[0009] First step, construction of reverse transcription vector: a reverse transcription vector pOK-T7 is obtained by inserting a T7 promoter, an HdRZ ribozyme encoding gene and a T7 terminator on a pOK12 vector through a homologous recombination method;

[0010] Second step, constructing porcine rotavirus strain infectious recombinant plasmid: recombining 11 gene fragments of rotavirus to the pOK-T7 vector obtained in the first step, the gene fragments are VP1 , VP2 , VP3 , VP4 , VP6 , VP7 , NSP1, NSP2 , NSP3 , NSP4 and NSP5 , and 10 porcine rotavirus strain infectious recombinant plasmids are constructed, including pOK-T7-VP1, pOK-T7-VP2, pOK-T7-VP3, pOK-T7-VP4, pOK-T7-VP6, pOK-T7-VP7, pOK-T7-NSP1, pOK-T7-NSP3, pOK-T7-NSP4 and pOK-T7-NSP2 / 5;

[0011] Third step, co-transfecting the porcine rotavirus strain infectious recombinant plasmid constructed in the second step and the helper plasmid into host cells to express, and obtaining porcine rotavirus recombinant virus.

[0012] Further, the porcine rotavirus is G9P

[23] genotype rotavirus.

[0013] Further, the G9P

[23] genotype porcine rotavirus is NMTL strain.

[0014] Further, the host cell is BHK cell.

[0015] Further, the pOK-T7-NSP2 / 5 recombinant plasmid is to connect NSP2 and NSP5 gene fragments through Linker.

[0016] Further, the Linker is selected from flexible connecting peptide, rigid connecting peptide and in-vivo cleavable connecting peptide.

[0017] Preferably, the Linker is in-vivo cleavable connecting peptide.

[0018] More preferably, the Linker is P2A.

[0019] Further, the recombinant plasmid obtained in the second step is infectious recombinant plasmid carrying porcine rotavirus gene fragments or infectious recombinant plasmid carrying porcine rotavirus gene fragments and reporter gene.

[0020] Further, the helper plasmid is selected from one of C3P3-G1, pCMV-868CP, pCAG-D12L or pCAG-D1R.

[0021] Preferably, the helper plasmid is C3P3-G1.

[0022] In a second aspect, the present application provides a vaccine composition comprising the porcine rotavirus recombinant strain obtained in the first aspect.

[0023] Further, the vaccine composition comprises an adjuvant.

[0024] Further, the adjuvant is selected from one or more of an oil-in-water adjuvant, a polymer and water adjuvant, a water-in-oil adjuvant, an aluminum hydroxide adjuvant and / or a vitamin E adjuvant.

[0025] Further, the vaccine composition further comprises at least one additional antigen.

[0026] In a third aspect, the present application provides use of the porcine rotavirus recombinant strain of the first aspect in the preparation of a vaccine for preventing diseases caused by porcine rotavirus infection.

[0027] Further, the porcine rotavirus is a G9P

[23] genotype rotavirus.

[0028] Further, the G9P

[23] genotype porcine rotavirus is NMTL strain. Advantages

[0029] The present application finds that the rescue work for rotaviruses of different genotypes will be significantly different using different reverse genetic manipulation systems. For the G9P

[23] genotype porcine rotavirus strain of the present application, 11 gene fragments of porcine rotavirus are recombined into a pOK-T7 vector to obtain 10 porcine rotavirus infectious recombinant plasmids, wherein the genes encoding viral NSP2 and NSP5 are placed into one plasmid to obtain a pOK-T7-NSP2 / 5 plasmid, and finally a reverse genetic system based on 10 porcine rotavirus infectious recombinant plasmids is formed. Application of the system successfully rescues the G9P

[23] genotype porcine rotavirus NMTL strain to obtain a rNMTL porcine rotavirus recombinant strain. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 is a pOK-T7 vector map.

[0031] Figure 2The plasmid electrophoresis map for expressing 11 gene fragments of the virus is shown in the figure, wherein lanes 1-11 are pOK-T7-VP1, pOK-T7-VP2, pOK-T7-VP3, pOK-T7-VP4, pOK-T7-VP6, pOK-T7-VP7, pOK-T7-NSP1, pOK-T7-NSP2, pOK-T7-NSP3, pOK-T7-NSP4 and pOK-T7-mNSP5 respectively.

