Synthetic method and application of annular shRNA (short hairpin ribonucleic acid) with gene knockdown function
The cyclized circular shRNA is solved through the 2′,5′-phosphodiester bond linkage of cyclized cyclic shRNA, and the stability of nucleic acid drugs in a nuclease-rich environment is achieved, the gene knockdown function in cells is achieved, and the development direction of new nucleic acid drugs is provided.
Patent Information
- Application Number
- CN202510609105.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2045-05-13
AI Technical Summary
Existing nucleic acid drugs are unstable in nuclease-rich environments, which affects the delivery efficiency and safety of nucleic acid interference therapy, especially the stability problems of circular shRNA when exert gene knockdown function.
By cyclizing the ends of linear shRNA with 2',5'-phosphodiester bonds, a circular shRNA was formed and lysed into shRNA by DBR1 in the cell. The reaction system of MES buffer and EDAC solution was cyclized and purified in combination with RNase R enzyme to improve stability and retain the gene knockdown function.
It improves the stability of circular shRNA in the exonuclease environment and can effectively exert gene knockdown function after entering the cell, providing a direction for the development of new nucleic acid drugs.
Smart Images

Figure CN120464698A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a synthesis method and application of circular shRNA with gene knockdown function. Background Art
[0002] RNA interference (RNAi) is a naturally occurring protective mechanism in organisms that inhibits gene expression by degrading messenger RNA, preventing protein translation. RNAi technology can inhibit target gene expression with high specificity. Consequently, RNAi-related therapies, including small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), ribozymes, and antisense oligonucleotides, have been developed for the treatment of various diseases. Among these therapies, siRNA, miRNA, and shRNA can specifically bind to targeted mRNA, thus attracting attention in the field of nucleic acid therapeutics. shRNA, as a nucleic acid therapeutic, offers numerous advantages, including controllable nucleic acid sequence, convenient synthesis, efficient production, and a relatively clear and straightforward mechanism of action. Despite its significant potential advantages, enhancing the stability of RNAi is particularly important for exposure to nuclease-rich environments during systemic circulation. For example, naked siRNA degrades within minutes in serum. The problem of RNA interference instability in nucleic acid drug delivery has not been completely solved, and the main challenges of most nucleic acid therapies remain unchanged, that is, there are still problems with safe, efficient and targeted delivery.
[0003] Circular RNAs (circ-RNAs) are covalently closed single-stranded RNA molecules. Unlike cis-splicing, endogenous circular RNAs are produced through reverse splicing. Circular RNAs lack free ends, forming a covalently closed loop structure, which makes them somewhat resistant to degradation by ribonuclease R (RNase R). Compared to linear RNA, circular RNAs are less sensitive to exonuclease activity and have greater stability. However, circular shRNAs linked by 3′,5′-phosphodiester bonds can prevent shRNA nucleic acid drugs from achieving gene knockdown. Therefore, the technical problem of how to improve the stability of nucleic acid drug delivery while effectively achieving the gene knockdown function of nucleic acid drugs urgently needs to be solved. Summary of the Invention
[0004] To address the above technical issues, the present invention provides a method for synthesizing and applying circular shRNA with gene knockdown function. This invention improves the stability of shRNA delivery in the presence of exonucleases by designing it as a circ-shRNA. By using a unique 2′,5′-phosphodiester bond for cyclization, the shRNA can be recovered after entering the cell, exerting its function of inhibiting gene expression.
[0005] The technical solutions of the present invention are as follows:
[0006] The present invention provides a method for synthesizing circular shRNA with gene knockdown function.
[0007] In one embodiment, the ends of the linear shRNA are cyclized via 2′, 5′-phosphodiester linkages to form circular shRNA.
[0008] As an embodiment, 3'-deoxyadenosine (cordycepin) is added to the 3' end of the shRNA to convert the triphosphate (5'PPP) at the 5' end of the shRNA into monophosphate (5'P).
[0009] As one embodiment, 3'-deoxyadenosine (cordycepin) is added using E. coli Poly(A) polymerase.
[0010] As one embodiment, RNA 5' pyrophosphohydrolase is used to convert the triphosphate at the 5' end of the shRNA (5'PPP) into a monophosphate (5'P).
[0011] As an embodiment, the cyclization is carried out in a reaction system of MES buffer and EDAC solution.
[0012] As an embodiment, the concentration of the EDAC solution is 200-300 mM.
