Pathogen-targeted engineered exosome as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological materials, and particularly relates to a pathogen-targeted engineered exosome as well as a preparation method and application thereof. The engineered exosome provided by the invention comprises an adipose-derived stromal cell exosome, antibacterial peptide M27-39 and 6 '-sialic acid lactose, and integrates two functions of resisting influenza virus and relieving viral pneumonia, targeted modification of 6'-SL can simulate a host receptor structure, and binding of HA and sialic acid is competitively blocked. After the antibacterial peptide M27-39 carried by the exosome is released in the lung, the direct antiviral effect can be achieved, excessive inflammatory response induced by viruses is inhibited, and meanwhile lung injury caused by influenza virus infection is relieved by promoting alveolar epithelial cell repair and relieving pathological injury of viral pneumonia. Therefore, the engineered exosome provided by the invention can be combined with pathogenic microorganisms in a targeted manner, and has obvious functions of resisting pathogenic microorganisms, resisting inflammation, repairing barriers and intervening the pathological process of infectious lung injury.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a pathogen-targeted engineered exosome and a preparation method and application thereof. Background Art

[0002] Influenza A virus (IAV) is one of the main causes of respiratory diseases. With the change of seasons, influenza virus infection is more common in autumn and winter. The World Health Organization has classified influenza virus infection as a major global health problem. Human influenza A and B viruses can cause serious morbidity and mortality, especially in infants and the elderly, or those with pre-existing diseases or immunodeficiency. Influenza viruses are divided into four types: A, B, C, and D. The influenza viruses that circulate seasonally in the human population are influenza A and B viruses. In the past hundred years, there have been four influenza pandemics worldwide. The most common causes of death from influenza virus infection are severe pneumonia and acute respiratory distress syndrome (ARDS). Influenza viruses, especially influenza A viruses, are seasonal pathogens that cause serious public health problems each year, with 3 to 5 million severe cases and approximately 250,000 to 500,000 deaths worldwide each year.

[0003] Exosomes have emerged as promising therapeutic agents for tissue regeneration. This is primarily due to their intercellular communication capabilities and their rich content of bioactive molecules, including proteins, nucleic acids, and lipids. Exosomes play a crucial role in viral infection, inflammation, and injury of the lungs and respiratory tract, and are also involved in several pathological diseases, including cancer progression and cardiovascular disease. Mesenchymal stem cell-derived exosomes reduce cytokine storms and reverse the suppression of host antiviral defenses associated with COVID-19. They can also enhance mitochondrial function and repair lung damage. For example, AdMSC-Exos can effectively provide mitochondrial components, ensuring macrophage mitochondrial integrity and oxidative phosphorylation levels, leading to the restoration of airway macrophage metabolic and immune homeostasis and alleviating lung inflammatory pathology.

[0004] Many viruses use sialic acid residues as their receptors. For example, hemagglutinin is the primary external protein of respiratory syncytial virus, influenza virus, and rotavirus. This is related to sialic acid on the host surface. The presence of sialic acid allows sialyllactose (SLs) to mimic host membrane receptors, thereby preventing viral hemagglutinin from binding to the host and exerting an antiviral effect. Therefore, focusing on the viral entry mechanism may open the door to the development of compounds with broad-spectrum activity. All influenza viruses use terminal sialic acid (SA) on glycoproteins and glycolipids as cellular receptors. Human influenza viruses bind to α-2,6 sialic acid receptors, while avian influenza viruses prefer to bind to α-2,3 sialic acid receptors. α-2,6 sialic acid receptors are the predominant form found on human respiratory cells. Influenza viruses can invade epithelial cells of the human lower respiratory tract and type II pneumocytes in alveoli and replicate efficiently in isolated lung and tracheal explant cultures and in several mammalian cell lines.

[0005] Therefore, developing a drug that specifically binds to the α-2,6 sialic acid receptor plays an important role in more thorough treatment of influenza virus. Summary of the Invention

[0006] Based on the above, the present invention provides a pathogen-targeted engineered exosome, its preparation method, and application. The engineered exosome M27-39@Ex-6'-SL has anti-inflammatory and antiviral effects and can treat lung damage caused by influenza virus infection.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] A pathogen-targeted engineered exosome comprising drug-loaded exosomes, antimicrobial peptide M27-39, and 6'-sialyllactose.

