A nucleic acid aptamer for detecting the transgenic component CP4-EPSPS protein in genetically modified soybeans

By designing a nucleic acid aptamer for the detection of CP4-EPSPS protein in genetically modified soybeans, and combining magnetic bead enrichment and fluorescent dye labeling, the problems of insufficient sensitivity and stability of existing detection methods were solved, achieving detection results with high sensitivity and good repeatability.

CN120464629BActive Publication Date: 2025-10-28QINGDAO AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510977497.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-16
Publication Date
2025-10-28
Estimated Expiration
2045-07-16

AI Technical Summary

Technical Problem

Existing methods for detecting genetically modified soybeans are inadequate in terms of sensitivity, stability, and repeatability. They are particularly difficult to meet food safety regulatory requirements when detecting low-concentration samples, and there is a lack of nucleic acid aptamer design for CP4-EPSPS protein.

Method used

Nucleic acid aptamers for the detection of CP4-EPSPS protein in genetically modified soybeans were designed and optimized. Nucleic acid aptamers were enriched and separated by magnetic bead coupling, and formed into complexes by combining with fluorescent dye-labeled nucleic acid aptamers. The fluorescence signal intensity was detected and analyzed to achieve quantitative detection.

Benefits of technology

It achieves highly sensitive detection of CP4-EPSPS protein, with a detection limit of 2 ng/kg, stable recovery rate, good intra- and inter-batch repeatability, applicability to various sample types, and strong anti-interference ability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464629B_ABST
    Figure CN120464629B_ABST
Patent Text Reader

Abstract

This invention proposes a nucleic acid aptamer for detecting the transgenic component CP4-EPSPS protein in genetically modified soybeans. The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID No. 1 or 2. The two aptamers of this invention exhibit strong specificity for CP4 EPSPS protein, with a detection limit of 2 ng / kg, a recovery rate between 88.34% and 112.12%, a precision of 5.18%, and good reproducibility.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of CP4-EPSPS protein detection technology, and more particularly to a nucleic acid aptamer for detecting CP4-EPSPS protein, a transgenic component in genetically modified soybeans. Background Technology

[0002] With the continuous development of biotechnology, the research and development speed and planting area of ​​genetically modified (GM) crops worldwide have been steadily increasing. my country's imports of GM soybeans have been increasing year by year. The improvement of traits in imported GM soybeans mainly focuses on insect resistance, herbicide resistance, and quality, with herbicide-resistant GM soybeans being the most prevalent and playing a crucial role in agricultural production. CP4 EPSPS protein (5-enolpyruvate-3-phosphate synthase) is a common herbicide-resistant protein derived from Agrobacterium, frequently used in the development of herbicide-resistant GM crops. It is widely present in various GM soybean varieties and is one of the important targets for detecting GM components.

[0003] Currently, the main methods for detecting genetically modified (GM) components include DNA-based PCR amplification and protein-based ELISA immunoassay. PCR offers high sensitivity and specificity, making it suitable for qualitative or quantitative detection of GM components. ELISA, on the other hand, identifies GM components by detecting specific protein expression; it is simple to operate and relatively inexpensive, but its sensitivity and stability are significantly affected by antibody quality, and it is susceptible to interference in complex food matrices, resulting in limitations in reproducibility and accuracy.

[0004] Nucleic acid aptamers are single-stranded nucleotides that bind to specific target molecules through their folding and coiling. The diversity of their sequences and spatial structures allows them to form complex tertiary structures upon encountering different targets, due to electrostatic interactions, hydrogen bonding, or complementary base pairing. This enables them to recognize and specifically bind to a variety of target molecules, exhibiting advantages such as high affinity, high specificity, good chemical stability, and strong modifiability. They show broad application prospects in food safety testing, environmental monitoring, and clinical diagnostics. The target recognition mechanism of nucleic acid aptamers is similar to that of antibodies, and they are referred to as "chemical antibodies." Compared to traditional antibodies, nucleic acid aptamers can be obtained through in vitro screening using SELEX technology, avoiding animal immunization processes, and are easily mass-produced and modified, making them suitable for constructing novel, highly sensitive detection platforms.

[0005] However, there are currently no reports on nucleic acid aptamers specifically designed for CP4 EPSPS protein and their practical application in genetically modified soybeans. Furthermore, existing detection methods still have shortcomings in terms of sensitivity, selectivity, and stability, especially in detecting low-concentration samples, making it difficult to meet increasingly stringent food safety regulatory requirements. Summary of the Invention

[0006] To overcome the problems of low detection sensitivity, poor stability, and poor repeatability in the existing technologies, this invention proposes a nucleic acid aptamer for detecting the transgenic component CP4-EPSPS protein in transgenic soybeans.

[0007] The technical solution of the present invention is implemented as follows: In a first aspect, the present invention provides a nucleic acid aptamer for detecting the transgenic component CP4-EPSPS protein in transgenic soybeans, wherein the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID No. 1 and 2.

[0008] Secondly, this invention also provides the application of nucleic acid aptamers in the detection of the transgenic component CP4-EPSPS protein in transgenic soybeans.

[0009] Based on the above technical solutions, the preferred method for detecting CP4-EPSPS protein includes the following steps:

[0010] S1, using the magnetic bead-coupled nucleic acid aptamer 1 to enrich and separate CP4 EPSPS protein in the sample;

[0011] S2 binds the nucleic acid aptamer2 labeled with a fluorescent dye to the enriched CP4 EPSPS protein, forming the MBs-Capture Aptamer 1-CP4 EPSPS protein-Aptamer 2 complex.

[0012] S3, detect and analyze the intensity of the recovered fluorescence signal to quantify CP4 EPSPS protein;

[0013] Based on the above technical solutions, preferably, Aptamer 1 and Aptamer 2 are nucleic acid aptamers, and their nucleotide sequences are shown in SEQ ID No. 1 and 2.

[0014] Thirdly, the present invention also provides a kit for detecting CP4-EPSPS protein in genetically modified soybeans, comprising the aforementioned nucleic acid aptamers.

[0015] Based on the above technical solutions, preferred alternatives also include magnetic beads and fluorescent dyes.