[0013] The present invention also provides a method for synthesizing the circular shRNA to synthesize the circular shRNA with gene knockdown function.
[0014] As an embodiment, the gene with gene knockdown function includes a Renilla luciferase reporter gene.
[0015] As an embodiment, the nucleotide sequence of the circular shRNA for knocking down the Renilla luciferase reporter gene is shown as SEQ ID No.1.
[0016] The present invention also provides an application of the circular shRNA in preparing a drug with gene knockdown function.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] This invention provides a method for synthesizing circular shRNA, demonstrating the first in vitro synthesis of circular shRNA linked by a 2′,5′-phosphodiester bond. This method improves its stability during delivery in an exonuclease-resistant environment. Upon entry into cells, the 2′,5′-phosphodiester bond is cleaved by DBR1 (Debranching RNA Lariats 1), yielding the shRNA, which can exert its gene knockdown function and inhibit gene expression. This invention provides a new direction for the development of novel nucleic acid drugs for gene knockdown and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 The electrophoresis results of circ-shRNA RmA circularization synthesis are shown in Figure 1. The first lane is a small RNA ladder (50 nt), the second lane is a linear shRNA RpA band, the third lane is a linear shRNA RpA band after 1 hour of RNase R treatment, the fourth lane is a circ-shRNA RmA band, and the fifth lane is a circ-shRNA RmA band after 1 hour of RNase R treatment.
[0020] Figure 2 The shRNA is transfected into a 293T cell line stably expressing a Renilla luciferase reporter gene to knock down the Renilla luciferase reporter gene. A is the result of knocking down the Renilla luciferase reporter gene by shRNA RpA in Comparative Example 2 and shRNA FpA in Comparative Example 3; B is the result of knocking down the Renilla luciferase reporter gene by circ-shRNA RmA in Example 1 and circ-shRNA FmA in Comparative Example 1; C is the result of knocking down the Renilla luciferase reporter gene by circ-shRNA RpA in Comparative Example 4 and circ-shRNA FpA in Comparative Example 5. DETAILED DESCRIPTION
[0021] The present invention provides a method for synthesizing circular shRNA, which forms circular shRNA by connecting the ends of linear shRNA with 2', 5'-phosphodiester bonds.
[0022] In the present invention, 3'-deoxyadenosine is added to the 3' end of the shRNA. In one embodiment, E. coli Poly(A) polymerase is used to add 3'-deoxyadenosine; 3'-deoxyadenosine is also known as cordycepin. The addition of 3'-deoxyadenosine (cordycepin) to the 3' end of the shRNA facilitates subsequent cyclization to form a 2',5'-phosphodiester linkage.
[0023] In the present invention, RNA5' pyrophosphohydrolase (RppH) is used to treat the 5' end of the shRNA. The present invention uses RNA5' pyrophosphohydrolase to treat the 5' end of the shRNA, removing the pyrophosphate from the 5' terminal triphosphorylated RNA to produce 5' monophosphate RNA, which facilitates the subsequent cyclization to form a 2',5'-phosphodiester bond.
[0024] In the present invention, the cyclization is performed in MES buffer and EDAC solution. In one embodiment, the cyclization is performed in MgCl2 solution, MES buffer, and EDAC solution. The MgCl2 solution can reduce electrostatic repulsion and promote the proximity of the RNA ends. The MES buffer provides a stable pH environment for the cyclization reaction. The EDAC solution connects the shRNAs via covalent 2′,5′-phosphodiester bonds. The concentration of the MgCl2 solution is 50-150mM, and in one embodiment, the concentration is 100mM. The concentration of the MES buffer is 50-150mM, and in one embodiment, the concentration is 100mM. The pH of the MES buffer is 5.5-7, and in one embodiment, the pH of the MES buffer is 6.2. The concentration of the EDAC solution is 200-300mM, and in one embodiment, the concentration is 250mM. In one embodiment, the shRNA is first heated in a system of MgCl2 solution and MES buffer at a temperature of 75-85°C for 1-3 minutes. This heating disrupts the non-covalent interactions of the secondary structure within the shRNA, allowing the linear shRNA molecules to fully stretch and expose their ends or attachment sites, thereby improving cyclization efficiency. It also eliminates localized base pairing or stacking within the shRNA molecule, providing spatial accessibility for subsequent 2′,5′-phosphodiester bond reactions. After rapid cooling to room temperature, the solution is added to a system containing EDAC solution for cyclization. The cyclization temperature is 2-8°C, and in one embodiment, it is 4°C. The cyclization time is no less than 2 hours, and in one embodiment, it is 48 hours.
