ShRNA (short hairpin Ribonucleic Acid) nanocomposite, preparation thereof and application of shRNA nanocomposite in prevention and control of spodoptera frugiperda

Abstract

The invention relates to the technical field of biological prevention and control of pests, in particular to an shRNA (short hairpin Ribonucleic Acid) nanocomposite, preparation thereof and application of the shRNA nanocomposite to prevention and control of spodoptera frugiperda. The shRNA nano-composite provided by the invention comprises an shRNA related element and a cell penetrating disulfide polymer, the shRNA related element is selected from shRNA, a recombinant vector containing the shRNA and a recombinant cell containing the recombinant vector containing the shRNA; wherein the shRNA (short hairpin ribonucleic acid) is selected from one or two of shCHSB (short hairpin CHSB) or shCOPIbeta (short hairpin COPIbeta); wherein the cell-penetrating disulfide polymer is used for protecting the shRNA and delivering the shRNA at the same time, so that the effective prevention and control of the spodoptera frugiperda are successfully realized. The shRNA nanocomposite provided by the invention realizes relatively high silencing efficiency aiming at the CHSB gene and the COPIbeta gene of the spodoptera frugiperda, and generates a remarkable inhibition effect in the subsequent growth and development process of the spodoptera frugiperda.

Description

Technical Field

[0001] The present invention relates to the technical field of biological pest control, and in particular to a shRNA nanocomplex, a preparation method thereof, and an application thereof in controlling fall armyworm. Background Art

[0002] Pests cause multiple harms to agriculture, the environment, and human health. They not only destroy crops, resulting in reduced yields, but also spread diseases and affect human health. The main prevention and control strategy at present is chemical control, which is the use of chemicals such as pesticides to control pests. However, the large-scale use of pesticides has serious pollution problems, and potential pesticide residues can also cause harm to the human body. At the same time, pesticides can also cause pests to develop drug resistance, making pesticides and other insecticides less and less effective. Biological control is an emerging pest control strategy that uses biological means to affect the growth process of pests or introduce natural enemies of pests for prevention and control. It has been successfully applied to pest and disease control. It is eco-friendly and does not cause problems such as drug resistance. However, it has problems such as high cost and insignificant effect.

[0003] RNA interference (RNAi) is a phenomenon of homologous mRNA degradation mediated by double-stranded RNA (dsRNA). It is a highly conserved mechanism in biological evolution and is widely present in organisms. RNAi can inhibit protein synthesis by interfering with the transcription and translation of key genes for insect growth and development, ultimately leading to insect death. Due to the high efficiency and specificity of RNAi-induced target gene silencing, this technology has become a new generation of technology replacing traditional chemical control. For example, patent CN 116042620 A uses dsRNA expression vectors to produce dsRNA for RNA interference against potato beetles, successfully achieving control of this pest.

[0004] The fall armyworm (Spodoptera frugiperda) is a serious agricultural pest that causes significant damage to a wide range of crops. Its larval stage consumes crop leaves, damages stems, and affects fruit. Its adult stage has strong reproductive and migratory abilities, allowing it to quickly spread to new areas, increasing the difficulty of control. However, the fall armyworm has a wide host range, including corn, sugarcane, sorghum, wheat, rice, soybeans, cotton, and other crops. Yield reductions of affected crops can reach 15-20%, and in severe cases, even total crop failure.

[0005] Currently, the control strategy for fall armyworm is still mainly based on chemical pesticides such as chlorantraniliprole, benzoic acid, or spinetoram. Serious drug resistance has emerged, and other control strategies are urgently needed. Paramita Bera et al. successfully achieved lethal and teratogenic effects by using RNA interference against growth-related genes and detoxification-related genes in fall armyworm (Paramita Bera, SB Suby, Sameer Dixit, Vishakh Vijayan, Naveen Kumar, JC Sekhar, Jyothilakshmi Vadassery, Identification of novel target genes for RNAi mediated management of the pest, Fall Armyworm (Spodoptera frugiperda, JE Smith), Crop Protection, Volume 187, 2025, 106972, ISSN 0261-2194). Patent CN117178996 A significantly reduced the amount of pesticide used while maintaining the same control effect by combining RNA interference with traditional pesticides. However, the RNA interference currently used to control fall armyworms mostly uses dsRNA, which relies on a mixture of siRNAs formed by Dicer enzyme processing of dsRNA inside the insect. This interference effect varies among the resulting siRNA sequences, leading to waste of dsRNA base sequences and a lack of research on high-efficiency siRNAs. Furthermore, the delivery methods currently used in research mostly involve naked oral administration and injection, without any nuclease protection to address the susceptibility of RNA to degradation. This poses the risk of RNA degradation by nucleases in the external environment, as well as cost implications in practical applications.