[0016] The nucleic acid aptamer of the present invention for detecting the transgenic component CP4-EPSPS protein in transgenic soybeans has the following advantages over the prior art:

[0017] This invention, through reasonable design and optimization of screening conditions, obtains nucleic acid aptamers that can achieve efficient identification and quantitative detection of CP4EPSPS protein, with the following advantages: (1) High sensitivity: The detection limit reaches 2 ng / kg, which is significantly better than the traditional ELISA method. (2) Good recovery rate: The recovery rate is stable at 88.34%-112.12% in complex food matrices, which meets international standards. (3) Excellent precision: The relative standard deviation (RSD) is less than 5.18%, with good intra-batch and inter-batch repeatability. (4) Good reproducibility: It is suitable for various sample types and has strong anti-interference ability.

[0018] Therefore, the nucleic acid aptamer of the present invention fills the current technological gap in the molecular recognition of CP4 EPSPS protein, and provides new technical means and theoretical support for the safety supervision and rapid detection of genetically modified soybeans. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a diagram showing the partial sequence alignment results of the EPSPS gene.

[0021] Figure 2 Image showing enzyme digestion identification;

[0022] Figure 3 In Figure a, SDS-PAGE analysis of protein expression identification is shown, where M represents the molecular weight standard of the protein; 1: pET28a induction; 2: no induction; 3: after induction; 4: supernatant after induction and lysis; 5: precipitate after induction and lysis. In Figure b, SDS-PAGE analysis of protein purification is shown, where M represents the molecular weight standard of the protein; 1: sample after lysis; 2: elution; 3-4: elution. In Figure c, SDS-PAGE analysis of protein identification is shown, where M represents the molecular weight standard of the protein; 1: 0.5 mg / ml BSA; 2: purified sample.

[0023] Figure 4 To optimize PCR amplification conditions, lane a was 25 cycles, and lane b was 27 cycles; lane 1: Marker; lane 2: 61.2℃; lane 3: 58.8℃; lane 4: 55.9℃; lane 5: 53.6℃; lane 6: 52℃.

[0024] Figure 5In the diagram, a represents the PCR product purification results, lane 1: Marker; lanes 2 and 3: purified products; b represents the PCR product enzyme digestion results, lane 1: Marker; lanes 3, 4, 5, 7, 8, and 9: 10 μL enzyme digestion products; lane 10: ssDNA library.

[0025] Figure 6 The graph shows the results of nucleic acid aptamer recovery rate.

[0026] Figure 7 This is a homology analysis diagram of high-throughput sequencing results;

[0027] Figure 8 This is a fluorescence analysis diagram of nucleic acid aptamers;

[0028] Figure 9 A quantum dot diagram of CdTe / CdS / ZnS;

[0029] Figure 10 This is a diagram showing the specificity of nucleic acid aptamers for CP4 EPSPS. Detailed Implementation

[0030] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0031] I. Cloning of CP4 EPSPS

[0032] Using a PAS (PCR-based Accurate Synthesis) method, full-length splicing primers were designed, with protective base synthesis genes EPSPS designed at both ends of the primers and inserted between the NcoI (CCATGG)-XhoI (CTCGAG) sites of the vector pET-28a(+). The resulting recombinant plasmid pET-28a(+)-EPSPS was transformed into the TOP10 cloning strain.

[0033] Reagents and consumables: pET-28a(+) and TOP10 strains were provided by Zhongding Biotechnology; restriction endonuclease (TaKaRa), Pfu DNA polymerase (Zoonbio, catalog number PC12); Tyrptone, Yeast Extract (OXOID), Agarose (Shanghai Gene Co., Ltd.); DNA gel purification kit, plasmid miniprep kit (AXYGEN); PCR tubes, pipette tips and other consumables (Fisher); other reagents were domestically produced analytical grade or chemically pure.

[0034] pET-28a(+)-EPSPS sequencing verification: Using the PAS (PCR-based Accurate Synthesis) method, full-length splicing primers were designed, and the obtained recombinant plasmid pET-28a(+)-EPSPS was transformed into the TOP10 cloning strain. Positive clones were selected for sequencing, and the sequencing results are spliced ​​as shown below. The single-underlined region is the EPSPS gene region.

[0035] CCATGG GCATGGCTCAAATAAATAACATGGCACAGGGAATTCAGACCCTGAATCCAAATAGCAATTTT CATAAACCGCAGGTTCCGAAGTCTTCCAGTTTCCTGGTTTTTGGCAGCAAAAAGCTGAAGAACAGCGCGAATAGCA TGCTGGTTTTAAAGAAAGATAGCATCTTTATGCAAAAATTCTGCTCCTTCCGCATCAGCGCGAGCGTTGCTACCGC GTGTATGTTACATGGTGCGTCCAGCCGTCCGGCAACCGCAAGGAAGAGTAGCGGTTTGTCCGGCACCGTGCGCATC CCGGGCGACAAGTCGATCAGCCACCGTTCGTTCATGTTCGGTGGTTTGGCGTCGGGTGAGACGCGTATCACTGGTT TGCTGGAGGGCGAAGACGTTATCAATACGGGTAAGGCAATGCAGGCTATGGGTGCGCGTATCAGAAAAGAAGGCGA CACCTGGATTATCGACGGCGTGGGCAACGGCGGTTTATTGGCCCCGGAAGCTCCGTTGGACTTCGGAAACGCTGCG ACGGGGTGCCGTCTGACGATGGGTTTGGTCGGTGTCTATGATTTTGATTCGACCTTTATTGGTGACGCAAGCCTGA CCAAACGTCCGATGGGCCGTGTGCTTAACCCGCTGCGTGAAATGGGTGTCCAGGTTAAGAGCGAGGATGGCGACCG CCTGCCGGTGACCCTGCGTGGTCCGAAAACCCCGACTCCGATTACCTACCGCGTGCCGATGGCGTCTGCACAGGTT AAATCTGCGGTCCTGCTGGCGGGGTTGAACACGCCGGGTATTACCACCGTTATTGAGCCGATCATGACCTGCGATC ACACCGAAAAAATGCTGCAAGGTTTTGGTGCGAACCTGACCGTCGAAACCGATGCGGATGGTGTACGCACTATTCG TCTGGAGGGTCGTGGTAAACTGACCGGCCAAGTGATTGACGTGCCAGGCGACCCGTCAAGCACCGCGTTCCCGCTG GTTGCGGCTCTGCTGGTTCCGGGTTCCGATGTGACGATTCTGAACGTGCTGATGAATCCTACGAGAACAGGTTTGA TTCTGACTCTCCAAGAAATGGGTGCGGACATCGAGGTGATCAACCTGCGCCTAGCCGGCGGCGAGGACGTAGCGGA TCTGCGCGTGCGTTCCTCTACCTTGAAGGGTGTTACCGTTCCGGAGGACCGCGCACCACCGATGATCGACGAGTAC CCGATTCTGGCCGTCGCTGCGGCTTTCGCCGAAGGCGCGACGGTTATGAACGGCCTTGAGGAACTGCGTGTCAAGG AAAGCGACCGTTTAAGCGCAGTGGCCAACGGCCTGAAGTTGAATGGCGTGGACTGTGATGAGGGCGAGACGAGCCT GGTTGTTCGTGGTCGTCCGGATGGTAAAGGTCTGGGCAACGCATCTGGCGCGGCGGTGGCCACCCATCTGGACCAC CGCATCGCCATGAGCTTTCTGGTGATGGGTCTTGTGAGCGAGAACCCGGTTACCGTTGATGATGCCACCATGATCG CGACCAGCTTCCCGGAATTTATGGATCTGATGGCAGGTTTAGGTGCTAAAATTGAACTGAGCGATACCAAGGCAGC GCATCACCACCACCATCACTAA CTCGAG.