[0032] Figure 3 The plasmid construction electrophoresis map of pOK-T7-NSP2 / 5 is shown in the figure, wherein lane 1 is the gene amplification electrophoresis map of mNSP5, lane 2 is the plasmid amplification electrophoresis map of pOK-T7-NSP2, and lane 3 is the bacterial liquid PCR detection electrophoresis map of pOK-T7-NSP2 / 5.

[0033] Figure 4 The construction idea map of pOK-NSP2 / 5 vector is shown in the figure.

[0034] Figure 5 The rescue results of rNMTL recombinant virus are shown in the figure, wherein A: the recombinant virus NSP5 After gene sequencing, alignment is performed with wild virus by MegAlign; B: the supernatant of cells collected after transfection of 11-plasmid system and 10-plasmid system is inoculated into MA104 cells, and cell pathological changes are observed after 24 h.

[0035] Figure 6 The detection electrophoresis map of recombinant virus VP7 、 VP4 、 NSP5 is shown in the figure, wherein lane 1: VP7 is the gene amplification electrophoresis map, lane 2: VP4 is the gene amplification electrophoresis map, and lane 3: NSP5 is the gene amplification electrophoresis map.

[0036] Figure 7 The CPE and growth curve of rNMTL recombinant virus are shown in the figure, wherein A: the rescued recombinant virus and wild virus are inoculated into MA104 cells, and cell pathological changes are observed after 24 h; B: the rescued recombinant virus and wild virus are inoculated into MA104 cells at MOI=0.1, the supernatant of cells collected at different times after infection is determined for virus titer, and the virus growth curve is drawn.

[0037] Figure 8 The construction idea map of pOK-T7-NSP3-GFP vector is shown in the figure.

[0038] Figure 9The fluorescence expression and growth curve of the rNMTL-GFP recombinant virus, wherein A: the rNMTL-GFP recombinant virus was inoculated into MA104 cells at MOI=0.1 and MOI=1, respectively, and observed and photographed under a fluorescence microscope at 6 h and 24 h, respectively; B: comparison of the growth curves of the recombinant viruses rNMTL and rNMTL-GFP in MA104 cells. DETAILED DESCRIPTION

[0039] The specific embodiments of the present application are described below. It should be noted that the description of these embodiments is used to help understand the present application, but does not constitute a limitation on the present application. In addition, the technical features involved in the following described embodiments can be combined with each other as long as they do not conflict with each other.

[0040] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all commercially available unless otherwise specified.

[0041] The NMTL strain A pig / China / NMTL / 2008 / G9P

[23] (NMTL) in the present application was isolated from the feces of a diarrhea piglet in 2011 by the laboratory (Molecular characterization of a rare G9P

[23] porcine rotavirus isolate from China [J]. Arch Virol. 2012; 157(10): 1897-1903.). The 11 gene fragments of the NMTL strain are as follows: VP1 (GenBank: JF781164.1), VP2 (GenBank: JF781165.1), VP3 (GenBank: JF781166.1), VP4 (GenBank: JF781167.1), VP6 (GenBank: JF781168.1), VP7 (GenBank: JF781158.1), NSP1 (GenBank: JF781159.1), NSP2 (GenBank: JF781160.1), NSP3 (GenBank: JF781161.1), NSP4 (GenBank: JF781162.1), NSP5 (GenBank: JF781163.1).

[0042] The infectious recombinant plasmids of porcine rotavirus constructed in the present application include: pOK-T7-VP1 (nucleotide sequence: SEQ ID NO. 1), pOK-T7-VP2 (nucleotide sequence: SEQ ID NO. 2), pOK-T7-VP3 (nucleotide sequence: SEQ ID NO. 3), pOK-T7-VP4 (nucleotide sequence: SEQ ID NO. 4), pOK-T7-VP6 (nucleotide sequence: SEQ ID NO. 5), pOK-T7-VP7 (nucleotide sequence: SEQ ID NO. 6), pOK-T7-NSP1 (nucleotide sequence: SEQ ID NO. 7), pOK-T7-NSP2 (nucleotide sequence: SEQ ID NO. 8), pOK-T7-NSP3 (nucleotide sequence: SEQ ID NO. 9), pOK-T7-NSP4 (nucleotide sequence: SEQ ID NO. 10), pOK-T7-mNSP5 (nucleotide sequence: SEQ ID NO. 11), and pOK-T7-NSP2 / 5 (nucleotide sequence: SEQ ID NO. 12).