[0009] 6'-sialyllactose (6'-SL) is a human milk oligosaccharide formed by sialic acid linked to galactose in an α-2,6 fashion. It is a polysaccharide found in breast milk that triggers a variety of chemical reactions or interactions in the body, helping to establish the first line of defense against invading pathogens during infancy. 6'-SL's unique α-2,6-linked sialic acid glycan pattern can mimic host membrane receptors, thereby preventing viral hemagglutinin from binding to the host and exerting an antiviral effect.

[0010] First, the present invention utilizes DSPE-PEG 2KThe hydrophobic segment DSPE of the 6'-SL is inserted into the exosome membrane and then aerosolized and inhaled into the lungs. Due to its unique α-2,6-binding capacity, the 6'-SL mimics the sialic acid receptors of host cells, binding to the influenza virus and mitigating viral infection. Secondly, the short peptide M27-39 exhibits certain antiviral and immunomodulatory effects, alleviating influenza virus-induced inflammation and alleviating lung damage. Exosomes, with their unique biosafety properties and ability to effectively penetrate cell membranes and release their contents intracellularly, have great potential as drug delivery therapies for lung diseases.

[0011] The engineered exosomes provided by the present invention primarily consist of three components: an anti-inflammatory active ingredient, a competitive virus-binding moiety, and an antiviral moiety. The exosomes are the primary active ingredient for anti-inflammatory regulation, while the inserted 6'-SL can competitively bind to influenza viruses. The antiviral moiety is a short peptide, M27-39, that exhibits antiviral effects.

[0012] Preferably, the drug-loaded exosomes are exosomes derived from human adipose-derived mesenchymal stem cells (hADSCs).

[0013] The present invention also provides a method for preparing the engineered exosomes, comprising the following steps:

[0014] S1. Extract and purify exosomes derived from human adipose-derived mesenchymal stem cells (hADSCs);

[0015] S2. Prepare 0.5-1 mg / mL of antimicrobial peptide M27-39 preparative solution and 2-20 μg / mL of DSPE-PEG 2K -6'-SL solution, for later use;

[0016] S3. Loading of active ingredients: The exosomes extracted in step S1 were mixed with the DSPE-PEG2 K -6'-SL solution was mixed with DSPE-PEG 2K -6'-SL was loaded into exosome vesicles, incubated overnight, centrifuged, and the pellet was resuspended to prepare Ex-6'-SL;

[0017] S4. Synthesis of M27-39@Ex-6'-SL: Gently mix the Ex-6'-SL prepared in step S3 and the antimicrobial peptide M27-39 preparative solution in step S2, incubate overnight, remove unbound M27-39 by ultracentrifugation, and resuspend in PBS to obtain the product.

[0018] Preferably, the exosome extraction process in step S1 is: extracting and separating exosomes derived from human adipose-derived mesenchymal stem cells (hADSCs) by high-speed centrifugation.

[0019] Preferably, the preparation process of the antimicrobial peptide M27-39 preparatory solution in step S2 is: adding the antimicrobial peptide M27-39 powder to a sterile PBS solution to prepare a 0.5-1 mg / mL antimicrobial peptide M27-39 preparatory solution.

[0020] Preferably, the DSPE-PEG 2K The preparation process of -6'-SL solution is as follows: DSPE-PEG with purity >95% HPLC 2K -6'-SL powder was added to a certain amount of PBS solution to prepare 2-20 μg / mL DSPE-PEG 2K -6'-SL solution.

[0021] Preferably, the centrifugation in step S3 is performed at a centrifugal force of 100,000 to 150,000 g at 4° C. for 60 to 80 min.

[0022] Preferably, the incubation process in step S4 is overnight incubation at 2-6° C., and the ultracentrifugation is performed at a speed of 100,000-150,000 g for 80-100 min.

[0023] The present invention also provides a use of the engineered exosomes in preparing a drug for treating influenza virus.

[0024] The present invention also provides a drug for treating influenza virus infection, which comprises the engineered exosomes or the engineered exosomes prepared by the method.