[0036] The sequencing results were compared with the expected sequence, and a portion of the compared sequence was extracted as follows: Figure 1 As shown.

[0037] Plasmid restriction enzyme digestion identification: Digestion system: plasmid 3 μL, restriction enzyme 1 0.25 μL, restriction enzyme 2 0.25 μL, 10× Buffer 1.0 μL, DDW up to 10 μL. Restriction enzyme digestion identification results are as follows: Figure 2 .

[0038] II. Expression and purification of CP4 EPSPS protein

[0039] The target protein EPSPS was expressed using IPTG induction. Expression conditions were optimized by adjusting the induction temperature to 15°C. Analysis showed that the target protein was mainly expressed in inclusion body form. The target protein EPSPS was reconstituted using renaturation and purified by Ni column affinity chromatography to obtain the final protein.

[0040] Reagents: Urea (C0710110275) was purchased from Nanjing Chemical Reagent; Acr (V900845) and Bis (V900301) were purchased from Sigma; SDS (S8010), Tris (T8060) and TEMED (T8090) were purchased from Solarbio; Protein Marker (26610) was purchased from Thermo Scientific; IPTG (I104812) was purchased from Aladdin; Tryptone (LP0042) and YeastExtract (LP0021) were purchased from OXIOD; TOP10 strains (ZDA0001), pET28a plasmid (ZDB0003), BL21 (DE3) expression strain (ZDB0003), and Ni-IDA affinity chromatography gel (ZDC0001) were purchased from Zoonbio.

[0041] 1. Experimental methods and results

[0042] 1.1 Identification of prokaryotic protein expression

[0043] The theoretical molecular weight of the protein is approximately 56.3 KD (including the tag). Amino acid sequence: MAQINNM.

[0044] 1.1.1 Transformation of pET28a-EPSPS vector into Escherichia coli BL21(DE3)

[0045] Add 1 μL of plasmid to 100 μL of competent bacteria and place on ice for 20 min. Heat shock at 42℃ for 90 sec, then immediately place on ice for 5 min, and add 600 μL of LB medium. Shake at 37℃ and 220 r / min for 1 h, centrifuge, and spread the entire mixture onto LB agar plates containing 50 μg / mL Kans, and incubate upside down at 37℃ overnight.

[0046] 1.1.2 IPTG-induced expression of pET28a-EPSPS vector fusion protein

[0047] Pick single colonies from the transformation plate and inoculate them into 3 mL LB medium containing 50 μg / mL Kan, and incubate overnight at 37°C with shaking at 220 rpm. The next day, inoculate 1:100 into 30 mL LB medium containing 50 μg / mL Kan, and incubate at 37°C with shaking at 220 rpm until the bacterial OD value is reached. 600 The concentration was 0.6-0.8. Take 1 mL of culture, centrifuge at 10000 r / min for 2 min at room temperature, discard the supernatant, and resuspend the bacterial pellet in 100 μL of 1× loading buffer. Add IPTG to the remaining culture to a final concentration of 0.2 mM, and incubate overnight at 15℃ with shaking at 220 r / min to induce fusion protein expression. Take 1 mL of culture, centrifuge at 10000 r / min for 2 min at room temperature, discard the supernatant, and resuspend the bacterial pellet in 100 μL of 1× loading buffer. Centrifuge the remaining culture at 4000 r / min for 10 min, discard the supernatant, and resuspend the bacterial pellet in PBS; after sonication of the resuspended solution, take the supernatant and pellet separately and resuspend them in loading buffer. Perform 12% SDS-PAGE analysis, and stain with Coomassie brilliant blue for banding.

[0048] 1.1.3 Analysis of Expression Identification Results

[0049] Clones were selected, and protein expression was induced using IPTG. Analysis with 12% SDS-PAGE showed that the target protein was mainly present in the precipitate. The results are as follows: Figure 3 As shown in Figure a.

[0050] 1.2 Refolding of Inclusion Body Proteins

[0051] (1) Resuspend the bacterial pellet in 20 mL of lysis buffer (20 mM Tris-HCl containing 1 mM PMSF and bacteria protease inhibitor cocktail, pH 8.0) and sonicate (400 W, 4 sec on, 8 sec off, 20 min total). (2) Centrifuge the sonicated cell lysate at 10,000 r / min for 20 min at 4 °C and collect the pellet. Wash the inclusion bodies three times with inclusion body washing buffer (20 mM Tris, 1 mM EDTA, 2 M urea, 1 M NaCl, 1% Triton X-100, pH 8.0). (3) Dissolve the inclusion bodies in a certain ratio with dissolution buffer (20 mM Tris, 5 mM DTT, 8 M urea, pH 8.0) and incubate overnight at 4 °C; centrifuge at 10,000 r / min for 15 min at room temperature. (4) Add the above solution dropwise to 20 mM Tris-HCl, 0.15 M NaCl, pH 8.0 buffer solution, gradually dilute in multiples and stir slowly, put the protein solution into a dialysis bag and dialyze overnight in 20 mM Tris-HCl, 0.15 M NaCl, pH 8.0 solution.