[0006] Therefore, it is very important to provide a technical solution that can solve the above technical problems. Summary of the Invention

[0007] In order to solve the above problems, the purpose of the present invention is to provide a shRNA nanocomplex and its preparation and application in the prevention and control of fall armyworm. The shRNA nanocomplex provided by the present invention includes shRNA-related elements and CPD (cell-penetrating disulfide polymer); the shRNA-related elements are selected from shRNA (small stem-loop double-stranded RNA), a recombinant vector containing shRNA, and a recombinant cell containing a shRNA recombinant vector; wherein, the shRNA is selected from one or both of shCHSB or shCOPIβ; wherein, CPD is used to protect shRNA while delivering it, successfully achieving effective prevention and control of fall armyworm. The shCHSB@CPD complex provided by the present invention achieved a gene silencing efficiency of 72.37% for the CHSB gene of fall armyworm, and the shCOPIβ@CPD complex achieved a gene silencing efficiency of 56.37% for the COPIβ gene of fall armyworm, and produced a significant inhibitory effect in the subsequent growth and development process of the insect body.

[0008] Traditional insect RNA interference (RNAi) is primarily performed through long-chain dsRNAs, which are cleaved into siRNAs of varying sequences by the insect's own Dicer enzyme, thereby initiating the RNAi silencing mechanism. However, due to the significant differences in the silencing effects of siRNAs of varying sequences, the silencing effect of long-chain dsRNAs is provided by only a small number of highly effective siRNA sequences, resulting in significant base waste and poor interference efficiency. This study analyzed the genome of the fall armyworm (Spodoptera frugiperda) and screened for highly effective shRNA sequences targeting two genes associated with growth and development: chitin synthase B (CHSB, NCBI: AY525599.1) and vesicle transport protein (COPIβ, NCBI: XM_035575055.1). By further analyzing and screening the CHSB and COPIβ gene mRNA sequences, we obtained the shRNA sequence with the best RNA interference effect (shRNA can trigger the RNA interference effect to silence genes related to the fall armyworm), avoiding the problems of low interference efficiency and low base utilization of dsRNA, and delivering and protecting shRNA (nuclease degradation protection) by combining with CPD, thereby improving the silencing effect and achieving better prevention and control effects.

[0009] The purpose of the present invention can be achieved by the following technical solutions:

[0010] The first object of the present invention is to provide a shRNA nanocomplex comprising an shRNA-related element and a cell-penetrating disulfide polymer;

[0011] The shRNA-related elements are selected from shRNA, a recombinant vector containing shRNA, and a recombinant cell containing a recombinant shRNA vector;

[0012] Wherein, the shRNA is selected from one or both of shCHSB and shCOPIβ;

[0013] The nucleotide sequence of the shCHSB is selected from one of the nucleotide sequences shown in SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.26, and SEQ ID NO.27; the nucleotide sequence of the shCOPIβ is one of the nucleotide sequences shown in SEQ ID NO.28, SEQ ID NO.31, and SEQ ID NO.32;

[0014] The chemical structure of the cell-penetrating disulfide polymer is shown in formula (I):

[0015]

[0016] In formula (I), m is an integer greater than 10.

[0017] In one embodiment of the present invention, the nucleotide sequence of the shCHSB is selected from one of the nucleotide sequences shown in SEQ ID NO. 27, and the nucleotide sequence of the shCOPIβ is one of the nucleotide sequences shown in SEQ ID NO. 32.

[0018] In one embodiment of the present invention, CPD is obtained by chemical synthesis using lipoic acid and L-arginine methyl ester dihydrochloride as substrates, and has an average molecular weight of 6816.

[0019] In one embodiment of the present invention, the mass ratio of the shRNA-related element to the cell-penetrating disulfide polymer is 1:4-6.

[0020] A second object of the present invention is to provide a method for preparing a shRNA nanocomplex, comprising the following steps:

[0021] (S1) dissolving a cell-penetrating disulfide polymer and then mixing to prepare a cell-penetrating disulfide polymer solution;

[0022] (S2) diluting the shRNA-related elements and adding them dropwise to the cell-penetrating disulfide polymer solution prepared in step (S1), homogenizing by ultrasound and incubating to obtain the shRNA nanocomplex.

[0023] In one embodiment of the present invention, in step (S1), the cell-penetrating disulfide polymer is dissolved in nuclease-free water.

[0024] In one embodiment of the present invention, in step (S1), the concentration of the cell-penetrating disulfide polymer solution is 1000 μg / mL to 3000 μg / mL.

[0025] In one embodiment of the present invention, in step (S2), the incubation temperature is 20-45° C. and the incubation time is 10-30 min.

[0026] In one embodiment of the present invention, in step (S2), in the shRNA nanocomplex, the concentration of the shRNA-related element is 187.5 μg / mL, and the concentration of the cell-penetrating disulfide polymer is 1125 μg / mL;

[0027] During the incubation process, the incubation temperature was 25°C and the time was 15 minutes.

[0028] The third object of the present invention is to provide an application of a shRNA nanocomplex in the preparation of a product for controlling fall armyworm.

[0029] The present invention provides a method for controlling fall armyworm, characterized by comprising the following steps:

[0030] The shRNA nanocomplex is administered so that it is ingested by the Spodoptera frugiperda, or the shRNA nanocomplex is introduced into the body of the Spodoptera frugiperda.

[0031] In one embodiment of the present invention, the method of administering comprises:

[0032] The pesticide is applied topically or to the whole plant, or applied to the plant seeds, or spread through fertilizer, or spread through irrigation, or a combination of the above application methods.