[0043] The pOK12 vector is purchased from Addgene Company, and the nucleotide sequence is SEQ ID NO. 13, and the nucleotide sequence of the pOK-T7 modified vector is SEQ ID NO. 14.

[0044] Example 1 Construction and identification of recombinant plasmids of 11 gene fragments of NMTL strain

[0045] 1.1 Construction of pOK-T7 reverse genetic vector.

[0046] The T7 promoter sequence, HdRZ ribozyme sequence and T7 terminator sequence are inserted in sequence at the Xho I enzyme cutting site of the pOK12 vector by homologous recombination method, and the modified vector is named as pOK-T7 vector (see Figure 1 ).

[0047] 1.2 Construction of infectious recombinant plasmid of NMTL strain.

[0048] The porcine rotavirus NMTL strain RNA was extracted using TRIzol kit, and 11 gene fragments were amplified by RT-PCR. The primers used are shown in Table 1. The PCR products were recovered by gel electrophoresis, and after recovery, they were respectively cloned into pMD-18-T vector and connected overnight. The ligation products were transformed into DH5α competent cells, spread on LB solid medium containing ampicillin, and the next day single colonies were picked and subjected to colony PCR verification. The strains verified as positive were sent to Riboexingke (Northeast) for sequencing. The bacterial liquid with correct sequencing was cultured to extract plasmids, obtaining pMD-18-T-NSP1, pMD-18-T-NSP2, pMD-18-T-NSP3, pMD-18-T-NSP4, pMD-18-T-NSP5, pMD-18-T-VP1, pMD-18-T-VP2, pMD-18-T-VP3, pMD-18-T-VP4, pMD-18-T-VP6, and pMD-18-T-VP7.

[0049] Table 1 Primer sequences for amplifying gene fragments

[0050] Sequence name Upstream primer sequence (5'-3') Nucleotide sequence number Sequence name Downstream primer sequence (5'-3') Nucleotide sequence number NSP1-1F ggcttttttatgaaaagtct SEQ ID NO. 15 NSP1-1R ggtcacattttatgctgccta SEQ ID NO. 26 NSP2-1F ggcttttaaagcgtctcagt SEQ ID NO. 16 NSP2-1R ggtcacataagcgctttctat SEQ ID NO. 27 NSP3-1F ggcttttaatgcttttcagt SEQ ID NO. 17 NSP3-1R ggtcacataacgcccctata SEQ ID NO. 28 NSP4-1F ggcttttaaaagttctgttc SEQ ID NO. 18 NSP4-1R ggtcacactaagaccattcc SEQ ID NO. 29 NSP5-1F ggctttaaaagcgctacagt SEQ ID NO. 19 NSP5-1R ggtcacaaaacgggagtgggg SEQ ID NO. 30 VP1-1F ggctattaaagctgtacaat SEQ ID NO. 20 VP1-1R ggtcacatctaagcactctaa SEQ ID NO. 31 VP2-1F ggctattaaaggctcaatgg SEQ ID NO. 21 VP2-1R ggtcatatctccacagtgggg SEQ ID NO. 32 VP3-1F ggcttttaaagcagtactag SEQ ID NO. 22 VP3-1R ggtcacatcgtgactagtgt SEQ ID NO. 33 VP4-1F ggctataaaatggcttctct SEQ ID NO. 23 VP4-1R ggtcacatcctttaacagcta SEQ ID NO. 34 VP6-1F ggctttaaaacgaagtcttc SEQ ID NO. 24 VP6-1R ggtcacatcctctcactata SEQ ID NO. 35 VP7-1F ggctttaaaagagagaattt SEQ ID NO. 25 VP7-1R ggtcacatcgaccaattcta SEQ ID NO. 36