[0025] In the present invention, after the cyclization is completed, RNase R enzyme is added to the reaction system. RNase R enzyme can effectively degrade linear RNA molecules while retaining circular RNA molecules, thereby achieving efficient enrichment and purification of circular RNA. The enzyme activity ratio of the RNase R enzyme to the RNA after the cyclization reaction is 1-3U: 1μg. As an embodiment, the reaction conditions of the RNase R enzyme are as follows: the reaction buffer is 50mM Tris-HCl (pH 8.0), containing 75mM KCl and 3mM MgCl2, the reaction temperature is 37°C, and the reaction time is 1h. After the reaction is completed, the present invention removes the enzyme and other impurities through a phenol-chloroform extraction method to obtain enriched circular RNA.
[0026] The present invention also provides a method for synthesizing the circular shRNA to synthesize a circular shRNA with a gene knockdown function. The Renilla luciferase produced by the expression of the Renilla luciferase reporter gene can catalyze Renilla luciferin to produce fluorescence, and the expression level of the gene can be quickly detected according to the luminescence intensity. In the present invention, the shRNA capable of knocking down the Renilla luciferase gene is cyclized according to the synthesis method described in this application. As an embodiment, the nucleotide sequence of the circular shRNA is shown in SEQ ID No.1. The circular shRNA shown in SEQ ID No.1 is transfected into a 293T cell line stably expressing the Renilla luciferase reporter gene, which can significantly inhibit the expression of the Renilla luciferase reporter gene. It shows that the circular shRNA synthesized by the method of the present invention can play a gene knockdown function.
[0027] The present invention also provides a method for using the circular shRNA in preparing a drug with gene knockdown function.
[0028] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0029] Unless otherwise specified, the materials, reagents, etc. used in the following examples are all commercially available. If specific conditions of use are not specified, they are usually carried out under conventional conditions or under conditions recommended by the company.
[0030] Example 1 In vitro synthesis of circular shRNA (circ-shRNARmA) with knockdown of Renilla luciferase reporter gene
[0031] 1. Synthesis of linear shRNA (shRNA RmA) with knockdown function of Renilla luciferase reporter gene
[0032] The DNA template for synthesizing shRNA RmA was PCR amplified using forward primer SEQ ID No. 2 and reverse primer SEQ ID No. 3. The PCR amplification system consisted of 10 μM forward and reverse primers, water, and Premix Ex Taq. The PCR reaction conditions were: heating at 95°C for 5 minutes to denature the DNA, followed by cooling to 64°C for 30 seconds. Using the purified and recovered DNA fragment as a template, shRNA RmA was synthesized in vitro using T7 RNA polymerase. The fragment was then treated with deoxyribonuclease I (DNase I) at 37°C for 1 hour. After the reaction, the enzyme and other impurities were removed by phenol-chloroform extraction to obtain pure shRNA RmA. The nucleotide sequence of shRNA RmA is shown in SEQ ID No. 4. The primers were synthesized by Sangon Biotechnology Co., Ltd. (Sangon).
[0033] SEQ ID No.2: TAATACGACTCACTATAGCTATGAGCATCAAGATAATCGCGTCGCAGCGGATT;
[0034] SEQ ID No.3: AGCTATGAGCATCAAGATAATCCGCTGCGACGCGAT;
[0035] SEQ ID No. 4: GCUAUGAGCAUCAAGAUAAAUCGCGUCGCAGCGGAUUAUCUUGAUGCUCAUAGCU.
[0036] 2. Circularization and purification of shRNA RmA
[0037] 2.1 Modification of shRNA RmA
[0038] Add shRNA RmA to a solution containing 10×PAP Reaction Buffer, 1mM C9137 cordycepin, RNase Inhibitor, and E. coli Poly(A) Polymerase, and react at 37°C for 30 minutes to add a 3′-deoxyadenosine (cordycepin) poly(A) tail to the 3′ end of shRNA RmA. Add shRNA RmA to a solution containing 1×NEBuffer. TM The reaction was carried out at 37°C for 30 min in a solution of 2 and RppH. The pyrophosphate was removed from the 5′-terminal triphosphorylated RNA of the linear shRNA using RNA 5′ pyrophosphohydrolase (RppH) to generate 5′ monophosphate RNA.
