ACTA2 + MCAM + Application of cells in the assessment of recurrence, radiotherapy efficacy, prognosis, and treatment of nasopharyngeal carcinoma patients

Abstract

This invention provides ACTA2 + MCAM + Application of cells in nasopharyngeal carcinoma patients' recurrence, radiotherapy efficacy and prognostic assessment, and treatment. This invention, based on extensive research, has discovered that ACTA2... + MCAM + Cells can serve as specific biomarkers for assessing nasopharyngeal carcinoma recurrence, radiotherapy efficacy, and prognosis; detection of ACTA2 is indicated. + MCAM + The cellular reagent can be used to prepare products for assessing nasopharyngeal carcinoma recurrence, radiotherapy efficacy, and prognosis. Furthermore, the ACTA2... + MCAM + Cells promote radioresistance in nasopharyngeal carcinoma cells by secreting type IV collagen that binds to the ITGA2 integrin receptor on the surface of the cells. This activation of the downstream PI3K-AKT signaling pathway leads to the formation of this receptor. Therefore, specific clearance of ACTA2 is crucial. + MCAM + Cells, inhibiting ACTA2 + MCAM + Cellular production of type IV collagen and blocking the binding of type IV collagen to the ITGA2 integrin receptor on the surface of tumor cells, as well as inhibiting the downstream PI3K-AKT signaling pathway, can effectively reverse the radiotherapy resistance of nasopharyngeal carcinoma and improve the efficacy of radiotherapy.

Description

Technical Field

[0001] This invention belongs to the fields of molecular diagnostics and biomedicine, and particularly relates to ACTA2. + MCAM + Application of cells in the assessment of recurrence, radiotherapy efficacy, prognosis, and treatment of nasopharyngeal carcinoma patients. Background Technology

[0002] Nasopharyngeal carcinoma (NPC) is highly prevalent in my country, and the presence of numerous infiltrating immune cells around tumor foci suggests the existence of a specific tumor microenvironment (TME) in NPC. The tumor microenvironment is a complex micro-ecosystem with spatiotemporal interactions among heterogeneous cell types (including malignant cells, immune cells, and stromal cells). The tumor microenvironment and its heterogeneity are closely related to tumor treatment resistance and recurrence. Radiotherapy is the most crucial treatment for NPC patients. Approximately 10-20% of endemic NPC patients experience local recurrence after previous radical radiotherapy, and the current standard treatment for locally recurrent NPC is two courses of radiotherapy.

[0003] Therefore, timely assessment of recurrence, radiotherapy efficacy, and prognosis in nasopharyngeal carcinoma is crucial for timely intervention and treatment of recurrent patients and for selecting appropriate treatment plans. Summary of the Invention

[0004] Based on this, the purpose of the present invention is to provide ACTA2. + MCAM + Applications of cells in cancer patient recurrence, radiotherapy efficacy and prognostic assessment, and treatment.

[0005] To achieve the above objectives, the present invention adopts the following technical solution.

[0006] The first aspect of the present invention is to provide ACTA2 + MCAM + Application of cells as biomarkers in the assessment of recurrence, and / or radiotherapy efficacy, and / or prognosis in nasopharyngeal carcinoma patients.

[0007] A second aspect of the present invention is to provide a method for detecting ACTA2. + MCAM + Application of cell ratio reagents in the preparation of products for assessing recurrence in nasopharyngeal carcinoma patients, and / or assessing the efficacy of radiotherapy, and / or prognostic assessment.

[0008] In some embodiments, the reagents include reagents for flow cytometry detection and immunofluorescence detection.

[0009] In some embodiments, the product is a reagent kit.

[0010] A third aspect of the present invention is to provide a kit for assessing recurrence, radiotherapy efficacy, and prognosis in nasopharyngeal carcinoma patients, the kit comprising a reagent for detecting ACTA2. + MCAM + Reagents for cell ratios.

[0011] In some embodiments, the reagents include reagents for flow cytometry detection and immunofluorescence detection.

[0012] A fourth aspect of the present invention is to provide a method for clearing ACTA2. + MCAM + Cellular reagents, and / or inhibitors of ACTA2 + MCAM + The application of reagents for cell-derived type IV collagen production and / or PI3K-AKT pathway inhibitors in the preparation of radiosensitizers for nasopharyngeal carcinoma patients.