[0025] The M27-39@Ex-6'-SL constructed by the present invention is an engineered exosome with multiple functions. By inserting the peptide 6'-SL, it can simulate host cell receptors and reduce influenza virus infection. When the influenza virus infects the body, 6'-SL can bind to the influenza virus and engulf the entire virus. The short peptide M27-39 has an antiviral effect, which can effectively reduce viral titers and inhibit the expression of virus-related genes, thereby reducing the virus's ability to infect. M27-39@Ex-6'-SL, constructed by the combined action of the antimicrobial peptide M27-39, exosomes, and 6'-SL, has the effect of resisting influenza viruses, alleviating lung damage, and improving the condition of influenza virus-infected mice through anti-inflammatory and immune regulation. It also increases the weight and survival rate of virus-infected mice, effectively alleviating and treating various conditions caused by influenza virus infection.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] (1) The present invention provides an engineered exosome M27-39@Ex-6'-SL that effectively inhibits influenza virus adhesion to host cells. The obtained M27-39@Ex-6'-SL engineered exosomes were evaluated for the treatment of influenza virus pneumonia. It was found that the M27-39@Ex-6'-SL engineered exosomes can effectively alleviate lung damage caused by influenza virus, reduce the expression of lung inflammatory factors, and reduce the viral load in lung tissue.

[0028] (2) The present invention provides a method for preparing engineered exosomes M27-39@Ex-6'-SL, which comprises exosomes derived from human adipose-derived mesenchymal stem cells, antimicrobial peptide M27-39, and DSPE-PEG. 2K -6'-SL is the main component to prepare an engineered exosome with anti-influenza virus infection effect, the preparation method is simple and the cost is low.

[0029] (3) The present invention established the M27-39@Ex-6'-SL drug delivery system, which achieved specific intervention in influenza virus-infected lung damage tissue and could directly reach the lesion. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The process of constructing exosomes engineered for M27-39@Ex-6'-SL;

[0031] Figure 2 This is the characterization result diagram of M27-39@Ex-6'-SL;

[0032] Figure 3 This is the drug loading efficiency result of M27-39@Ex-6'-SL engineered exosomes;

[0033] Figure 4 This is the result of the in vitro activity of M27-39@Ex-6'-SL engineered exosomes;

[0034] Figure 5 This is the in vitro antiviral effect of M27-39@Ex-6'-SL engineered exosomes;

[0035] Figure 6 The results of the M27-39@Ex-6'-SL engineered exosome hemagglutination inhibition experiment are shown;

[0036] Figure 7 This is the viral targeting result diagram of M27-39@Ex-6'-SL engineered exosomes;

[0037] Figure 8 This is the result of M27-39@Ex-6'-SL engineered exosomes treating lung injury;

[0038] Figure 9 This is a diagram showing the in vivo anti-inflammatory results of M27-39@Ex-6'-SL engineered exosomes;

[0039] Figure 10 This is a diagram showing the in vivo antiviral results of M27-39@Ex6'-SL engineered exosomes. DETAILED DESCRIPTION

[0040] The present invention will be further explained below with reference to specific examples. However, it should be noted that the following examples are intended only to illustrate the present invention and are not intended to limit the present invention. All technical solutions that are identical or similar to the present invention are within the scope of protection of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available products.

[0041] The human adipose-derived mesenchymal stem cells (hADSCs) were purchased from Huatuo Biotechnology Co., Ltd.

[0042] The human alveolar basal epithelial cell lines A549 and others were purchased from the China Center for Type Culture Collection, Wuhan University;

[0043] The antimicrobial peptide M27-39 was synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0044] The DSPE-PEG2K-6'-SL was synthesized by Xi'an Haoran Biotechnology Co., Ltd.

[0045] Unless otherwise specified, the culture medium is the conventional laboratory culture medium, DMEM and DMEM / F12 culture medium; the fetal bovine serum (FBS) was purchased from Gibco, USA; the female BALB / c mice (18-22 g) were purchased from Guangdong Medical Laboratory Animal Center.

[0046] Example 1 Extraction and purification of exosomes from human adipose-derived mesenchymal stem cells (hADSCs)

[0047] The preparation process of the exosomes is as follows:

[0048] (1) Collection of exosomes: Human adipose-derived mesenchymal stem cells (hADSCs) were cultured in DMEM / F12 complete medium (DMEM / F12:FBS = 9:1). When the cell density reached approximately 70%, the original medium was discarded, the cells were rinsed three times with PBS buffer, and the cells were cultured in serum-free DMEM / F12 medium for another 48 h. The cell supernatant was collected and stored at -80°C for subsequent exosome extraction.