[0039] 2.2 Circularization of shRNA RmA
[0040] The modified shRNA RmA was heated at 80°C for 2 minutes in a system of 100 mM MgCl2 and 100 mM MES buffer (pH 6.2), quickly cooled to room temperature, and 5 minutes later, EDAC was added to the system at a final concentration of 250 mM. The cyclization reaction was carried out at 4°C for 48 hours. After the reaction, the enzyme and other impurities were removed by phenol-chloroform extraction to obtain an RNA sample containing circular shRNA (circ-shRNA RmA) connected by 2′,5′-phosphodiester bonds.
[0041] Purification of circ-shRNA RNA
[0042] 3U of RNase R enzyme was added to each microgram of RNA sample. The RNase R enzyme can degrade linear RNA while retaining circular RNA, thereby achieving efficient enrichment and purification of circ-shRNA RmA. The reaction conditions of the RNase R enzyme are as follows: the reaction buffer is 50mM Tris-HCl (pH 8.0), containing 75mM KCl and 3mM MgCl2, the reaction temperature is 37°C, and the reaction time is 1h. After the reaction is completed, the enzyme and other impurities are removed by phenol-chloroform extraction to obtain purified circ-shRNA RmA, the nucleotide sequence of which is shown in SEQ ID No.1.
[0043] SEQ ID No. 1: GCUAUGAGCAUCAAGAUAAAUCGCGUCGCAGCGGAUUAUCUUGAUGCUCAUAGCUA.
[0044] Comparative Example 1 In vitro synthesis of circular shRNA (circ-shRNAFmA) with knockdown of firefly luciferase reporter gene
[0045] The firefly luciferase reporter gene is another commonly used luciferase reporter gene system. The in vitro synthesized circular shRNA (circ-shRNA FmA) with the ability to knock down the firefly luciferase reporter gene does not have a knockdown effect on the Renilla luciferase reporter gene.
[0046] 1. Synthesis of linear shRNA (shRNA FmA) with the function of knocking down the firefly luciferase reporter gene
[0047] A DNA template for synthesizing shRNA FmA was PCR amplified using forward primer SEQ ID No. 5 and reverse primer SEQ ID No. 6. The PCR amplification system consisted of 10 μM forward and reverse primers, water, and Premix Ex Taq. The PCR reaction conditions were: heating at 95°C for 5 minutes to denature the DNA, followed by cooling to 64°C for 30 seconds. Using the purified DNA fragment as a template, shRNA FmA was synthesized in vitro using T7 RNA polymerase. The fragment was then treated with deoxyribonuclease I (DNase I) at 37°C for 1 hour. After the reaction, the enzyme and other impurities were removed by phenol-chloroform extraction to obtain pure shRNA FmA. The nucleotide sequence of shRNA FmA is shown in SEQ ID No. 7. The primers were synthesized by Sangon Biotechnology Co., Ltd. (Sangon).
[0048] SEQ ID No.5: TAATACGACTCACTATAGCTACATTCTGGAGACATATCGCGTCGCAGCGGAT
[0049] SEQ ID No.6: GGCTACATTCTGGAGACATATCCGCTGCGACGCGAT
[0050] SEQ ID No. 7: GCUACAUUCUGGAGACAUAUCGCGCCAGCGGAUAUGUCUCCAGAAUGUAGCC.
[0051] 2. Circularization and Purification of shRNA FmA
[0052] The circularization and purification methods described in Example 1 were used to obtain circ-shRNA FmA.
[0053] Comparative Example 2 In vitro synthesis of linear shRNA (shRNA RpA) with knockdown function of Renilla luciferase reporter gene
[0054] The method for synthesizing shRNA RmA was the same as that described in Example 1. The difference was that the forward primer for PCR amplification of shRNA RpA was SEQ ID No. 8, and the reverse primer was SEQ ID No. 9. The nucleotide sequence of the amplified shRNA RpA was SEQ ID No. 10. The primers were synthesized by Sangon Biotech Co., Ltd. (Sangon).
[0055] SEQ ID No.8: TAATACGACTCACTATAGCTATGAGCATCAAGATAATCGCGTCGCAGCGGATT;
[0056] SEQ ID No.9: TAGCTATGAGCATCAAGATAATCCGCTGCGACGCGAT;
[0057] SEQ ID No. 10: GCUAUGAGCAUCAAGAUAAAUCGCGUCGCAGCGGAUUAUCUUGAUGCUCAUAGCUA.