[0013] In some embodiments, the reagent includes at least one of an MCAM-specific binding antibody, a reagent that inhibits COL4A1 gene expression, a reagent that inhibits COL4A2 gene expression, and MK2206.

[0014] A fifth aspect of the present invention is to provide a radiosensitizer for nasopharyngeal carcinoma patients, wherein the main active ingredient of the radiosensitizer includes scavenging ACTA2. + MCAM + Cellular reagents, inhibitors of ACTA2 + MCAM + At least one of the following: a reagent for cell-derived type IV collagen production and an inhibitor of the PI3K-AKT pathway.

[0015] In some embodiments, the reagent includes at least one of an MCAM-specific binding antibody, a reagent that inhibits COL4A1 gene expression, a reagent that inhibits COL4A2 gene expression, and MK2206.

[0016] Compared with the prior art, the present invention has the following beneficial effects.

[0017] This invention, based on extensive research, has found that compared to newly diagnosed nasopharyngeal carcinoma patients, patients with recurrent nasopharyngeal carcinoma have higher levels of ACTA2 in their biosamples. + MCAM + The cell count was significantly increased and it can be used for recurrence assessment in nasopharyngeal carcinoma patients. Furthermore, ACTA2... + MCAM + Cells were also significantly associated with poor prognosis and radioresistance in nasopharyngeal carcinoma patients. Therefore, ACTA2 + MCAM +Cells can serve as specific biomarkers for assessing nasopharyngeal carcinoma recurrence, radiotherapy efficacy, and prognosis; detection of ACTA2 is crucial. + MCAM + Reagents for cell ratios can be used to prepare products for assessing cancer recurrence, radiotherapy efficacy, and prognosis.

[0018] Furthermore, the present invention also discovered that ACTA2 + MCAM + Cells secrete type IV collagen, which binds to the ITGA2 integrin receptor on the surface of tumor cells, activating the downstream PI3K-AKT signaling pathway and thus promoting radiotherapy resistance in cancer cells. Therefore, inhibiting ACTA2... + MCAM + Cells produce type IV collagen. Blocking the binding of type IV collagen to the ITGA2 integrin receptor on the surface of tumor cells and inhibiting the downstream PI3K-AKT signaling pathway can effectively reverse the radiotherapy resistance of tumor cells and improve the efficacy of radiotherapy. Attached Figure Description

[0019] Figure 1 For ACTA2 + MCAM + Experimental results on the association between cells and recurrence in nasopharyngeal carcinoma patients.

[0020] Figure 2 For ACTA2 + MCAM + Experimental results on the association between cells and poor prognosis in patients with nasopharyngeal carcinoma.

[0021] Figure 3 For ACTA2 + MCAM + Experimental results on the relationship between cells and radiotherapy resistance in nasopharyngeal carcinoma patients.

[0022] Figure 4 For ACTA2 + MCAM + Experimental results showing that type IV collagen promotes radiotherapy resistance in nasopharyngeal cancer cells.

[0023] Figure 5 This study presents experimental results showing that IV collagen promotes radioresistance in nasopharyngeal carcinoma cells by binding to the integrin receptor ITGA2 on the surface of nasopharyngeal carcinoma cells.

[0024] Figure 6 To inhibit the PI3K-AKT pathway and ACTA2 + MCAM + Experimental results showing a significant reduction in the tumor-promoting effects of cells. Detailed Implementation

[0025] Experimental methods in the following embodiments of the present invention, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used chemical reagents used in the embodiments are commercially available products.

[0026] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0027] The terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion. For example, a process, method, apparatus, product, or device that includes a series of steps is not limited to the steps or modules listed, but may optionally include steps not listed, or may optionally include other steps inherent to such process, method, product, or device.

[0028] In this invention, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent three cases: A existing alone, A and B existing simultaneously, and B existing alone. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.

[0029] The following description is based on specific embodiments.

[0030] In the following embodiments, ACTA2 will be used. + MCAM + The cell is called MCAM + Tumor-associated fibroblasts (MCAM) + mCAFs).

[0031] Example 1

[0032] Clinical samples were collected from 40 matched, treatment-naïve, recurrent nasopharyngeal carcinoma patients (validation corhort 1). MCAM was detected in the samples using immunofluorescence staining. + The proportion of tumor-associated fibroblasts.