[0049] (2) Extraction of exosomes: The supernatant of the collected cells was extracted by ultracentrifugation. The specific steps are: centrifugation at 300×g for 10 minutes to remove cell debris and take the supernatant; then centrifugation at 2000×g for 10 minutes to remove macromolecular substances and take the supernatant. 4 × g centrifugation for 30 min, take the supernatant, and use a 0.22 μm filter to remove large particles. 5 × g, centrifuged at 4 ° C for 90 min, removed the supernatant, and the remaining precipitate was resuspended in PBS and then resuspended in 10 5 The cells were centrifuged at 4°C for 90 min and then stored at -80°C.

[0050] Preparation of Example 2 Solution

[0051] (1) The preparation of the antimicrobial peptide M27-39 preparatory solution comprises the following steps:

[0052] 5 mg of antimicrobial peptide M27-39 powder was added to 10 mL of sterile PBS solution to prepare a 500 μg / mL antimicrobial peptide M27-39 stock solution for later use.

[0053] (2) The preparation of DSPE-PEG2K-6'-SL solution includes the following steps:

[0054] Add 1 mL of sterile PBS solution to prepare 1 mg / mL DSPE-PEG 2K Accurately pipette 5 μL of DSPE-PEG2K-6'-SL stock solution and add 995 μL of sterile PBS solution to prepare 5 μg / mL DSPE-PEG 2K -6'-SL solution, set aside.

[0055] Example 3 Simulating host sialic acid receptor 6'-SL modification

[0056] The exosomes prepared in Example 1 were mixed with the DSPE-PEG prepared in Example 2. 2K The DSPE-PEG2K-6'-SL solution was mixed in a volume ratio of 1:1, and DSPE-PEG2K-6'-SL was loaded into the exosome vesicles. After incubation at 4°C overnight, the vesicles were incubated for 10 5 × g, ultracentrifuge for 70 min to remove unbound 6'-SL, prepare Ex-6'-SL, and resuspend in PBS.

[0057] Example 4 Construction of M27-39@Ex-6'-SL

[0058] The construction of M27-39@Ex-6'-SL includes the following steps:

[0059] The Ex-6'-SL prepared in Example 3 was mixed with M27-39 in equal volumes and incubated overnight at 4°C in a shaker. 5 The cells were centrifuged at 400 × g for 90 min to remove unbound exosomes and resuspended in PBS to obtain resuspended exosomes, thereby preparing engineered exosomes M27-39@Ex-6'-SL. The schematic diagram of the construction of M27-39@Ex-6'-SL is shown in Figure 1 .

[0060] The constructed M27-39@Ex-6'-SL was imaged using a transmission electron microscope (Hitachi High-Technologies Co., Ltd., model HT7700) to examine the structure and size changes of exosomes, 6'-SL-modified exosomes, and M27-39@Ex-6'-SL. The constructed M27-39@Ex-6'-SL was incubated with Cy3-conjugated elderberry lectin (SNL), a lectin that specifically binds to α-2,6-SA. Fluorescence expression was observed under a confocal microscope to verify the successful construction of Ex-6'-SL. Western blotting confirmed that the exosome surface proteins were not damaged by drug loading before and after loading.

[0061] The experimental results are as follows Figure 2 As shown, Figure 2 As shown in A, the saucer-like structure of the exosomes did not change after drug loading modification, indicating that the exosome structure did not change before and after drug loading, and there was no significant difference in the morphology of the exosomes in each group; Figure 2 As shown in B, the particle size of exosomes after targeted modification and drug loading becomes larger, indicating that the targeted modification and drug-loaded exosomes are successfully constructed; Figure 2 As shown in C, Western Blot results showed that Exo, Ex-6'-SL, and M27-39@Ex-6'-SL expressed exosome-specific marker proteins CD63, TSG101, and HSP70, indicating that exosome surface modification and drug loading did not destroy exosome surface proteins; Figure 2 As shown in D, the expression results showed that the expression of Ex-6'-SL was successfully constructed, and Ex-6'-SL showed red fluorescence under a fluorescence microscope.

[0062] The engineered exosomes M27-39@Ex-6'-SL obtained in Example 4 of the present invention were used for in vitro and in vivo antiviral performance testing and influenza virus lung injury research. The specific experiments are as follows:

[0063] Experimental Example 1 Evaluation of drug loading rate of engineered exosomes

[0064] In order to accurately evaluate the content of antimicrobial peptide M27-39 in exosomes, (combined with Example 4) after drug loading by co-incubation, the supernatant was collected by ultrahigh-speed centrifugation for drug loading rate calculation.