[0058] Comparative Example 3 In vitro synthesis of linear shRNA (shRNAFpA) with the function of knocking down firefly luciferase reporter gene
[0059] The synthesis method of shRNA ARmA was the same as that described in Example 1. The difference was that the forward primer for PCR amplification of shRNA FpA was SEQ ID No. 11, and the reverse primer was SEQ ID No. 12. The nucleotide sequence of the amplified shRNA FpA was SEQ ID No. 13. The primers were synthesized by Sangon Biotech Co., Ltd. (Sangon).
[0060] SEQ ID No.11: TAATACGACTCACTATAGCTACATTCTGGAGACATATCGCGTCGCAGCGGAT;
[0061] SEQ ID No.12: TGGCTACATTCTGGAGACATATCCGCTGCGACGCGAT;
[0062] SEQ ID No. 13: GCUACAUUCUGGAGACAUAUCGCGUCGCAGCGGAUAUGUCUCCAGAAUGUAGCCA.
[0063] Comparative Example 4: In vitro synthesis of shRNA capable of knocking down the Renilla luciferase reporter gene by linking the circular shRNA (circ-shRNA RpA) with a 3′,5′-phosphodiester bond
[0064] The shRNA RpA described in Comparative Example 2 was added to a system containing T4 RNA Ligase 2 and 10×T4 Rnl2 Reaction Buffer, and the reaction was carried out at 25° C. for 48 h, so that T4 RNA ligase 2 cyclized the shRNA RpA through enzymatic cyclization to form a circular shRNA (circ-shRNA RpA) cyclized by a 3′, 5′-phosphodiester bond.
[0065] Comparative Example 5 In vitro synthesis of shRNA capable of knocking down the firefly luciferase reporter gene by linking the circular shRNA (circ-shRNA FpA) with a 3′,5′-phosphodiester bond
[0066] The shRNA FpA described in Comparative Example 3 was added to a system containing T4 RNA Ligase 2 and 10×T4 Rnl2 Reaction Buffer, and the reaction was carried out at 25° C. for 48 h, so that T4 RNA ligase 2 cyclized the shRNA FpA through enzymatic cyclization to form a circular shRNA (circ-shRNA FpA) cyclized by a 3′, 5′-phosphodiester bond.
[0067] Experimental Example 1: Synthesis and Verification of circ-shRNA RmA
[0068] 1. Preparation of Denatured Urea Polyacrylamide Gel
[0069] The reagents for gel preparation are as follows:
[0070]
[0071]
[0072] 2. Sample Processing
[0073] Five samples, including the small RNA ladder (50 nt), shRNA RpA in Comparative Example 2, shRNA RpA after 1 hour of RNase R treatment, circ-shRNA RmA in Example 1, and circ-shRNA RmA after 1 hour of RNase R treatment, were mixed with equal volumes of formamide and glycerol mixture and denatured at 95°C for 2 minutes in a PCR instrument. RNase R can effectively degrade linear RNA molecules while retaining circular RNA molecules.
[0074] 3. Electrophoresis
[0075] Tris-Borate-EDTA Buffer was used both inside and outside the electrophoresis tank, and electrophoresis was performed at a rated voltage of 70 V for 4 h.
[0076] 4. Staining and Glue
[0077] The treated gel was stained in NA-RED staining solution for 30 min and observed and photographed under UV gel imaging. The electrophoresis results were as follows: Figure 1 shown. Figure 1The results show that the linear shRNA RpA in the third lane was digested after treatment with RNase R, while the circular circ-shRNA RmA in the fifth lane was not digested after treatment with RNase R. The experimental results confirm that the present invention has completed the synthesis of circular shRNA.
[0078] Experimental Example 2 Functional Verification of circ-shRNA RmA
[0079] 1. Construction of a 293T cell line stably expressing the Renilla luciferase reporter gene
[0080] The Renilla luciferase reporter gene was constructed into the modified CRISPR / Cas9 lentiGuide puro plasmid.
[0081] The lentiGuide puro plasmid was co-transfected into 293T cells along with two other lentiviral packaging plasmids, PMDG.2 and psPAX2. The viral supernatant was collected 48 hours after transfection and used to infect 293T cells. After 24-48 hours of infection, the cells were selected with puromycin to obtain a 293T cell line stably expressing the Renilla luciferase reporter gene. The 293T cell line contains the DBR1 (RNA debranching enzyme 1) gene, which is responsible for degrading the intronic lariat RNA (lariat RNA) produced during splicing. That is, the DBR1 gene can cleave 2',5'-phosphodiester bonds.