[0033] In one embodiment of the present invention, the plant is a grass plant;

[0034] The introduction method is feeding, body wall penetration or injection.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] (1) The present invention performs RNA screening and verification for the first time to obtain shRNA with the best silencing effect, thereby replacing long-chain dsRNA for RNA interference and having a higher target gene silencing effect.

[0037] (2) The present invention also develops a cell-penetrating disulfide polymer (CPD) shRNA delivery system, which has the ability to efficiently deliver shRNA orally while effectively protecting shRNA from degradation by external nucleases, allowing the system to have a longer effective time in the environment.

[0038] (3) The present invention provides an optimal shRNA interference target for the prevention and control of fall armyworm and has application prospects in environmentally friendly agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the electrophoresis image of shRNA native polyacrylamide gel. Lanes 1 to 11 represent shCHSB-A, shCHSB-B, shCHSB-C, shCHSB-D, shCHSB-E, shCOPIβ-A, shCOPIβ-B, shCOPIβ-C, shCOPIβ-D, shCOPIβ-E, and shGFP, respectively.

[0040] Figure 2 Schematic diagram of CPD chemical synthesis;

[0041] Figure 3 Schematic diagram of CPD binding shRNA;

[0042] Figure 4 For CPD 1 H NMR spectrum;

[0043] Figure 5 is the GPC spectrum of CPD;

[0044] Figure 6 Schematic diagram of the particle size and Zeta potential of CPD before and after binding to shCHSB-E, (A) before binding, (B) after binding;

[0045] Figure 7 TEM image of shCHSB-E@CPD;

[0046] Figure 8 Schematic diagram of shRNA@CPD gene silencing efficiency, (A) is the detection result on Day 8, (B) is the detection result on Day 11;

[0047] Figure 9 Schematic diagram of the body length (A) and weight (B) of the insect after shRNA@CPD treatment;

[0048] Figure 10 This is a schematic diagram of the mortality rate of Spodoptera frugiperda after treatment with shRNA@CPD;

[0049] Figure 11 Schematic diagram of the pupation rate (A) and pupal emergence rate (B) of Spodoptera frugiperda after treatment with shRNA@CPD;

[0050] Figure 12 Schematic diagram of the worm body deformity (taking the shCHSB-E and shCOPIβ-E groups as examples);

[0051] Among them, the figure adopts letter marking method for significance marking. If two groups share the same letters (such as a, b, c), it indicates that there is no significant difference between the two groups (P>0.05); if there are no shared letters, it indicates that there is a significant difference (P<0.05). DETAILED DESCRIPTION

[0052] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0053] In the following examples, unless otherwise specified, all reagents used are commercially available reagents, and all detection means and methods used are conventional detection means and methods in the art.

[0054] Example 1

[0055] This example provides the preparation of shRNA, including shCHSB-A, shCHSB-B, shCHSB-C, shCHSB-D, shCHSB-E, shCOPIβ-A, shCOPIβ-B, shCOPIβ-C, shCOPIβ-D, shCOPIβ-E, and shGFP obtained after screening, as follows:

[0056] (A1) Eleven pairs of primers (shCHSB-AF and shCHSB-AR, shCHSB-BF and shCHSB-BR, shCHSB-CF and shCHSB-CR, shCHSB-DF and shCHSB-DR, shCHSB-EF and shCHSB-ER, shCOPIβ-AF and shCOPIβ-AR, shCOPIβ-BF and shCOPIβ-BR, shCOPIβ-CF and shCOPIβ-CR, shCOPIβ-DF and shCOPIβ-DR, shCOPIβ-EF and shCOPIβ-ER) were used to identify the target genes. Overlap extension PCR was performed on shGFP-R, shGFP-F, and shGFP-R) and purified to obtain in vitro transcription templates Template-CHSB-A, Template-CHSB-B, Template-CHSB-C, Template-CHSB-D, Template-CHSB-E, Template-COPIβ-A, Template-COPIβ-B, Template-COPIβ-C, Template-COPIβ-D, Template-COPIβ-E, and Template-GFP, respectively;

[0057] Among them, the T7 promoter sequence contained in the primer design enables the in vitro transcription templates Template-CHSB-A, Template-CHSB-B, Template-CHSB-C, Template-CHSB-D, Template-CHSB-E, Template-COPIβ-A, Template-COPIβ-B, Template-COPIβ-C, Template-COPIβ-D, Template-COPIβ-E, and Template-GFP to be directly transcribed in vitro, obtaining the initial transcription products CHSB-A, CHSB-B, CHSB-C, CHSB-D, CHSB-E, COPIβ-A, COPIβ-B, COPIβ-C, COPIβ-D, COPIβ-E, and GFP, respectively;

[0058] (A2) digesting the initial transcription products CHSB-A, CHSB-B, CHSB-C, CHSB-D, CHSB-E, COPIβ-A, COPIβ-B, COPIβ-C, COPIβ-D, COPIβ-E and GFP obtained in step (A1) with DNase I enzyme to obtain ssRNA-CHSB-A, ssRNA-CHSB-B, ssRNA-CHSB-C, ssRNA-CHSB-D, ssRNA-CHSB-E, ssRNA-COPIβ-A, ssRNA-COPIβ-B, ssRNA-COPIβ-C, ssRNA-COPIβ-D, ssRNA-COPIβ-E and ssRNA-GFP, respectively;