[0052] 1.3 Ni-column affinity purification of fusion protein and result analysis

[0053] Ni column purification: Using a low-pressure chromatography system, the supernatant was loaded into a Ni-IDA-Sepharose Cl-6B affinity chromatography column pre-equilibrated with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min. The column was washed with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min until the eluent reached an OD of 100%. 280 The value reached baseline. Wash with Ni-IDA Washing-Buffer (20 mM Tris-HCl, 20 mM imidazole, 0.15 M NaCl, pH 8.0) at a flow rate of 1 mL / min until the OD of the outflow reached baseline. 280 The values ​​reached baseline. The target protein was eluted with Ni-IDA Elution-Buffer (20 mM Tris-HCl, 250 mM imidazole, 0.15 M NaCl, pH 8.0) at a flow rate of 1 mL / min, and the eluent was collected. The collected protein solution was added to a dialysis bag and dialyzed overnight with PBS. 12% SDS-PAGE analysis was then performed.

[0054] Purification results analysis: The inclusion bodies were refolded to rehydrate the target protein, which was then purified by Ni column affinity chromatography and analyzed by 12% SDS-PAGE. The results are as follows: Figure 3 As shown in Figures b and c. The concentration of purified protein was determined to be 0.8 mg / mL using the Bradford method, and was used for subsequent experiments.

[0055] III. Screening of CP4 EPSPS protein aptamers and establishment of reaction system

[0056] 1. Graphene oxide method (GO-SELEX) screening

[0057] Graphene oxide screening (GO-SELEX) is a classic fixation-free method for screening nucleic acid aptamers. During screening, free ssDNA undergoes strong π-π interactions, stacking and adsorbing onto graphene oxide, while dsDNA, due to its phosphate backbone shielding nucleobases, is less adsorbed by GO. Based on this characteristic, free ssDNA and target-bound ssDNA can be separated by centrifugation. GO-SELEX avoids target or library fixation during screening, ensuring that the binding of the target and ssDNA is unaffected by steric hindrance and conformational changes, thus improving screening efficiency. Currently, the GO-SELEX method has been used to obtain target aptamers for pesticides, avian influenza viruses, and nicotinamide phosphoribosyltransferase, among others. The method is mature, simple to operate, and highly efficient.

[0058] 1.1 Screened random ssDNA library, primers, and aptamer sequences

[0059] Table 1 DNA Sequence

[0060]

[0061] Table 1 shows the DNA sequences used for screening: random ssDNA libraries, primers, and aptamers. The ssDNA library is 75 nt in length, with fixed sequences of 18 nt and 17 nt at each end, and a 40 nt random sequence in the middle. The aptamer sequences shown in the table are the 40 nt random sequences in the middle. The random sequence determines the diversity of random library types.

[0062] 1.2 Preparation of Reagents for the Experiment

[0063] (1) 1×TE: 10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 7.4. Accurately weigh 1.2 g Tris and 0.372 g EDTA.2Na, dissolve in 800 mL of ultrapure water, carefully adjust the pH to 7.4 with 1 M HCl, bring the volumetric flask to 1 L, and sterilize for later use.

[0064] (2) 1×BB: Accurately weigh 6.05 g Tris, 0.375 g KCl, 5.84 g NaCl, and 0.20 g MgCl2, dissolve them in 800 mL of ultrapure water, carefully adjust the pH to 7.4 with 1 M HCl, bring the volumetric flask to 1 L, and sterilize it for later use.

[0065] (3) 1 M NaCl: Accurately weigh 5.84 g NaCl and dissolve it in ultrapure water to a volume of 100 mL.

[0066] (4) Gelred staining solution: Measure 22.5 mL of ultrapure water, add 2.5 mL of NaCl, add 6 μL of Gelred nucleic acid dye with a pipette, mix thoroughly, and store in the dark for later use.

[0067] (5) Graphene oxide dispersion: Accurately weigh 0.1 g of graphene oxide powder and dissolve it in 10 mL of ultrapure water to prepare a 10 mg / mL graphene oxide dispersion.

[0068] (6) 10% (W / V, g / mL) ammonium persulfate (APs): Accurately weigh 0.1 g of ammonium persulfate, dissolve it in 1 mL of deionized water, dissolve it completely, and store it at 4°C for later use.

[0069] (7) 30% (W / V) N,N'-methylenebisacrylamide-acrylamide stock solution (Acr-Bis): Accurately weigh 290 g of acrylamide and 10 g of N,N'-methylenebisacrylamide, dissolve them in ultrapure water and bring the volume to 1 L in a volumetric flask, and store at 4°C until use.

[0070] (8) 3 M NaAc (pH 5.2): Accurately weigh 24.6 g NaAc, dissolve it in 80 mL of ultrapure water, add glacial acetic acid to adjust the pH to 5.2, and make up to 100 mL in a volumetric flask.

[0071] 1.3 Screening Process

[0072] 1.3.1 Preprocessing of random ssDNA libraries

[0073] Take 20 μL of 100 μmol / L (2 nmol) random ssDNA library, add 500 μL of 1×BB buffer, mix well, and heat in a 95°C metal bath for 10 min. After removing it, immediately place it in an ice box for 10 min. After the ice bath, place it at room temperature for 10 min to allow the ssDNA in the library to fold into a complex tertiary structure.

[0074] 1.3.2 Screening of transgenic soybean CP4 EPSPS protein aptamers using the GO-SELEX method

[0075] The nucleic acid aptamer screening method based on graphene oxide (GO-SELEX) was used to screen nucleic acid aptamers for transgenic soybean CP4EPSPS protein.