[0033] Figure 1 Image A shows a typical result of immunofluorescence staining. Figure 1 Figure B shows the statistical results, indicating that ACTA2 levels were higher in patients with recurrent nasopharyngeal carcinoma compared to newly diagnosed nasopharyngeal carcinoma patients. + MCAM +The proportion of double-positive tumor-associated fibroblasts is significantly increased in patients with recurrent nasopharyngeal carcinoma.

[0034] Furthermore, in order to verify ACTA2 + MCAM + The role of double-positive tumor-associated fibroblasts in assessing nasopharyngeal carcinoma recurrence was investigated. Primary fibroblast cultures were performed on 10 PT and 10 RT nasopharyngeal carcinoma lesions, and MCAMs were then isolated by flow cytometry. + The proportion of tumor-associated fibroblasts was found in RT samples, with MCAMs being the most abundant. + The proportion of mCAFs was 58.47% (median), almost nine times that of the PT sample (median, 6.275%). Figure 1 (As shown in Figure C). Furthermore, we performed ROC curve analysis, and the results showed that MCAM... + mCAF cells had an AUC of 0.9100 when used to predict nasopharyngeal carcinoma recurrence. Figure 1 As shown in Figure D), the accuracy is relatively high. Therefore, MCAM... + mCAFs have high predictive value for the prognosis of nasopharyngeal carcinoma patients.

[0035] The above results indicate that MCAM + Tumor-associated fibroblasts can serve as a specific biomarker for assessing recurrence in nasopharyngeal carcinoma, with high accuracy.

[0036] Example 2

[0037] We also discovered MCAM + Tumor-associated fibroblasts are significantly associated with poor prognosis in nasopharyngeal carcinoma patients. For example... Figure 2 As shown, in validation cohort 2, we collected samples from 86 pNPC patients who had received radiotherapy and used immunofluorescence staining to detect MCAM. + The proportion of mCAFs cells was determined, and samples were categorized into high-mCAF and high-mCAF groups based on the test results. + mCAFs cell proportion group and low MCAM + mCAFs cell proportion groups were labeled as follows: the top 30% of patients with MCAM expression were defined as the high MCAM expression group, and the bottom 70% of patients were defined as the low MCAM expression group. The prognosis of the two groups was compared.

[0038] The results showed that, with low MCAM + Compared to the mCAFs cell proportion group, the proportion of MCAMs was higher. + mCAFs and patients with worse LRRFS ( Figure 2 (B) is related to OS ( Figure 2 In the middle (A), multivariate analysis also suggested MCAM.+ The proportion of mCAFs+ cells was an important independent predictor of LRRFS (HR = 8.93, P < 0.001) and OS (HR = 7.69, P = 0.015) (Table 1).

[0039] Table 1

[0040]

[0041] Example 3

[0042] MCAM + Tumor-associated fibroblasts are significantly associated with radiotherapy resistance in nasopharyngeal carcinoma patients.

[0043] 1. In vitro experiments with cell lines

[0044] Firstly, we successfully obtained and identified MCAM from fresh tissue samples of patients with recurrent nasopharyngeal carcinoma using flow cytometry. + myCAFs(ACTA2 + MCAM + ) and MCAM - CAFs(ACTA2 + MCAM - The identification results are shown in the image below. Figure 3 As shown in Figure A.

[0045] MCAM + CAFs and MCAM - CAFs were co-cultured with nasopharyngeal carcinoma carcinoma lines C666 and TW03, respectively, using the following method: Nasopharyngeal carcinoma carcinoma lines and fibroblasts were indirectly co-cultured in Tranwell chambers (Cat 3412, Corning) with 0.42 μm pores. C666 cells or TW03 cells were seeded at a ratio of 1.5 * 10⁵ cells at the bottom of a six-well plate, and fibroblasts were seeded at a ratio of 5 * 10⁵ cells. 4 The samples were seeded at a density in the upper chambers of a six-well plate and incubated indirectly for five days before subsequent experiments were conducted.