[0059] (A3) annealing the ssRNA-CHSB-A, ssRNA-CHSB-B, ssRNA-CHSB-C, ssRNA-CHSB-D, ssRNA-CHSB-E, ssRNA-COPIβ-A, ssRNA-COPIβ-B, ssRNA-COPIβ-C, ssRNA-COPIβ-D, ssRNA-COPIβ-E, and ssRNA-GFP prepared in step (A2) (incubating at 94° C. for 5 min, then slowly cooling to 37° C. for 1 h), and then removing the protein precipitate denatured by high temperature by centrifugation. After purification, shCHSB-A, shCHSB-B, shCHSB-C, shCHSB-D, shCHSB-E, shCOPIβ-A, shCOPIβ-B, shCOPIβ-C, shCOPIβ-D, shCOPIβ-E, and shGFP were obtained, respectively;

[0060] Among them, due to the TCAAGAG stem-loop sequence in the primer design, the initial RNA transcribed can achieve sequence complementary pairing through the annealing step, generate a stem-loop, and form an shRNA structure;

[0061] The shRNA purification steps are as follows:

[0062] (1) Centrifuge the annealed product (12000 rpm, 10 min), retain the supernatant, and remove the protein precipitate.

[0063] (2) Add 0.1 volume of 3M sodium acetate (pH 5.2) and 1 volume of isopropanol to the annealing mixture. Mix well and place on ice for 5 minutes. The reaction mixture will become cloudy at this stage. Centrifuge at maximum speed for 10 minutes.

[0064] (3) A white precipitate should be observed at the bottom of the microcentrifuge tube. Carefully aspirate the supernatant and wash the precipitate with 0.5 ml of cold 70% ethanol. Remove all ethanol after washing. Air-dry the precipitate at room temperature for 15 minutes.

[0065] (4) Resuspend the pellet in nuclease-free water at a volume 2-5 times the original reaction volume and store at -80°C.

[0066] The obtained shRNA was subjected to non-denaturing polyacrylamide gel electrophoresis ( Figure 1 ) to check its size and structural correctness.