[0076] This experiment primarily employed both positive and negative screening methods. The first round of screening used positive screening. The pretreated random ssDNA library was taken, and 160 μL of CP4 EPSPS protein was added, followed by 1×BB to form a 1 mL reaction system. The mixture was incubated at 37°C for 2 h. The three-dimensional structure formed by the ssDNA could bind to the target protein to form a complex. Then, 2 mL of 10 mg / mL GO dispersion was added, and the mixture was incubated at 25°C for another 1.5 h. Free ssDNA adsorbed onto GO due to aggregation, while the mixture bound to CP4 EPSPS protein was not adsorbed by GO. After incubation, the mixture was centrifuged at 12000 r / min for 15 min, and the supernatant was collected for further processing.

[0077] In subsequent rounds of screening, the secondary libraries prepared after each round were used for further screening. The screening mode and conditions were adjusted as needed to remove sequences with weak binding affinity between the obtained ssDNA and the target protein, thus obtaining sequences with stronger binding affinity. The entire screening process lasted for 7 rounds (adjusted according to the types of proteins and the concentration of ssDNA in between). The screening conditions were optimized for each round, including the amount of library and target protein added, to achieve better screening results.

[0078] Positive screening: The random ssDNA library and target protein were incubated at 37 °C for 2 h, then 2 mL of GO (graphene oxide) (10 mg / mL) solution was added, and the mixture was incubated at 25 °C for 1.5 h to remove ssDNA that had not bound to the target protein. After incubation, the mixture was centrifuged at 12000 r / min for 15 min, the GO precipitate was discarded, and the supernatant was the incubation mixture of ssDNA and target protein.

[0079] Reverse screening: This involves using a mixture of other proteins (excluding the target protein) to screen for nucleic acid aptamers, thereby enhancing the specificity of the selected aptamers. First, a random ssDNA library is incubated with the reverse screening protein at 37°C for 2 hours. Then, GO solution is added and incubated at 25°C for 1.5 hours. The mixture is then centrifuged at 12000 r / min for 15 minutes, the supernatant is discarded, and the GO precipitate is redispersed in 1×BB buffer. The target protein is added and incubated at 37°C for 2 hours. The ssDNA on the GO is then competitively extracted, centrifuged, and the GO precipitate is discarded. The supernatant is the mixture of ssDNA and target protein obtained through reverse screening.

[0080] Table 2 GO-SELEX Filtering Criteria

[0081]

[0082] 1.4 Polymerase chain reaction (PCR) amplification of ssDNA

[0083] To obtain the secondary library from GO-SELEX screening, the mixture of ssDNA and target protein from each round of screening was used as a PCR amplification template. It was prepared into a 50 μL reaction system with primers Primer-F: 5'-TACTAACGGTACAAGC TA-3' and Primer-RP: 5'-P-GCTTCTA GGTCAACGTT-3' for ssDNA PCR amplification.

[0084] Reaction system: Primer-F (10 μM) 2 μL, Primer-RP (10 μM) 2 μL, dNTP mixture 1 μL, 10×PCR Buffer 5 μL, Mg 2+ (25mM) 3μL, DNA template 5μL, H2O 31μL, Taq Plus DNA Polymerase 1μL.

[0085] After adding the above reaction components according to the reaction volume, mix thoroughly and place in a PCR instrument for amplification. First, pre-denature at 95℃ for 30 s, then denature at 95℃ for 15 s, anneal at the optimal annealing temperature for 15 s, extend at 72℃ for 1 min, and set multiple cycles for amplification. Finally, extend at 72℃ for 5 min.

[0086] 1.4.1 Optimal annealing temperature for PCR

[0087] Annealing temperature is the temperature parameter at which primers and templates bind. It is the temperature at which 50% of the primers and complementary sequences exhibit double-stranded DNA molecules. It affects the specificity of PCR. Therefore, in order to achieve better PCR results and obtain higher quality PCR products, the optimal annealing temperature needs to be optimized before batch PCR amplification. This involves setting the same reaction system and the same number of cycles, and performing PCR amplification at different annealing temperatures.

[0088] 1.4.2 Optimization of the optimal number of PCR cycles

[0089] The number of PCR cycles also affects the amplification effect. Too many PCR cycles will result in non-specific amplification, while too few PCR cycles will result in insufficient PCR products. Therefore, in order to achieve better PCR results, it is necessary to optimize the number of PCR cycles by setting the same reaction system and the same annealing temperature, and verifying different numbers of cycles.

[0090] 1.4.3 Verification of PCR amplification products by agarose gel electrophoresis

[0091] The PCR amplified products can be detected using agarose gel electrophoresis. First, wash and dry the gel casting plate, place it in the gel casting tank, insert the sample comb, weigh 0.7 g of agarose and dissolve it in 20 mL of 1×TAE. Place the tank in a microwave oven and heat on medium-low for 1 min 40 s. Add 2 μL of dye, shake well, and after the bubbles disappear, quickly pour the mixture into the gel casting tank. Before pouring, ensure the gel casting tank is level to avoid tilting the gel. While waiting for the gel to solidify, dilute the 50×TAE buffer 50 times and pour the diluted 1×TAE buffer into the electrophoresis tank, ensuring the volume does not exceed the maximum line. After the gel solidifies, carefully remove the sample comb, place the gel plate into the electrophoresis tank, take 10 μL of PCR amplification product, add 2 μL of 10×DNA Loading Buffer, and repeatedly pipette to mix thoroughly. Carefully add 10 μL of sample to the sample well using a pipette. Simultaneously, take one control well and add 10 μL of DNA Marker, add 2 μL of 10×DNA Loading Buffer, mix thoroughly, and then add 10 μL to the well. After adding the sample, set the voltage to 200 V. Stop electrophoresis when the bands reach 2 / 3 of the gel. After electrophoresis, remove the gel, place it in an imaging system for imaging, and take pictures for recording.

[0092] 1.5 Purification

[0093] After obtaining the optimal PCR amplification annealing temperature and the optimal number of PCR cycles, batch amplification was performed. The amplified PCR products were then purified to remove primer dimers generated during amplification, excess dNTPs, excess primers, buffer solutions, and enzymes from the amplification system. Purification can be performed using a kit or a traditional purification method. To improve the PCR product recovery rate, this experiment used the traditional phenol / chloroform / isoamyl alcohol extraction and ethanol precipitation method.