[0046] Nasopharyngeal carcinoma cell lines C666 and TW03 were respectively associated with MCAM + After indirect co-culturing mCAFs or MCAM-mCAFs for 5 days, they were irradiated with 10 Gy. Immunofluorescence was used to detect the expression of the nuclear protein γH2AX after irradiation, and flow cytometry was used to detect tumor cell apoptosis. We found no significant difference between the MCAM-mCAF co-culture group and the PBS group, while MCAM... + mCAF can significantly reduce the uptake rate of γH2AX in C666 and TW03 cells. Figure 3(B). Furthermore, we found that indirect co-culture of nasopharyngeal carcinoma cells with MCAM+mCAFs significantly reduced apoptosis in C666 and TW03 cells. Figure 3 (C) but the apoptosis level in the MCAM-mCAF co-culture group showed no significant change. Flow cytometry and immunofluorescence assays both indicated that MCAM... + mCAFs can reduce the apoptosis rate of tumor cells and promote radiotherapy resistance in nasopharyngeal carcinoma cells.

[0047] 2. In vivo experiments using animal models

[0048] Furthermore, in order to better explore MCAM + mCAF promotes radiotherapy resistance in nasopharyngeal carcinoma cells. We purchased female NCG mice (18-20g, 3-8 weeks old, strain NO. T001475) from GemPharmatech in Guangdong, China, to conduct in vivo experiments using the NCG mouse model. The method is as follows: Guangdong Yaokang Company constructed a highly immunodeficient NCG mouse model by simultaneously knocking out the Prkdc gene (protein kinase, DNA activation, catalytic peptide) and the I12rg gene (common γ-chain receptor). The NCG mice were randomly divided into three groups: C666+MCAM... + mCAFs group, C666+MCAM - CAFs group and C666+PBS group (n=6 in each group). Among them, C666 cells (1×10 6 ) respectively with MCAM + mCAFs or MCAM - CAFs were mixed in a 3:1 ratio. The mixed cells were subcutaneously injected into the buttocks of mice to establish a tumor xenograft model. When the tumors were measurable, on days 6-7, all mice were locally irradiated under anesthesia at a dose of 2 Gy, once daily for 5 consecutive days. Tumor volume (V) and weight were measured every 2 days for each mouse. The changes in tumor volume across the three groups were observed and recorded, calculated using the formula V = (length × width²) / 2. When the tumors reached a certain size, around day 28, the mice were sacrificed, and the tumors were removed for volume measurement and weight. Furthermore, the above treatment was repeated for three groups, and tumor survival curves were plotted. The tumor volume was increased until it reached 1600 mm². 3 Mice are considered to have reached the end of their survival when obvious ulcers appear.

[0049] Consistent with in vitro experimental results, this model validates the interaction between C666 and MCAM. + mCAFs co-cultured rather than with MCAM - When mCAFs are co-cultured, they can significantly enhance the tumor's radiation resistance and sustain tumor growth, and significantly reduce tumor cell apoptosis and tumor volume. Figure 3(D) and weight ( Figure 3 MCAM levels were significantly elevated. In vivo experiments also demonstrated that MCAM... + myCAF may be a major factor contributing to radiotherapy resistance in nasopharyngeal carcinoma tumors.

[0050] The above results indicate that MCAM + Tumor-associated fibroblasts (MCAMs) are significantly associated with radiotherapy resistance in nasopharyngeal carcinoma patients, and MCAMs are present in tissue samples. + Patients with a high proportion of tumor-associated fibroblasts may develop radiotherapy resistance.

[0051] Example 4

[0052] Furthermore, differential gene analysis using single-cell sequencing (contracted to Guangzhou Yuanxin Biotechnology Co., Ltd.) indicated that in MCAM... + Significant differences were found in the secreted protein genes such as COL4A1, COL4A2, PDGFA, and IGFBP7 in tumor-associated fibroblasts. Figure 4 Further Western blot (WB) and ELISA results (A and B) also confirmed MCAM. + myCAFs significantly increased type IV collagen secretion. Figure 4 (C and D) We hypothesized that type IV collagen plays a role in radiotherapy resistance in nasopharyngeal carcinoma cells and verified this hypothesis.

[0053] Experimental Methods: We dissolved 5 mg of exogenous type IV human collagen (Cat. No. 5022, Advanced BioMatrix, USA) in 5 ml of pre-chilled 0.25% glacial acetic acid and incubated overnight at 4°C with shaking. The dissolved type IV collagen was then used in a solution containing 20 μg / cm³ of [amount missing]. 2 The type IV collagen was coated onto a 6-well plate at a specific concentration. Excess liquid was then aspirated, and the coated plate was stored at 4°C under humid conditions for subsequent experiments.