[0051] 15 bp homologous arm sequences were added to the original primers, respectively, wherein the upstream homologous arm sequence was: ATACGACTCACTATA, nucleotide sequence number SEQ ID NO. 59; and the downstream homologous arm sequence was: ATGCCATGCCGACCC, nucleotide sequence number SEQ ID NO. 60. The primers used are shown in Table 2. The pOK-T7 vector amplification primers were: GGGTCGGCATGGCATCTCCAC, nucleotide sequence number SEQ ID NO. 61; and TATAGTGAGTCGTATTA, nucleotide sequence number SEQ ID NO. 62. The vector and 11 fragments were amplified, the nucleic acid concentrations of the linearized plasmid and the fragments were determined, the target fragments were recombined into the pOK-T7 vector according to the ClonExpress homologous recombination procedure, the product was transformed into DH5α competent cells, spread on LB solid medium containing kanamycin, and the next day single colonies were picked. After sequencing, the recombinant plasmid was large-scale extracted, and the obtained recombinant plasmids were named as pOK-T7-VP1, pOK-T7-VP2, pOK-T7-VP3, pOK-T7-VP4, pOK-T7-VP6, pOK-T7-VP7, pOK-T7-NSP1, pOK-T7-NSP2, pOK-T7-NSP3, pOK-T7-NSP4, and pOK-T7-NSP5 (see Table 2). Figure 2 )

[0052] To identify the differences between the recombinant virus and the wild virus, the VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP3, NSP4, and NSP5 genes of the recombinant virus were amplified by PCR, and the PCR products were sequenced. NSP5A GC mutation was introduced at position 306 of the gene (upstream primer: ggattcatcgacCcaatcacga, nucleotide sequence number SEQID NO.63; downstream primer: agcactaacCcagctacttagg, nucleotide sequence number SEQID NO.64) to obtain plasmid pOK-T7-mNSP5.

[0053] 1.3 Construction of pOK-T7-NSP2 / 5 plasmid

[0054] The obtained pOK-T7-mNSP5 was used as a template and PCR amplification was performed. T7-mNSP5-HdRz-Ter 15 bp homology arm sequences were added to both ends of the gene fragment (upstream primer: ATCTATCGATGCATGgatccggatatagttcctcc, nucleotide sequence number SEQID NO.65; downstream primer TCCCGGGTACCATGGtaatacgactcactataggc, nucleotide sequence number SEQID NO.66), (see Figure 3 Lane 1), design ideas such as Figure 4 As shown. The obtained pOK-T7-NSP2 was used as a template, and the upstream primer ccatggtacccgggagctcga, nucleotide sequence number SEQID NO.67 and the downstream primer catgcatcgatagatgatccg, nucleotide sequence number SEQID NO.68 were used to linearize pOK-T7-NSP2 by PCR (see Figure 3 Lane 2). Assay T7-mNSP5- HdRz-Ter The nucleic acid concentration of gene fragment and linearized plasmid was adjusted according to the ClonExpress homologous recombination procedure. T7-mNSP5-HdRz-Ter The product was recombined into the pOK-T7-NSP2 vector, transformed into DH5α competent cells, and plated on LB solid medium containing kanamycin. The next day, a single colony was picked and verified by colony PCR (upstream primer: TACTATGTGGAAATTGACATA, nucleotide sequence number SEQID NO.69; downstream primer: ATTATGCTGAGTGATATCCGA, nucleotide sequence number SEQID NO.70) to obtain a positive clone strain (see Figure 3 Lane 3) After sequencing was correct, the recombinant plasmid was extracted and the constructed plasmid was named pOK-T7-NSP2 / 5.