[0094] The traditional purification steps are as follows: Take an appropriate amount of PCR amplification product and add an equal volume of phenol:chloroform:isoamyl alcohol (V:V:V=25:24:1) mixture. Vortex for 30 s, centrifuge at 13000 r / min for 15 min, and transfer the supernatant. When aspirating the supernatant, ensure that the centrifuge tube is not shaken and aspirate slowly to avoid aspirating the intermediate layer, as this may lead to impurities. Repeat the above steps after the first transfer. Next, add 1 / 10 volume of 3 mol / L sodium acetate (pH=5.2) and 2.5 volumes of anhydrous ethanol, and incubate overnight at -20°C. Centrifuge the overnight reaction system at 12000 r / min for 15 min, discard the supernatant, add 1 mL of pre-cooled 70% ethanol, and mix well. Centrifuge again at 12000 r / min for 15 min, discard the supernatant, air dry in a fume hood, dissolve in sterile water, and determine the double-stranded DNA concentration (dsDNA).

[0095] The purified sample was tested using agarose gel electrophoresis, and the agarose gel and operating procedures were the same as those for the PCR amplification followed by gel electrophoresis.

[0096] 1.6 Enzyme digestion

[0097] (1) Take 5 ng / μL of purified PCR product, add 35 μL of Lambda exonuclease reaction buffer, then add 1 μL of Lambda exonuclease, and mix well (adjust according to the concentration of your PCR product). (2) Place the well-mixed enzyme digestion system in a 37℃ incubator for 30 min. (3) Quickly remove the enzyme digestion system and place it on ice to prevent over-digestion. (4) Take 10 μL of the digestion product and verify whether the digestion was successful using an 8% denaturing PAGE gel containing 7 mol / L urea. (5) Place the enzyme digestion system that has been successfully digested in a 75℃ metal bath for 10 min to inactivate the Lambda exonuclease and stop the digestion reaction. (6) Add one-tenth of a volume of 3 M NaAc (pH 5.2) to the supernatant of the enzyme digestion system, invert and mix well, add 2 volumes of anhydrous ethanol, vortex until fully mixed, and place the mixture in a -20℃ refrigerator overnight. (7) Pre-cool the centrifuge and centrifuge the overnight mixed solution at 14000 r / min for 15 min at 4°C. (8) Carefully discard the supernatant and add 200 μL of 70% ethanol pre-cooled at 4°C to the precipitate and wash by inverting the tube. (9) Centrifuge at 14000 r / min for 15 min at 4°C, discard the supernatant, and place the centrifuge tube in a 50°C oven until the ethanol has completely evaporated. (10) Dissolve the precipitate in 40 μL of 1×TE buffer and perform Nanodrop concentration analysis to obtain the secondary library.

[0098] 1.6.1 Verification of ssDNA using 8% denaturing PAGE gel containing 7 mol / L urea

[0099] The success of enzyme digestion can be verified using an 8% denaturing PAGE gel containing 7 mol / L urea. The formulation of the 8% denaturing polyacrylamide gel is as follows: 2.52 g urea, 2 mL ultrapure water, 1.6 mL 30% Acr / Bis, 0.6 mL 10×TBE, 36 μL 10% APS, and 9 μL TEMED.

[0100] First, wash and dry the two glass plates (one long and one short) and the sample comb needed for preparing the 8% PAGE gel with clean water to remove surface water stains. Place the two glass plates, one long and one short, flat and aligned in the glass plate clamp, with the shorter plate in front and the longer plate behind. After clamping, place them on a gel casting rack with a sponge pad, ensuring the glass plates are upright and aligned to prevent gel leakage or tilting. After clamping, add 1 mL of water to the gel casting plate to check for leaks. Prepare the gel solution according to the 8% non-denaturing polyacrylamide gel formulation, and pour it evenly and smoothly into the leak-proof glass plate. Quickly insert the matching sample comb, avoiding air bubbles, and allow the gel to solidify. Pour an appropriate amount of 1×TBE buffer into the electrophoresis tank. Clamp the solidified gel plate onto the electrodes and place it in the electrophoresis tank. Carefully remove the sample comb, avoiding damage to the sample loading wells. Take 10 μL of PCR amplification product, add 2 μL of 10×DNA Loading Buffer, and mix thoroughly by pipetting. Then, carefully pipette 10 μL of the mixed DNA sample into each well. Simultaneously, add DNA Marker and a random ssDNA library to two other wells as controls. Set the electrophoresis parameters to 180 V. Stop electrophoresis when the bands reach 2 / 3 of their length. After electrophoresis, remove the gel from the gel plate and incubate it in prepared Gelred staining solution at room temperature for 40 min. After incubation, take a photograph using an imaging system to record the results.

[0101] 1.7 Determine the number of GO-SELEX screening rounds

[0102] After each round of screening, the nucleic acid concentration (ng / μL) of the supernatant was measured using an ultra-micro spectrophotometer and compared with the amount of nucleic acid used in the same round to obtain the recovery rate of each round of screening. The recovery rate was used as an indicator of the screening process.

[0103] 1.8 High-throughput sequencing

[0104] After determining the number of screening rounds, the library from the last round was used as a PCR template. PCR amplification was performed using Primer-F and Primer-R, and the PCR products were sent to Shanghai Sangon Biotech for high-throughput sequencing. The sequencing results were analyzed using DNAMAN software, and suitable nucleic acid aptamers were selected for subsequent experiments.

[0105] 1.9 Graphene oxide fluorescence analysis

[0106] Candidate CP4 EPSPS protein aptamers were selected and analyzed using graphene oxide fluorescence spectrometry. Fluorescent aptamers were incubated with transgenic soybean CP4 EPSPS protein and other proteins at the same concentration, including zein, pea protein (PP), and soy protein isolate (SPI) from maize, at 37°C for 2 h. After incubation, GO dispersion was added, and the mixture was incubated at 25°C for 1.5 h to completely quench the fluorescence of unbound aptamers. The mixture was then centrifuged at 12000 r / min for 15 min, the precipitate was discarded, and the emission fluorescence intensity at 520 nm under a 490 nm excitation wavelength was measured using a multi-mode microplate reader. The entire experiment was conducted in the dark.