[0082] 2. circ-shRNA RmA transfection experiment
[0083] Use Lipofectamine 3000 reagent to transfect the linear shRNA and circular shRNA synthesized in Example 1, Comparative Example 1, Comparative Example 2 and Comparative Example 3, Comparative Example 4, Comparative Example 5 respectively into the 293T cell line stably expressing the Renilla luciferase reporter gene, after culturing 48-72h, cell lysate was added to each group of cells cultured accordingly, and the supernatant was taken after centrifugation as a substrate for luciferase activity detection. When detecting luciferase activity, a blank control (BC) in which only substrate was added was designed for each group. The expression results of each group of Renilla luciferase reporter gene are as shown in Figure 2. Figure 2 As shown, Figure 2 A is the result of knocking down the Renilla luciferase reporter gene by shRNARpA in Comparative Example 2 and shRNAFpA in Comparative Example 3. Figure 2 As shown in Figure A, transfection of shRNA RpA into the 293T cell line stably expressing the Renilla luciferase reporter gene can significantly inhibit gene expression (P<0.05). Figure 2B is the result of knockdown of Renilla luciferase reporter gene by circ-shRNA RmA in Example 1 and circ-shRNA FmA in Comparative Example 1. Figure 2 As shown in Figure B, transfection of circ-shRNARmA linked by 2′,5′-phosphodiester bonds into the 293T cell line stably expressing the Renilla luciferase reporter gene can significantly inhibit gene expression (P<0.05). Figure 2 C is the result of knockdown of Renilla luciferase reporter gene by circ-shRNA RpA in comparative example 4 and circ-shRNA FpA in comparative example 5. Figure 2 As shown in Figure C, transfection of the circ-shRNA RpA linked by 3′,5′-phosphodiester bonds using T4 RNA ligase 2 into a 293T cell line stably expressing the Renilla luciferase reporter gene failed to inhibit gene expression. The results indicate that the circ-shRNA RmA linked by 2′,5′-phosphodiester bonds of the present invention can still significantly inhibit the expression of the Renilla luciferase reporter gene in a 293T cell line stably expressing the Renilla luciferase reporter gene.
[0084] The above experimental results indicate that the circular shRNA linked by 2′,5′-phosphodiester bonds of the present invention can exert the gene knockdown function of shRNA nucleic acid drugs. The method of the present invention can obtain circular shRNA with gene knockdown function. The present invention provides a new direction for the development of novel nucleic acid drugs for knocking down gene expression and has broad application prospects.
[0085] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.
Claims
1. A method for synthesizing circular shRNA with gene knockdown function, characterized in that: The ends of the linear shRNA were cyclized by 2′,5′-phosphodiester linkage to form circular shRNA.
2. The method for synthesizing circular shRNA according to claim 1, wherein 3'-deoxyadenosine is added to the 3' end of the shRNA to convert the triphosphate at the 5' end of the shRNA into a monophosphate.
3. The method for synthesizing circular shRNA according to claim 2, wherein 3'-deoxyadenosine was added using E. coli Poly(A) polymerase.
4. The method for synthesizing circular shRNA according to claim 2, wherein shRNA was treated with RNA 5′ pyrophosphohydrolase.
5. The method for synthesizing circular shRNA according to claim 1, wherein The cyclization is carried out in a reaction system of MES buffer and EDAC solution.
6. The method for synthesizing circular shRNA according to claim 5, wherein The concentration of the EDAC solution is 200-300 mM. 7 . A method for synthesizing the circular shRNA according to any one of claims 1 to 6 , for synthesizing circular shRNA with gene knockdown function.
8. The circular shRNA according to claim 7, characterized in that The gene with gene knockdown function includes a Renilla luciferase reporter gene.
9. The circular shRNA according to claim 8, characterized in that The nucleotide sequence of the circular shRNA for knocking down the Renilla luciferase reporter gene is shown in SEQ ID No.
1.
10. Use of the circular shRNA according to any one of claims 7 to 9 in preparing a drug having gene knockdown function.
Citation Information
Patent Citations
Nucleic acid delivery vectors comprising cyclic single-stranded polynucleotides
CN114846138A
Establishment method of zebrafish model for simulating duodenal obstruction
CN119837089A
Compositions and methods for transient gene therapy with enhanced stability
US20180169146A1
Circular RNA platforms, uses thereof, and their manufacturing processes from engineered DNA
US20230235337A1
Novel circular interfering RNA molecules
WO2010084371A1