[0067] Among them, shCHSB-AF (SEQ ID NO. 1, 5'-3'): GGATCCTAATACGACTCACTATAGGGACGAGTGGTACGAGGTTCAATCA

[0068] shCHSB-AR (SEQ ID NO. 2, 5'-3'): AAGACGAGTGGTACGAGGTTCAACTCTTGATTGAACCTCGTACCACTCGTCC

[0069] shCHSB-BF (SEQ ID NO.3, 5'-3'): GGATCCTAATACGACTCACTATAGGCACTATCAACATGAACTGATATCA

[0070] shCHSB-BR (SEQ ID NO. 4, 5'-3'): AACACTATCAACATGAACTGATACTCT TGATATCAGTTCATGTTGATAGTGCCTATAGT

[0071] shCHSB-C-F(SEQ ID NO.5,5’-3’):GGATCCTAATACGACTCACTATAGGGCCGAGCAGGTCGAAGATGTTTCA

[0072] shCHSB-C-R(SEQ ID NO.6,5’-3’):AAGCCGAGCAGGTCGAAGATGTTCTCTTGAAACATCTTCGACCTGCTCGG

[0073] shCHSB-D-F(SEQ ID NO.7,5’-3’):GGATCCTAATACGACTCACTATAGGCTGGTTGAAGAACTCGTCGAATCA

[0074] shCHSB-D-R(SEQ ID NO.8,5’-3’):AACTGGTTGAAGAACTCGTCGAACTCTTGATTCGACGAGTTCTTCAACCAGC

[0075] shCHSB-E-F(SEQ ID NO.9,5’-3’):GGATCCTAATACGACTCACTATAGGCGCGTCCGACACCGCGCTGTATC

[0076] shCHSB-E-R(SEQ ID NO.10,5’-3’):AACGCGTCCGACACCGCGCTGTACTCTTGATACAGCGCGGTGTCGGAC

[0077] shCOPIβ-A-F(SEQ ID NO.11,5’-3’):GGATCCTAATACGACTCACTATAGGCCCGACTGATTCAGAGCCTTATC

[0078] shCOPIβ-A-R(SEQ ID NO.12,5’-3’):AACCCGACTGATTCAGAGCCTTACTCTTGATAAGGCTCTGAATCAGTCGGGC

[0079] shCOPIβ-B-F(SEQ ID NO.13,5’-3’):GGATCCTAATACGACTCACTATAGGGGTACTCTCGTTACACTGTCTTCA

[0080] shCOPIβ-BR(SEQ ID NO.14,5'-3'):AAGGTACTCTCGTTACACTGTCTCTCTTGAAGACAGTGTAACGAGAGTACCCCTATA

[0081] shCOPIβ-CF(SEQ ID NO.15,5'-3'):GGATCCTAATACGACTCACTATAGGGGCTACTAATCTGCTTGATGATC

[0082] shCOPIβ-CR(SEQ ID NO.16,5'-3'):AAGGCTACTAATCTGCTTGATGACTCTTGATCATCAAGCAGATTAGTAGCCCCTATAG

[0083] shCOPIβ-DF(SEQ ID NO.17,5'-3'):GGATCCTAATACGACTCACTATAGGTTCCACAAACATGAAGTGTTTTCA

[0084] shCOPIβ-DR(SEQ ID NO.18,5'-3'):AATTCCACAAACATGAAGTGTTTCTCTTGAAAACACTTCATGTTTGTGGAACCT

[0085] shCOPIβ-EF(SEQ ID NO.19,5'-3'):GGATCCTAATACGACTCACTATAGGGGTAATCAAATTGCCAGGTATATCA

[0086] shCOPIβ-ER(SEQ ID NO.20,5'-3'): AAGTAATCAAATTGCCAGGTATACTCTTGATATACCTGGCAATTTGATTTACCCTATA

[0087] shGFP-F(SEQ ID NO.21,5'-3'):GGATCCTAATACGACTCACTATAGGAAGGTGATGCTACATACGGAATC

[0088] shGFP-R(SEQ ID NO.22,5'-3'):AAAAGGTGATGCTACATACGGAACTCTTGATTCCGTATGTAGCATCACCTTCCTATA

[0089] The sequence of shCHSB-A (SEQ ID NO. 23, 5'-3') is as follows: GGGACGAGUGGUACGAGGUU CAAUCAAGAGUUGAACCUCGUACCACUCGUCUU

[0090] The sequence of shCHSB-B (SEQ ID NO. 24, 5'-3') is as follows: GGCACUAUCAACAUGAACUG AUAUCAAGAGUAUCAGUUCAUGUUGAUAGUGUU

[0091] The sequence of shCHSB-C (SEQ ID NO. 25, 5'-3') is as follows: GGGCCGAGCAGGUCGAAGAU GUUUCAAGAGAACAUCUUCGACCUGCUCGGCUU

[0092] The sequence of shCHSB-D (SEQ ID NO. 26, 5'-3') is as follows: GGCUGGUUGAAGAACUCGUC GAAUCAAGAGUUCGACGAGUUCUUCAACCAGUU

[0093] The sequence of shCHSB-E (SEQ ID NO. 27, 5'-3') is as follows: GGCGCGUCCGACACCGCGCU GUAUCAAGAGUACAGCGCGGUGUCGGACGCGUU

[0094] The sequence of shCOPIβ-A (SEQ ID NO. 28, 5′-3′) is as follows: GGCCCGACUGAUUCAGAG CCUUAUCAAGAGUAAGGCUCUGAAUCAGUCGGGUU

[0095] The sequence of shCOPIβ-B (SEQ ID NO. 29, 5'-3') is as follows: GGGGUACUCUCGUUACACU GUCUUCAAGAGAGACAGUGUAACGAGAGUACCUU

[0096] The sequence of shCOPIβ-C (SEQ ID NO. 30, 5′-3′) is as follows: GGGGCUACUAAUCUGCUUG AUGAUCAAGAGUCAUCAAGCAGAUUAGUAGCCUU

[0097] The sequence of shCOPIβ-D (SEQ ID NO. 31, 5'-3') is as follows: GGUUCCACAAACAUGAAGUG UUUUCAAGAGAAACACUUCAUGUUUGUGGAAUU

[0098] The sequence of shCOPIβ-E (SEQ ID NO. 32, 5′-3′) is as follows: GGGUAAUCAAAUUGCCAGGU AUAUCAAGAGUAUACCUGGCAAUUUGAUUACUU

[0099] The sequence of shGFP (SEQ ID NO. 33, 5'-3') is as follows: GGAAGGUGAUGCUACAUACGG AAUCAAGAGUUCCGUAUGUAGCAUCACCUUUU

[0100] Example 2

[0101] This embodiment provides a method for preparing CPD ( Figure 2 ), specifically including the following steps:

[0102] (B1) Preparation of monomer M1

[0103] Thioic acid (2.06 g, 10 mmol) and carbonyldiimidazole (1.62 g, 10 mmol) were added to anhydrous dimethylformamide (25 mL), and then stirred under nitrogen protection at room temperature for 2 h to activate the thioctic acid to obtain a mixed solution;

[0104] L-arginine methyl ester dihydrochloride (1.31 g, 5 mmol) and N,N-diisopropylethylamine (0.87 mL, 5 mmol) were added to anhydrous dimethylformamide (20 mL) solution and reacted at room temperature for 1 h. The above mixed solution was then added and stirred at room temperature for 3.5 h to obtain a reaction solution;

[0105] The reaction solution was added to 100 mL of diethyl ether, at which time an oily substance was precipitated. The mixture was centrifuged (2 min, 3000 rpm), the oily substance was collected, and the oily substance was washed three times with a mixed solution of dichloromethane and diethyl ether (the volume ratio of dichloromethane to diethyl ether was 1:2, 15 mL of dichloromethane and 30 mL of diethyl ether were taken each time). After vacuum drying (room temperature, 5 h), a yellow oily monomer was obtained: M1 (Cl salt, 1.5 g, yield 79.6%).