[0107] 2. Results and Discussion

[0108] 2.1 Optimization of PCR amplification conditions

[0109] The first round of screening products was used as a demonstration for optimizing PCR cycle number conditions. Since the amount of ssDNA library added in each screening round was different, the number of PCR cycles needed to be optimized before each subsequent round of PCR amplification. Using the same PCR reaction system, the annealing temperatures were set to (52℃, 53.6℃, ​​55.9℃, 58.8℃, 61.2℃) based on the primer Tm values. Comparisons were made between 25 cycles and 27 cycles of PCR. Amplification reactions were performed in a PCR instrument, and the amplification products were verified by agarose gel electrophoresis. The gel electrophoresis results are shown below. Figure 4 As shown: when the number of cycles is 25 and the annealing temperature is 61.2℃, the bands in the other lanes are the clearest and brightest. Figure 4 (a) When the number of cycles is 27, the bands in each lane are relatively clear. Figure 4 (b) However, the brightness of the first lane is lower than that of the 25 cycles, so 61.2℃ was chosen as the annealing temperature for the first round of PCR amplification in GO-SELEX screening, and 25 cycles is the number of cycles for screening the products of the first round of PCR amplification.

[0110] Optimal number of PCR cycles per round: Round 1: 25 cycles; Round 2: 27 cycles; Round 3: 27 cycles; Round 4: 28 cycles; Round 5: 30 cycles; Round 6: 29 cycles; Round 7: 28 cycles.

[0111] 2.2 Purification of PCR products

[0112] The PCR products obtained under the above PCR conditions were purified using the traditional phenol / chloroform / isoamyl alcohol extraction and ethanol precipitation method. After purification, the purified products were verified by agarose gel electrophoresis. Gel electrophoresis was performed on two separate purification processes to verify the results of each purification step, confirming compliance with enzyme digestion conditions and the effect of purification concentration on the bands. The results are as follows: Figure 5 As shown in Figure a: the purified bands are clear and bright, and can be used for subsequent enzyme digestion experiments.

[0113] 2.3 Enzyme digestion of PCR products

[0114] When the purified PCR amplification product is obtained, the phosphate-bound PCR purified dsDNA is digested into single-stranded ssDNA using Lambda exonuclease to obtain a secondary library.

[0115] During the screening process, except for the first round of libraries which were random ssDNA libraries, subsequent secondary libraries were all single-stranded libraries prepared after PCR amplification. The main methods for obtaining single-stranded libraries include asymmetric PCR, streptavidin assay, and Lambda exonuclease assay. Asymmetric PCR typically requires primers of different ratios of F and R, necessitating a large number of cycles, thus increasing the likelihood of obtaining non-specific bands. The streptavidin magnetic bead assay requires streptavidin-coated magnetic beads and biotin, making the materials more complex. Lambda exonuclease can act on double-stranded DNA, progressively cleaving 5' mononucleotides along the 5'-3' direction. Its optimal substrate is 5'-phosphorylated double-stranded DNA. The enzyme digestion method used in this experiment was Lambda exonuclease digestion.

[0116] After enzyme digestion, the success of the digestion was verified using an 8% denaturing PAGE gel containing 7 mol / L urea. The verification results are as follows: Figure 5 As shown in Figure b: Lane 1 is the DNA Marker band, lanes 3, 4, 5, 7, 8, and 9 are the bands obtained from 10 μL of enzyme digestion product, and lane 10 is the control ssDNA library. The digested product is consistent with the ssDNA library, indicating that the digestion was successful and the product is single-stranded. The successfully digested product was purified with 3 M NaAc (pH 5.2) and anhydrous ethanol and used as the secondary library for the next round.

[0117] 2.4 Determine the number of GO-SELEX screening rounds

[0118] After screening, the recovery rate was selected as the evaluation index for the screening process. The formula for calculating the recovery rate is shown in Formula 2-1:

[0119]

[0120] This experiment used the GO-SELEX method to screen serum protein nucleic acid aptamers. A total of seven rounds of screening were performed, with a reverse screening in the sixth round. This reverse screening enhances the specificity of the nucleic acid aptamers, thereby obtaining sequences with higher specificity. The results are as follows: Figure 6 As shown, with the increase of screening rounds, the recovery rate gradually increased, and the enrichment of the screening products increased, indicating that the affinity between the nucleic acid aptamers and the target protein was enhanced. In the 6th round, a reverse screening was performed, adding non-target proteins to remove nucleic acid aptamers that could bind to other proteins, thereby enhancing the specificity of the nucleic acid aptamers. The recovery rate decreased. In the 7th round, a positive screening was performed again, and the recovery rate improved, becoming similar to that of the 4th and 5th rounds. The recovery rate then tended to stabilize, and the screening was stopped. The screening products from the 7th round were used for the next experiment.

[0121] 2.5 Analysis of High-Throughput Sequencing Results

[0122] The secondary library obtained in the 7th round was selected as a PCR template. PCR amplification was performed using Primer-F and Primer-R, and the PCR products were sent to Shanghai Sangon Biotech for high-throughput sequencing. Sequencing results showed a total of 72,758 sequences. The top 29 sequences with the best repeat counts were used for analysis. As shown in Table 3, the sequences in the table are 40 nt intermediate sequences with the fixed ends removed. Homology analysis of the sequencing results was performed using DNAMAN software.

[0123] Table 3. Results of high-throughput sequencing of nucleic acid aptamers

[0124]

[0125] 2.5.1 Homology analysis of high-throughput sequencing results

[0126] Homology analysis of candidate nucleic acid aptamers was performed using DNAMAN software. The results are as follows: Figure 7 As shown, the 29 nucleic acid aptamers showed poor homology. Several aptamers with identical base sites were selected for further homology analysis. The results showed that the first three base sites of seven candidate aptamers (seq-4, seq-5, seq-19, seq-20, seq-24, seq-25, and seq-28) were identical, and the first eight base sites were basically identical, with a repetition rate of 53.66%, indicating good homology. These aptamers can be used as candidate aptamers for subsequent experiments.

[0127] 2.5.2 Secondary Structure Analysis of High-Throughput Sequencing Results

[0128] Gibbs free energy is a thermodynamic function artificially introduced to explore the direction (forward and reverse) and limits of thermodynamic processes. Binding ability is determined by stability and structure; stability is related to Gibbs free energy, and any reaction proceeds in the direction that decreases Gibbs free energy. The smaller the Gibbs free energy, the more stable the secondary structure, which contributes to the robustness of the target-aptamer complex structure. As shown in Table 4 below, based on the seven candidate nucleic acid aptamers selected above, the Gibbs free energy of the nucleic acid aptamers was analyzed and calculated. Aptamers seq-19, seq-24, and seq-25 have smaller Gibbs free energies and better stability; therefore, these three aptamers were selected for subsequent experiments.