[0055] Table 2 Primer sequences for gene fragment amplification

[0056] Sequence name Upstream primer sequence (5'-3') Nucleotide sequence number NSP1-2F ATACGACTCACTATAggcttttttatgaaaagtct SEQ ID NO. 37 NSP2-2F ATACGACTCACTATAggcttttaaagcgtctcagt SEQ ID NO. 38 NSP3-2F ATACGACTCACTATAggcttttaatgcttttcagt SEQ ID NO. 39 NSP4-2F ATACGACTCACTATAggcttttaaaagttctgttc SEQ ID NO. 40 NSP5-2F ATACGACTCACTATAggctttaaaagcgctacagt SEQ ID NO. 41 VP1-2F ATACGACTCACTATAggctattaaagctgtacaat SEQ ID NO. 42 VP2-2F ATACGACTCACTATAggctattaaaggctcaatgg SEQ ID NO. 43 VP3-2F ATACGACTCACTATAggcttttaaagcagtactag SEQ ID NO. 44 VP4-2F ATACGACTCACTATAggctataaaatggcttctct SEQ ID NO. 45 VP6-2F ATACGACTCACTATAggctttaaaacgaagtcttc SEQ ID NO. 46 VP7-2F ATACGACTCACTATAggctttaaaagagagaattt SEQ ID NO. 47 NSP1-2R ATGCCATGCCGACCCggtcacattttatgctgccta SEQ ID NO. 48 NSP2-2R ATGCCATGCCGACCCggtcacataagcgctttctat SEQ ID NO. 49 NSP3-2R ATGCCATGCCGACCCggtcacataacgcccctata SEQ ID NO. 50 NSP4-2R ATGCCATGCCGACCCggtcacactaagaccattcc SEQ ID NO. 51 NSP5-2R ATGCCATGCCGACCCggtcacaaaacgggagtgggg SEQ ID NO. 52 VP1-2R ATGCCATGCCGACCCggtcacattttatgctgccta SEQ ID NO. 48 NSP2-2R ATGCCATGCCGACCCggtcacataagcgctttctat SEQ ID NO. 49 NSP3-2R ATGCCATGCCGACCCggtcacataacgcccctata SEQ ID NO. 50 NSP4-2R ATGCCATGCCGACCCggtcacactaagaccattcc SEQ ID NO. 51 NSP5-2R ATGCCATGCCGACCCggtcacaaaacgggagtgggg SEQ ID NO. 52 VP1-2R ATGCCATGCCGACCCggtcacattttatgctgccta SEQ ID NO. 48 NSP2-2R ATGCCATGCCGACCCggtcacataagcgctttctat SEQ ID NO. 49 NSP3-2R ATGCCATGCCGACCCggtcacataacgcccctata SEQ ID NO. 50 NSP4-2R ATGCCATGCCGACCCggtcacactaagaccattcc SEQ ID NO. 51 NSP5-2R ATGCCATGCCGACCCggtcacaaaacgggagtgggg SEQ ID NO. 52 VP1-2R ATGCCATGCCGACCCggtcacatctaagcactctaa SEQ ID NO. 53 VP2-2R ATGCCATGCCGACCCggtcatatctccacagtgggg SEQ ID NO. 54 VP3-2R ATGCCATGCCGACCCggtcacatcgtgactagtgt SEQ ID NO. 55 VP4-2R ATGCCATGCCGACCCggtcacatcctttaacagcta SEQ ID NO. 56 VP6-2R ATGCCATGCCGACCCggtcacatcctctcactata SEQ ID NO. 57 VP7-2R ATGCCATGCCGACCCggtcacatcgaccaattcta SEQ ID NO. 58

[0057] Note: The capital sequence in the primer is homologous arm sequence, and the lower sequence is viral gene sequence.

[0058] Example 2 Construction and application of reverse genetic system of porcine rotavirus NMTL strain

[0059] The infectious recombinant plasmid encoding the viral genome fragment constructed in Example 1 and the helper plasmid C3P3-G1 were co-transfected into BHK-T7 cells stably expressing T7 RNA polymerase for initial rescue of the virus, and 48 h after transfection, susceptible cells MA104 were added to the system for co-culture to proliferate the recombinant virus.

[0060] The specific steps are as follows:

[0061] 10 Plasmid rescue system: take 125 μL DMEM into a centrifuge tube, and sequentially add the following plasmids: 0.4 μg pOK-T7-VP1, 0.4 μg pOK-T7-VP2, 0.4 μg pOK-T7-VP3, 0.4 μg pOK-T7-VP4, 0.4 μg pOK-T7-VP6, 0.4 μg pOK-T7-VP7, 0.4 μg pOK-T7-NSP, 0.4 μg pOK-T7-NSP3, 0.4 μg pOK-T7-NSP4, 2 μg pOK-T7-NSP2 / 5, and 0.4 μg of the helper plasmid C3P3-G1, mix after adding 12 μL transfection reagent, stand at room temperature, and add to the bottom of the well at a dose of 6.0 μg / well.