[0065] The encapsulation efficiency of M27-39@Ex-6'-SL was determined by centrifugal precipitation. M27-39 was used as a standard and the concentration gradient was set to 0, 0.05, 0.1, 0.2, 0.4, 0.6, 0.8 and 1 mg / mL. The OD value at 562 nm was measured using a microplate reader, and a standard curve was constructed. 0.2 mg / mL of M27-39 was incubated with Ex-6'-SL prepared in Example 3 overnight. 4 Centrifuge for 30 minutes and collect the supernatant to be used as the exosome-free M27-39. Absorbance was measured using the same concentration of Ex-6'-SL as the negative control. Drug loading was determined using the following formula:

[0066] EE% = (Wtotal - Wfree) / Wtotal × 100%

[0067] Where Wtotal and Wfree represent the weight of total M27-39 and the weight of free unloaded M27-39, respectively.

[0068] The experimental results are as follows Figure 3 As shown, the OD value of the supernatant collected by centrifugation was taken into Figure 3 The weight of free unloaded M27-39 was calculated from the standard curve. The drug loading rate of M27-39 and Ex-6'-SL provided by the present invention was 13.1%, proving that the antimicrobial peptide was successfully loaded into exosomes.

[0069] Experimental Example 2 Evaluation of the activity of engineered exosomes

[0070] RAW246 cells were cultured overnight in DMEM complete medium supplemented with 10% fetal bovine serum (FBS) and 1% double antibody. 5 Each group was added with 100 μg / mL of DMEM complete medium containing 10% fetal bovine serum (FBS) and 1% double antibody at a concentration of 100 μg / mL. DMEM complete medium was used as the negative control (Normal group), and 3 replicates were used for each group. After culturing at 37°C for 24 hours, the culture medium was removed. 20 μL of CCK8 solution at a concentration of 5 mg / mL was added to each well under light-proof conditions and placed in an incubator for further culturing for 2 hours. The absorbance at 490 nm was detected on a microplate reader to calculate cell viability.

[0071] Cell survival rate (%) = (OD experimental group - OD blank group) / (OD positive group - OD blank group) × 100%

[0072] The experimental results are as follows Figure 4 As shown in the figure, M27-39, Exo, Ex-6'-SL and M27-39@Ex-6'-SL had no obvious inhibitory effect on the proliferation of RAW264.7 cells, which indicates that M27-39@Ex-6'-SL has no significant cytotoxicity to RAW246.

[0073] Experimental Example 3 Evaluation of the antiviral effect of engineered exosomes in vitro

[0074] According to 3×10 4 MDCK cells were inoculated into 96-well cell plates at 37°C and 5% CO2 for 24 hours. First, the cells were divided into experimental groups (M27-39, Exo, Ex-6'-SL, M27-39@Ex-6'-SL) and H1N1 groups, with three replicates per group. Two columns of Normal groups (200 μL virus growth medium was added, without virus) were set up in each group as virus-free controls, and cultured for the same time as the other groups. The H1N1 group was inoculated with influenza virus (TCID 50 =10 -6.16 / mL) for 10 -1 -10 -8 Dilute the infected cells and incubate at 37°C for 1 hour to allow the virus to fully adsorb. Gently wash the cells 3 times with pre-cooled PBS to remove unbound virus particles. Add 200 μL of virus growth solution (add 0.25 mL of TPCK-trypsin (stock concentration is 2 mg / mL) to 500 mL of DMEM culture medium to make the final concentration of TPCK-trypsin 1 μg / mL). Continue to culture in a 35°C, 5% CO2 incubator. Observe the cytopathic effect every day. When the cytopathic effect stops developing (usually 72-96 hours), detect the hemagglutination titer (HA) of the virus. Each experimental group was inoculated with influenza virus (TCID) at a concentration of 100 μg / mL. 50 =10 -6.16 After incubation with 5% paraformaldehyde (5% paraformaldehyde) and 1% paraformaldehyde (5% paraformaldehyde) for 30 min (premixed administration), MDCK cells were infected. -1 -10 -8 Dilute, add PBS to each well and wash the cells 2-3 times. Inoculate the diluted virus solution into a 96-well MDCK cell plate, 100 μL per well, repeat 8 wells for each dilution, incubate at 37°C for 1 hour, and shake the cell plate once every 15 minutes. Aspirate the virus solution and add PBS to each well to wash the cells once. Then add 200 μL of virus growth solution to each well, incubate at 35°C, and observe the cell pathological changes every day. When the cell pathological changes stop developing (usually 72-96 hours), the red blood cell agglutination titer (HA) of the virus is detected. According to the Reed-Muench formula, the TCID of the H1N1 virus is calculated. 50 , and calculate the inhibitory effect of each group of drugs on influenza virus.