[0129] Table 4. Secondary structure analysis of nucleic acid aptamers

[0130]

[0131] 2.6 Graphene oxide fluorescence method for detecting nucleic acid aptamer specificity

[0132] The above three aptamers were selected for verification. The aptamers with fluorescent labels were synthesized by Shanghai Sangon Biotech, and the specific candidate aptamer sequences are shown in Table 5 below:

[0133] Table 5 Nucleic acid aptamer sequences

[0134]

[0135] Fluorescent nucleic acid aptamers were incubated with transgenic soybean CP4 EPSPS protein and other proteins of the same concentration. CPS binds to the aptamers with affinity, and the resulting complexes interfere with GO adsorption of the nucleic acid aptamers. GO dispersion completely quenches the fluorescence of aptamers that are not bound to the protein. The results are as follows: Figure 8As shown, the fluorescence intensity values ​​of the three candidate aptamers binding to CPS protein were higher than those of other proteins, indicating that all three candidate aptamers had good affinity for CPS protein. In aptamer seq-19, zein and soybean protein isolate (SPI) had some influence. In aptamer seq-25, zein also had some influence, but its overall specificity was better than that of seq-19. Therefore, aptamer seq-25 was selected as Capture aptamer 1, with the sequence 5'-CGGTCGTAGGGGAAGTTAATACAATTTCCCCGCAAAG GCC-3', and was coupled with magnetic beads to construct MBs-Capture aptamer 1 for the isolation and enrichment of transgenic proteins. The seq-24 aptamer exhibits good binding affinity to CPS proteins, with minimal influence from other proteins, demonstrating good specificity. Therefore, the seq-24 aptamer was selected as Aptamer 2, with the sequence 5'-CGGGCGCA CTGTGTCAATGATTGGTTAGCATCACAATGGG-3', to prepare CdTe / CdS / ZnS quantum dots (QDs) (see...). Figure 9 And coupled with it to construct QDs-Aptamer 2.

[0136] A 12-nt length ssDNA sequence complementary to Aptamer 2 was designed as a probe near the 5' end, with the sequence 5'-ACAGTGCGCCCG-3'. The 3' end was aminated and then ligated with Alexa Fluor 555dye to construct an Alexa Fluor 555 dye-Probe. Finally, QDs-Aptamer 2 and Alexa Fluor 555dye-Probe were mixed and ligated at a 1:1 ratio to construct the FRET reaction system.

[0137] 3. Summary

[0138] The screening method used in this experiment was the graphene oxide method, a classic fixation-free method for screening nucleic acid aptamers. The screening process consisted of seven rounds, with a reverse screening performed in the sixth round. After screening, the final ssDNA library was sequenced using high-throughput sequencing, yielding 72,758 sequences. The first 29 sequences with good repeat counts were analyzed for homology and secondary structure, identifying three candidate nucleic acid aptamers. These three candidate aptamers were then analyzed using graphene oxide fluorescence spectrometry, ultimately yielding two nucleic acid aptamers with high affinity and specificity, their sequences shown in SEQ ID No. 1-2, respectively. Using these two aptamers, Capture aptamer1 and QDs-Aptamer2 were constructed, and a FRET reaction system was finally established.

[0139] IV. Establishment and Evaluation of CP4 EPSPS Protein Detection Method

[0140] The target CP4 EPSPS protein was enriched and separated using MBs-Capture Aptamer 1, and then added to the FRET reaction system. The target protein "captured" by Aptamer 1 simultaneously binds to Aptamer 2, causing the Alexa Fluor 555 dye-Probe bound to Aptamer 2 to detach, and QDs fluorescence to recover. Rapid detection and analysis were achieved by measuring the fluorescence value, and the fluorescence intensity was positively correlated with the target concentration.

[0141] Specificity detection was performed using zein, soy protein isolate (SPI), and pea protein (PP), respectively. The results showed that the detection system exhibited strong specificity for CP4 EPSPS protein. See [see details]. Figure 10 Non-GMO soybeans were ground into powder, and CP4 EPSPS protein at concentrations of 1, 2, 4, 8, 16, 32, 64, 128, 256, and 512 ng / kg was added. The powders were homogenized, and the established detection system was used for analysis. The detection limit reached 2 ng / kg, the recovery rate ranged from 88.34% to 112.12%, the precision reached 5.18%, and the reproducibility was good.

[0142] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A nucleic acid aptamer for detecting the transgenic component CP4-EPSPS protein in transgenic soybeans, characterized in that: The nucleotide sequences of the nucleic acid aptamers are shown in SEQ ID No. 1 and 2.

2. The application of the nucleic acid aptamer as described in claim 1 in the detection of the transgenic component CP4-EPSPS protein in transgenic soybeans.

3. The application as described in claim 2, characterized in that: The CP4-EPSPS protein detection method includes the following steps: S1, using the magnetic bead-coupled nucleic acid aptamer 1 to enrich and separate CP4 EPSPS protein in the sample; S2, binds the nucleic acid aptamer 2 labeled with fluorescent dye to the enriched CP4 EPSPS protein to form the MBs-Capture Aptamer 1-CP4 EPSPS protein-Aptamer 2 complex. S3, detect and analyze fluorescence signal intensity for quantitative detection of CP4 EPSPS protein; Aptamer 1 and Aptamer 2 are nucleic acid aptamers, and their nucleotide sequences are shown in SEQ ID No. 1 and 2.

4. A kit for detecting CP4-EPSPS protein in genetically modified soybeans, characterized in that: Includes the nucleic acid aptamer as described in claim 1.

5. The kit according to claim 4, characterized in that: It also includes magnetic beads and fluorescent dyes.

Citation Information

Patent Citations

  • Methods for detecting a target nucleotide sequence in a sample utilising a nuclease-aptamer complex

    CN101809164A

  • Screening method for BT-transgene paddy rice Cry1Ab / Ac protein aptamer

    CN102220311A