[0054] We found that after exogenous addition of type IV collagen, the radioresistance of nasopharyngeal carcinoma cells C666 and TW03 cells was significantly enhanced, and the number of tumor cell clones increased significantly. Figure 4 In the middle E), the number of apoptotic cells decreased significantly. Figure 4 (Middle F).

[0055] To further explore MCAM + To investigate whether myCAF functions through type IV collagen, we constructed a stable COL4A1 knockdown MCAM using shRNA specifically targeting the COL4A1 gene. +Fibroblast cell lines. This embodiment provides two shRNAs specifically targeting the COL4A1 gene, namely shRNA1 and shRNA2. The nucleotide sequence of shRNA1 is shown in SEQ ID NO.1; the nucleotide sequence of shRNA2 is shown in SEQ ID NO.2; and the NC sequence is shown in SEQ ID NO.3.

[0056] SEQ ID NO.1:GATCCAGGTGAGATACTTGGC;

[0057] SEQ ID NO.2: AATTGTTATAGGCACAGGACC;

[0058] SEQ ID NO. 3: TAATACGACTCACTATAGGG.

[0059] Building a stable knockdown MCAM for COL4A1 + The method for obtaining the fibroblast cell line (sh-COL4A1) is as follows:

[0060] The COL4A1 knockdown lentiviral vector containing shRNA1 and shRNA2 used in this study was constructed by Guangzhou Yijin Biotechnology Co., Ltd. MCAM was transfected with the COL4A1 knockdown lentiviral vector. + mCAFs. Nasopharyngeal carcinoma cells or primary fibroblasts were injected at a dose of 1×10⁻⁶. 5 Cells were seeded at a density of 1 / 2 well in 6-well plates and transfected with 50 μl of concentrated virus particle suspension using the calcium phosphate method. After 8 h, the transduction medium was replaced with fresh intact medium. After 48 h, transfected cells were selected using purromycin (TRC, Canada). Transfected cells were validated by Western blot. MCAM + mCAFs were transfected, sorted, and amplified. Western blot analysis verified the effectiveness of gene knockout.

[0061] Nasopharyngeal carcinoma cell lines C666 and TW03 were respectively induced to react with sh-NC, two sh-COL4A1 cells (containing shRNA1 and shRNA2, respectively), and MCAM. - After co-culturing CAFs for 48 hours, the number of tumor cell clones formed was detected using the plate cloning method, and the tumor cell apoptosis was detected using flow cytometry.

[0062] The results showed that, compared with NC, the number of tumor cell clones co-cultured with the two sh-COL4A1 strains was significantly reduced. Figure 4 In G), the number of apoptotic cells was significantly increased. Figure 4 (H), almost the same as MCAM -Co-culturing CAFs was quite effective. Furthermore, knockdown of COL4A1 resulted in MCAM... + mCAF significantly reduced radiotherapy resistance, further confirming the efficacy of MCAM. + mCAF exerts its radiotherapy resistance-promoting effect through type IV collagen. Therefore, inhibiting MCAM... + mCAF-generated type IV collagen can reverse the radiotherapy resistance of nasopharyngeal carcinoma cells, thus improving the effectiveness of radiotherapy.

[0063] To investigate the key receptors for type IV collagen's action on tumor cells, we performed receptor-ligand analysis. The results suggest an interaction between COL4A1 / 2-ITGA2_ITGB1 and COL4A1 / 2-ITGA3_ITGB1 between fibroblasts and tumor cells. Figure 5 In the middle A), spatial transcriptome results also suggest that, compared with other fibroblasts, tumor cells and MCAM + There is a stronger COL4A1 / 2-ITGA2_ITGB1 interaction among mCAFs. Figure 5 (B). Immunofluorescence results also indicated that ITGA2 was significantly localized on the surface of tumor cells, while type IV collagen was localized around tumor cells. Figure 5 (C)

[0064] Furthermore, immunoprecipitation results obtained by transfecting 293T cells with Flag-tagged COL4A1 plasmid and HA-tagged ITGA2 plasmid, respectively, indicated a significant interaction between COL4A1 and ITGA2. Figure 5 (D).