[0106] (B2) Preparation of triethanolamine (TEOA) working solution

[0107] Weigh 14.90 g of TEOA and dissolve it in 80 mL of ultrapure water. Mix thoroughly and add concentrated hydrochloric acid to adjust the pH to 7.0. Finally, add ultrapure water to make the volume 100 mL to obtain a TEOA working solution (1 M, H2O, pH = 7.0), which will serve as the buffer for subsequent monomer polymerization.

[0108] (B3) Preparation of CPD

[0109] Acetylamino-3-mercaptopropionic acid methyl ester solution (concentration of 2 mM, solvent is TEOA working solution) is used as the initiator mother solution, monomer M1 solution (concentration of 1 M, solvent is TEOA working solution), and iodoacetamide stop solution is used as the stop agent mother solution (concentration of 0.5 M, solvent is H2O).

[0110] The solution after nitrogen deoxygenation was mixed in a volume ratio of 1:1:1.5:6.5 of monomer M1 solution: initiator mother liquor: N,N-dimethylformamide: TEOA working solution (total system 10 mL). During polymerization, the reaction was stirred vigorously under nitrogen protection. After 30 minutes of reaction, 20 mL of iodoacetamide termination solution was added to the reaction solution to terminate the reaction. The terminated reaction solution was placed in a dialysis bag with a molecular cutoff of 2000 and then placed in deionized water to dialyze out the unreacted small molecules. The dialysis solution was changed every 4 hours. After dialysis for three days, the reaction solution was frozen at low temperature (-40°C, 8 hours) to a solid, placed in a vacuum freeze dryer (-20°C, 24 hours) and freeze-dried to obtain dry CPD, which was stored at -20°C.

[0111] Example 3

[0112] This example provides a method for preparing shRNA nanocomplexes ( Figure 3 ), specifically including the following steps:

[0113] (C1) Dissolving the CPD prepared in Example 2 in water without nuclease to obtain a CPD solution (2.25 mg / mL);

[0114] (C2) The shRNAs obtained in Example 1 (shCHSB-A, shCHSB-B, shCHSB-C, shCHSB-D, shCHSB-E, shCOPIβ-A, shCOPIβ-B, shCOPIβ-C, shCOPIβ-D, shCOPIβ-E, and shGFP, respectively) were diluted with nuclease-free water to obtain shRNAs (shCHSB-A, shCHSB-B, shCHSB-C, shCHSB-D, shCHSB-E, shCOPIβ-A, shCOPIβ-B, shCOPIβ-C, shCOPIβ-D, shCOPIβ-E, and shGFP, respectively) at a concentration of 375 ng / μL;

[0115] (C3) The shRNA (shCHSB-A, shCHSB-B, shCHSB-C, shCHSB-D, shCHSB-E, shCOPIβ-A, shCOPIβ-B, shCOPIβ-C, shCOPIβ-D, shCOPIβ-E and shGFP) solution prepared in step (C2) was added dropwise to the CPD solution prepared in step (C1), homogenized by ultrasound, and then incubated at 25°C for 15 minutes to obtain shRNA nanocomplexes: shRNA@CPD (shCHSB-A@CPD, shCHSB-B@CPD, shCHSB-C@CPD, shCHSB-D@CPD, shCHSB-E@CPD, shCOPIβ-A@CPD, shCOPIβ-B@CPD, shCOPIβ-C@CPD, shCOPIβ-D@CPD, shCOPIβ-E@CPD and shGFP@CPD).

[0116] Example 4

[0117] This example provides characterization of CPD and shRNA nanocomplexes, as follows:

[0118] (1) H NMR spectroscopy ( 1 H NMR)

[0119] Before testing, the CPD sample (3 mg) prepared in Example 2 was weighed using an analytical electronic balance and placed in a clean 1.5 mL centrifuge tube. 500 μL of heavy water was added to completely dissolve the sample. The solution was aspirated and placed in a quartz NMR tube. The test was performed using a 400 MHz NMR spectrometer, and the hydrogen atom information in the conjugate structure was analyzed using MestReNova software. The results are as follows: Figure 4 shown.

[0120] (2) Gel permeation chromatography (GPC)

[0121] The CPD was dissolved with a magnetic stirrer and the molecular weight of the compound was determined using gel permeation chromatography (GPC, Agilent 1260 Infinity II, USA). The mobile phase consisted of 30% acetonitrile in 0.1 M acetate buffer (pH = 6.5). The injection conditions were 20 μL per injection, a solvent flow rate of 1 mL / min, and a time of 0 to 20 minutes. The chromatographic columns were connected in series, and a differential refractive index detector was used to detect the polymerized sample at an absorbance peak of 214 nm. Monodisperse polyethylene glycol standards (number average molecular weight ranged from 1000 Da to 21800 Da) were used as the control for the test. The results are shown in Figure 2. Figure 5 shown.