[0062] 11 Plasmid rescue system: take 125 μL DMEM into a centrifuge tube, and sequentially add the following plasmids: 0.4 μg pOK-T7-VP1, 0.4 μg pOK-T7-VP2, 0.4 μg pOK-T7-VP3, 0.4 μg pOK-T7-VP4, 0.4 μg pOK-T7-VP6, 0.4 μg pOK-T7-VP7, 0.4 μg pOK-T7-NSP, 0.4 μg pOK-T7-NSP3, 0.4 μg pOK-T7-NSP4, 2 μg pOK-T7-NSP2, 2 μg pOK-T7-NSP5, and 0.4 μg of the helper plasmid C3P3-G1, mix after adding 12 μL transfection reagent, stand at room temperature, and add to the bottom of the well at a dose of 8.0 μg / well.

[0063] Take BHK-T7 cells, digest with trypsin in an incubator, and add about 5×10 5The BHK-T7 cells were mixed well and placed in a CO2 incubator. After 4-6 hours of transfection, the supernatant was replaced with 8% serum-containing medium, and the cells were washed with DMEM after 24 hours, and 1 mL of DMEM was added. After 48 hours of transfection, the MA104 cells were digested, and the cells were washed with DMEM after digestion, centrifuged, and plated on BHK-T7 cells, and observed for 3-4 days.

[0064] The transfection plate was repeatedly frozen and thawed, and all supernatants were collected and treated with trypsin, and then inoculated into MA104 cells for virus passage.

[0065] Recombinant virus rNMTL identification was performed. The results are shown in Figure 5 B, using 11 plasmid system transfection cells harvested cell supernatant in MA104 cells were observed after three generations of cell pathology; while using 10 plasmid rotavirus reverse genetic system, the harvested cell supernatant inoculated into MA104 cells P1 generation can be observed obvious cytopathic effect. Further by extracting the supernatant RNA of cytopathic hole, VP7, VP4 and mNSP5 gene were amplified by RT-PCR, the results are shown in Figure 6 . Sequencing proved to be NMTL strain VP7 and VP4 gene; at the same time in the mNSP5 gene 306 site detected mutation G-C, proved the success of the rescue of the recombinant strain (see Figure 5 A).

[0066] The parent virus and recombinant strain were inoculated into MA104 cells, respectively, and the cells showed obvious cytopathic effect, which was manifested as cell rounding, increased shedding of cells in the culture supernatant, and a reticular distribution of cells at the bottom of the culture plate with time, as shown in Figure 7 A. The results of the virus growth curve are shown in Figure 7 B, the growth curve of rNMTL is consistent with that of the parent strain.

[0067] Example 3 Rescue and identification of rNMTL-GFP recombinant virus

[0068] The recombinant virus carrying the reporter gene GFP is beneficial to the study of viral infection characteristics. To rescue the recombinant virus expressing GFP, the P2A-GFP was cloned into the 3' end of the NSP3 CDS region to form a fusion protein expression mode with NSP3, and the pOK-T7-NSP3-GFP expression vector was constructed, as shown in Figure 8 .

[0069] Ten infectious recombinant plasmids encoding viral genome fragments and one helper plasmid C3P3-G1 were co-transfected into BHK-T7 cells stably expressing T7 RNA polymerase for initial virus rescue. 48 hours after transfection, susceptible MA104 cells were added to the system for co-culture to propagate the virus. Take 125 μL of DMEM to a centrifuge tube and add the following plasmids in sequence: 0.4 μg pOK-T7-VP1, 0.4 μg pOK-T7-VP2, 0.4 μg pOK-T7-VP3, 0.4 μg pOK-T7-VP4, 0.4 μg pOK-T7-VP6, 0.4 μg pOK-T7-VP7, 0.4 μg pOK-T7- NSP, 0.4 μg pOK-T7-NSP3-GFP, 0.4 μg pOK-T7- NSP4, 2 μg pOK-T7-NSP2 / 5 and 0.4 μg of the auxiliary plasmid C3P3-G1, then add 12 μL of transfection reagent and let it stand at room temperature. Then add 6.0 μg / well to the bottom of the well plate.