[0065] We further constructed stable ITGA2 knockdown nasopharyngeal carcinoma cell lines (C666 and TW03) using shRNAs specifically targeting the ITGA2 gene, and investigated the effects of knocking down the ITGA2 integrin receptor versus exogenous type IV collagen irradiation on tumor cell radioresistance. In this embodiment, two shRNAs specifically knocking down the ITGA2 gene were designed: shRNA1 and shRNA2, with the NC sequence used as a control. The nucleotide sequence of shRNA1 is shown in SEQ ID NO.4, the nucleotide sequence of shRNA2 is shown in SEQ ID NO.5, and the nucleotide sequence of the NC sequence is shown in SEQ ID NO.3.

[0066] SEQ ID NO.4:GCTGTGATTGATCAATGCAAC;

[0067] SEQ ID NO. 5: GCAGTTCTTGGGTACTTAAAC.

[0068] The construction method of the ITGA2 stably knocked-down TW03 cell line (sh-ITGA2) is similar to the construction method of sh-COL4A1 mentioned above.

[0069] Plate cloning assay: Fibroblasts and tumor cells were indirectly co-cultured as described above. After 5 days of co-culture, nasopharyngeal carcinoma cells treated according to the specified conditions were seeded into 6-well plates, with TW03 cells at a density of 1×10⁻⁶. 4 / pore, C666 with a density of 1×10 5 / well seeding. Irradiate cells with a dose of 10 Gy, and change the culture medium every 3 days. After culturing for 7–14 days, wash tumor cells with PBS, fix with formaldehyde at room temperature for 30 min, stain with 1% crystal violet for 10 min, and photograph and count them.

[0070] The results of plate clone experiments all indicated that after ITGA2 knockdown and exogenous addition of IV collagen, both plate clone and flow cytometry apoptosis results showed that the effect of collagen in promoting radioresistance was significantly reduced after knockdown. Figure 5 The results (E, G) suggest that type IV collagen in nasopharyngeal carcinoma plays a role by binding to the integrin receptor ITGA2 on the surface of nasopharyngeal carcinoma cells, thereby promoting radioresistance in nasopharyngeal carcinoma cells.

[0071] Our single-cell sequencing results suggest that the PI3K-AKT pathway is also significantly activated in recurrent nasopharyngeal carcinoma compared to treatment-naïve patients. Figure 5 China F, Figure 6 Significant activation of this pathway was also detected in radiotherapy-resistant strains of nasopharyngeal carcinoma (A).

[0072] Furthermore, we found that when TW03 and C666 cells were treated with the AKT inhibitor MK2206 and irradiated in the presence of exogenous type IV collagen, both plate colony and flow cytometry apoptosis results indicated that AKT inhibition accelerated the uptake of γ-H2AX in both cell lines. Figure 6 In vivo experimental results also suggest that treatment of tumor cells with the PI3K-AKT pathway pan-AKT inhibitor MK2206 can reverse radioresistance caused by IV collagen. Figure 6 Medium CG).

[0073] The above results indicate that MCAM + Tumor-associated fibroblasts (MCAMs) promote radiotherapy resistance in cancer cells by secreting type IV collagen that binds to the ITGA2 integrin receptor on the surface of tumor cells, thereby activating the downstream PI3K-AKT signaling pathway. Therefore, specific clearance of MCAMs is crucial. + Tumor-associated fibroblasts, inhibition of MCAM +Tumor-associated fibroblasts producing type IV collagen or blocking the binding of type IV collagen to the ITGA2 integrin receptor on the surface of tumor cells, as well as inhibiting the downstream PI3K-AKT signaling pathway, can effectively reverse the radiotherapy resistance of tumor cells and improve the efficacy of radiotherapy.

[0074] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0075] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. Detection of ACTA2 + MCAM + Application of cell ratio reagents in the preparation of products for assessing recurrence in nasopharyngeal carcinoma patients, and / or assessing the efficacy of radiotherapy, and / or prognostic assessment.

2. The application as described in claim 1, characterized in that, The reagents include those used for flow cytometry and immunofluorescence detection.

3. The application as described in claim 1 or 2, characterized in that, The product in question is a reagent kit.

4. Clear ACTA2 + MCAM + Cellular reagents, and / or inhibitors of ACTA2 + MCAM + Application of reagents for cell-derived type IV collagen production in the preparation of radiosensitizers for nasopharyngeal carcinoma patients.

5. The application as described in claim 4, characterized in that, The reagent includes at least one of the following: an MCAM-specific binding antibody, a reagent that inhibits COL4A1 gene expression, and a reagent that inhibits COL4A2 gene expression.

Images