[0122] (3) Dynamic light scattering (DLS) and Zeta potential test

[0123] The prepared shRNA nanocomplexes (shRNA@CPD, in this example, the CPD prepared in Example 2 and the shCHSB-E@CPD prepared in Example 3 were used for testing) were tested for nanoparticle size and zeta potential changes, as follows:

[0124] The DLS function in the Malvern particle size analyzer was used to test the particle size range and distribution characteristics of the nanoparticles. Take 1 mL of sample and add it to the analysis sample pool. Place the sample pool in the instrument and set the test conditions. Pre-balance for 3 minutes before the test. After the test is completed, a series of particle size and intensity distribution graphs will be obtained. In order to explore the changes in the Zeta potential of the nanocomplex system before and after combination, the Zeta potential was also tested with the Malvern particle size analyzer. The above sample was added to the conductive cell. The sample should cover the copper sheet of the conductive cell and try to avoid the generation of bubbles to avoid affecting the accuracy of the test results. Each sample was tested 3 times during the test. The results are as follows Figure 6 shown.

[0125] (4) Morphological observation of shRNA complex (shCHSB-E@CPD prepared in Example 3 was used in this example)

[0126] First, the shCHSB-E@CPD nanoparticles were fully dispersed by ultrasound (room temperature, 15 minutes). A clean copper mesh was used as the sample mesh. 10 μL of the solution was dropped onto the copper mesh to form a water droplet. A petri dish was placed on the sample mesh and the sample on the carbon mesh was allowed to dry naturally. The dried sample was then observed using a transmission electron microscope (TEM) to observe the morphology of the composite. The results are shown in Figure 2. Figure 7 shown.

[0127] The above results showed that shCHSB-E and CPD successfully formed a nanocomposite shCHSB-E@CPD.

[0128] Example 5

[0129] This example provides shRNA nanocomplexes (prepared in Example 3) for the control of Spodoptera frugiperda, specifically as follows:

[0130] Fall armyworm eggs were purchased from Jilin Haokang Biotechnology Co., Ltd. Second-instar larvae 2 days after hatching were used as experimental subjects. After starvation for 12 h, the larvae were placed in the presence of shCHSB-A@CPD (subsequently labeled as shCHSB-A group), shCHSB-B@CPD (subsequently labeled as shCHSB-B group), shCHSB-C@CPD (subsequently labeled as shCHSB-C group), shCHSB-D@CPD (subsequently labeled as shCHSB-D group), shCHSB-E@CPD (subsequently labeled as shCHSB-E group), shCOPIβ-A@ Larvae were fed artificial diets (Henan Keyun Biopesticide Co., Ltd.) containing CPD (subsequently labeled as shCOPIβ-A group), shCOPIβ-B@CPD (subsequently labeled as shCOPIβ-B group), shCOPIβ-C@CPD (subsequently labeled as shCOPIβ-C group), shCOPIβ-D@CPD (subsequently labeled as shCOPIβ-D group), or shCOPIβ-E@CPD (subsequently labeled as shCOPIβ-E group). The shRNA nanocomplexes were added at a dose of 40 μL (9 μg shRNA) per gram of artificial diet. Larvae treated with shGFP@CPD (subsequently labeled as shGFP group), CPD (no shRNA, but fed only with an equal amount of CPD delivery vector, subsequently labeled as CPD-treated group), and ddH2O served as negative controls. Each group consisted of 24 larvae. Drug administration was continued from day 2 to 11 of larval development. Larvae were then fed a normal diet on day 12 until pupation. qPCR tests were performed on the 8th and 11th days; length and weight were measured on the 12th day; mortality was detected on the 12th day, and pupation and abnormalities of the insect body were recorded.

[0131] Result analysis:

[0132] (1) qPCR gene silencing effect detection (day 8, day 11):

[0133] On the 8th and 11th day after feeding, three larvae were randomly selected from each group, and total RNA was extracted using the AG RNAex Pro RNA extraction kit (Accurate Biology). cDNA was obtained using the Evo M-MLV reverse transcription premix kit (Accurate Biology). qPCR was then performed to detect the silencing efficiency of the CHSB and COPIβ genes using the actin gene Actin of Spodoptera frugiperda as the internal reference gene. Figure 8As shown in the results, compared with the ddH2O negative control, significant gene silencing effects were observed in the shCHSB-A (63.50%), shCHSB-B (41.33%), shCHSB-C (16.34%), shCHSB-D (44.73%), shCHSB-E (72.37%), shCOPIβ-A (21.47%), shCOPIβ-B (17.10%), shCOPIβ-D (24.33%), and shCOPIβ-E (56.37%) groups (P < 0.05); there was no significant difference between the CPD-treated group and the ddH2O-treated group.

[0134] The statistical results of insect body length and weight are as follows Figure 9 As shown, compared with the ddH2O negative control, the shCHSB-A, shCHSB-B, shCHSB-E and shCOPIβ-E groups reduced the larval body length by 2.24, 2.14, 2.55 and 2.46 mm, respectively (P < 0.05); the shCHSB-A, shCHSB-B, shCHSB-D, shCHSB-E, shCOPIβ-B, shCOPIβ-D and shCOPIβ-E groups reduced the larval body weight by 63.47 mg, 42.58 mg, 28.00 mg, 72.74 mg, 33.14 mg, 59.01 mg and 67.75 mg, respectively (P < 0.05); there was no significant difference in the body length and weight of the larvae in the CPD treatment group compared with the ddH2O treatment group.