[0070] Stably passaged BHK-T7 cells were digested with trypsin in an incubator and about 5×10 5 BHK-T7 cells were cultured in a CO2 incubator. 4-6 h after transfection, the supernatant was replaced with serum medium and the cells were washed with DMEM. 48 h after transfection, MA104 cells were digested and washed with DMEM, centrifuged, and 2 × 10 6 Each well was plated with BHK-T7 cells and observed for 3-4 days.

[0071] The transfection plate was repeatedly frozen and thawed, and the entire supernatant was collected and treated with trypsin before being inoculated into MA104 cells for viral passage. Next, MA104 cells were infected with the parental strain and recombinant virus at an MOI of 0.1. At different times after infection, the cell supernatant was collected and the growth curve was determined.

[0072] The results are as follows Figure 9 As shown, the virus was passaged three times in a row, and green fluorescence was always present ( Figure 9 A), proving that the recombinant strain was successfully rescued. Then, the parent strain and the recombinant virus were infected with MA104 cells at an MOI of 0.1. At different times after infection, the cell supernatant was collected and its growth curve was determined ( Figure 9 B); The results showed that the growth of the recombinant virus rNMTL-GFP was weakened compared with rNMTL, but the virus still maintained at 4×10 7 TCID50 / ml.

Claims

1. A recombinant porcine rotavirus strain, wherein the recombinant porcine rotavirus strain is obtained by the following method, which specifically comprises the following steps: The first step is the construction of the reverse transcription vector: T7 promoter, HdRZ ribozyme encoding gene and T7 terminator are inserted into the pOK12 vector by homologous recombination to obtain the reverse transcription vector pOK-T7; The second step is to construct the infectious recombinant plasmid of porcine rotavirus strain: 11 gene fragments of porcine rotavirus A pig / China / NMTL / 2008 / G9P[23] strain are recombined into the pOK-T7 vector obtained in the first step. VP1 、 VP2 、 VP3 、 VP4 、 VP6 、 VP7 、 NSP1, NSP2 、 NSP3 、 NSP4 and NSP5 , 10 infectious recombinant plasmids of porcine rotavirus strains were constructed, including pOK-T7-VP1, pOK-T7-VP2, pOK-T7-VP3, pOK-T7-VP4, pOK-T7-VP6, pOK-T7-VP7, pOK-T7-NSP1, pOK-T7-NSP3, pOK-T7-NSP4 and pOK-T7-NSP2 / 5, wherein the NSP2 and NSP5 genes in the pOK-T7-NSP2 / 5 recombinant plasmid were connected by a linker; In the third step, the infectious recombinant plasmid of the porcine rotavirus strain constructed in the second step and the helper plasmid are co-transfected into the host cells for expression to obtain the porcine rotavirus recombinant virus.

2. The porcine rotavirus recombinant strain according to claim 1, wherein the host cell is a BHK cell.

3. The porcine rotavirus recombinant strain according to claim 1, wherein the linker is selected from a flexible linker peptide, a rigid linker peptide and an in vivo cleavable linker peptide.

4. The porcine rotavirus recombinant strain according to claim 1, wherein the recombinant plasmid is an infectious recombinant plasmid carrying a porcine rotavirus gene fragment or an infectious recombinant plasmid carrying a porcine rotavirus gene fragment and a reporter gene.

5. The porcine rotavirus recombinant strain according to claim 1, wherein the helper plasmid is selected from one of C3P3-G1, pCMV-868CP, pCAG-D12L or pCAG-D1R.

6. A vaccine composition comprising the porcine rotavirus recombinant according to claim 1.

7. The vaccine composition according to claim 6, comprising an adjuvant, wherein the adjuvant is selected from one or more of an oil-in-water adjuvant, a water-in-oil adjuvant, an aluminum hydroxide adjuvant or a vitamin E adjuvant.

8. The vaccine composition of claim 6, further comprising at least one additional antigen.

Citation Information

Patent Citations

  • Stable expression T7 polymerase cell line, rotavirus reverse genetic system and construction method and application thereof

    CN116694578A

  • G9P [23] genotype porcine rotavirus strain and application thereof

    CN118667772A