[0135] Excluding individuals that died due to human operation, the mortality rate results are as follows Figure 10 As shown in the results, compared with the 4.76% mortality rate of the shGFP group, the 6.35% mortality rate of the CPD group and the 3.17% mortality rate of the ddH2O-treated group, the shCHSB-E, shCOPIβ-A, shCOPIβ-B, shCOPIβ-D and shCOPIβ-E groups showed a significant increase in mortality rate (mortality rates of 44.44%, 19.05%, 34.92%, 26.98% and 34.92%, respectively; P < 0.05), indicating that the downregulation of CHSB and COPIβ gene expression levels caused by shRNA@CPD affected the normal physiological activities of the fall armyworm larvae and led to their death.

[0136] (2) Statistics on pupation and deformity:

[0137] like Figure 11As shown, compared to the 96.75% pupation rate in the ddH2O-treated group, the pupation rates of larvae in the CHSB gene-targeted groups (shCHSB-A, shCHSB-B, and shCHSB-E) were only 65.47%, 69.66%, and 68.25% (P < 0.05). Among the groups targeting the COPIβ gene, the pupation rate in the shCOPIβ-E group was only 82.01% (P < 0.05). Regarding pupal emergence, the shCHSB-A, shCHSB-E, and shCOPIβ-E groups had lower pupal emergence rates (41.16%, 33.61%, and 47.27%, respectively) compared to the 66.22% pupation rate in the ddH2O-treated group (P < 0.05). There were no significant differences in pupation and emergence between the CPD-treated group and the ddH2O-treated group.

[0138] At the same time, during the experiment, abnormal deformities of the insect body occurred, which were mainly manifested as larval or pupal deformities caused by failure to pupate normally, as well as wing deformities of adults after pupation; taking the shCHSB-E@CPD (labeled as "shCHSB-E") and shCOPIβ-E@CPD (labeled as "shCOPIβ-E") groups as examples, their deformities were as follows: Figure 12 As shown (the fall armyworm without any treatment was used as the control group, marked as "Control").

[0139] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the explanations of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A shRNA nanocomplex, characterized in that Including shRNA-related elements and cell-penetrating disulfide polymers; The shRNA-related elements are selected from shRNA, a recombinant vector containing shRNA, and a recombinant cell containing a recombinant shRNA vector; Wherein, the shRNA is selected from one or both of shCHSB and shCOPIβ; The nucleotide sequence of the shCHSB is selected from one of the nucleotide sequences shown in SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.26, and SEQ ID NO.27; the nucleotide sequence of the shCOPIβ is one of the nucleotide sequences shown in SEQ ID NO.28, SEQ ID NO.31, and SEQ ID NO.32; The chemical structure of the cell-penetrating disulfide polymer is shown in formula (I): In formula (I), m is an integer greater than 10.

2. The shRNA nanocomplex according to claim 1, characterized in that The mass ratio of shRNA-related elements to cell-penetrating disulfide polymers is 1:4-8.

3. A method for preparing the shRNA nanocomplex according to any one of claims 1 to 2, characterized in that: The following steps are involved: (S1) dissolving a cell-penetrating disulfide polymer and then mixing to prepare a cell-penetrating disulfide polymer solution; (S2) diluting the shRNA-related elements and adding them dropwise to the cell-penetrating disulfide polymer solution prepared in step (S1), homogenizing by ultrasound and incubating to obtain the shRNA nanocomplex.

4. The method for preparing a shRNA nanocomplex according to claim 3, wherein: In step (S1), the cell-penetrating disulfide polymer is dissolved in nuclease-free water; In step (S1), the concentration of the cell-penetrating disulfide polymer solution is 1000 μg / mL to 3000 μg / mL.

5. The method for preparing a shRNA nanocomplex according to claim 3, wherein: In step (S2), during the incubation process, the temperature is 20 to 45° C. and the time is 10 to 30 minutes.

6. The method for preparing a shRNA nanocomplex according to claim 3, characterized in that: In step (S2), in the shRNA nanocomplex, the concentration of the shRNA-related element was 187.5 μg / mL, and the concentration of the cell-penetrating disulfide polymer was 1125 μg / mL; During the incubation process, the incubation temperature was 25°C and the time was 15 minutes.

7. Use of the shRNA nanocomplex according to any one of claims 1 to 2 in preparing a product for controlling fall armyworm.

8. A method for controlling fall armyworm, characterized in that: The following steps are involved: The shRNA nanocomplex according to any one of claims 1 to 2 is administered so as to be eaten by the Spodoptera frugiperda, or the shRNA nanocomplex according to any one of claims 1 to 2 is introduced into the body of a lepidopteran insect.

9. The method for controlling fall armyworm according to claim 8, characterized in that: The method of administration includes: Applying the drug topically or to the whole plant, or coating the plant seeds, or spreading it through fertilizers, or spreading it through irrigation, or a combination of these application methods; The plant is a grass plant.

10. The method for controlling fall armyworm according to claim 8, characterized in that: The introduction method is feeding, body wall penetration or injection.

Images