[0075] Distance ratio = (above 50% infection rate - 50%) / (above 50% infection rate - below 50% infection rate)

[0076] LogTCID 50 = distance ratio × difference between logarithms of dilutions - logarithm of dilution with a lesion rate higher than 50%

[0077] The experimental results are as follows Figure 5 As shown, it can be seen that M27-39, Exo, Ex-6'-SL and M27-39@Ex-6'-SL can all reduce the titer of influenza virus, among which the inhibition rate of M27-39@Ex-6'-SL on influenza virus can be as high as 99.94%.

[0078] Experimental Example 4 Evaluation of the Inhibitory Effect of Engineered Exosomes on Hemagglutination in Vitro

[0079] In a 96-well V-shaped plate, 25 μL of a 100 μg / mL drug group (H1N1, M27-39, Exo, Ex-6'-SL, M27-39@Ex-6'-SL) was added sequentially to columns 3-7. A 25 μL PBS solution was added to column 1 as a negative control (normal). Next, 25 μL of a 4-unit agglutination virus solution was added to columns 1 and 3-7. To allow the virus solution and drug to fully interact, 25 μL of a 1% chicken red blood cell suspension was added to each well. After incubation at room temperature for 30 minutes, red blood cell agglutination was observed and recorded.

[0080] The experimental results are as follows Figure 6 As shown, it can be seen that Ex-6'-SL, M27-39@Ex-6'-SL can prevent some influenza virus hemagglutinin proteins from adsorbing to chicken red blood cells.

[0081] Experimental Example 5 Evaluation of the pathogen targeting effect of engineered exosomes

[0082] The specific test process is as follows:

[0083] 1. Fluorescent drug labeling: Use Cy3 conjugated M27-39@Ex-6'-SL for labeling. After labeling, verify the labeling efficiency using a fluorescence spectrometer to ensure successful labeling.

[0084] 2. Cell co-localization experiment:

[0085] a) Cell preparation: MDCK cells were cultured to a confluency of approximately 80%. After digestion, the cells were centrifuged and resuspended to adjust the cell density to 1 × 10 4500 μL of cell suspension was added to a 3.5 cm confocal culture dish, and the volume was made up to 2 mL with complete DMEM medium. The cells were cultured in a 37°C, 5% CO2 incubator until the cell confluence reached 60-70%.

[0086] b) Virus adsorption: dilute the virus to 100 TCID in serum-free DMEM. 50 (half tissue culture infectious dose). Add 100 μL of 100 TCID to each well. 50 (TCID 50 =10 -6.16 / mL) of virus solution and incubate at 35°C for 1 hour to allow sufficient virus adsorption. After adsorption, the cells were gently washed three times with pre-cooled PBS to remove unbound virus particles. 200 μL of virus growth medium (same as Experimental Example 3) was added and cultured in a 35°C, 5% CO2 incubator for another 24 hours;

[0087] c) Cell fixation and permeabilization: Add 1 mL of 4% paraformaldehyde solution and fix at room temperature for 15 minutes. Discard the paraformaldehyde solution, wash three times with sterile PBS, add 5% BSA, block at room temperature for 0.5 hours, and permeabilize with 0.5% Triton X-100 in PBS for 30 minutes.

[0088] d) Primary antibody incubation: Discard the solution, add primary antibody M2 protein (1:200) and 10 μg Cy3 fluorescently labeled M27-39@Ex-6'-SL, place the culture dish in a humidified chamber, and incubate at 4°C overnight;

[0089] e) Secondary antibody incubation: The secondary antibody used was goat anti-mouse IgG H&L (Alexa 488) (1:600) and incubated at room temperature for 1 hour;

[0090] f) DAPI staining: After incubation, wash three times with PBS. Add 200 μL of DAPI staining solution and incubate at room temperature for 15 minutes. Discard the DAPI staining solution and wash three times with PBS.

[0091] g) Microscope observation: Add 200 μL of sterile PBS and use a fluorescence microscope to observe DAPI (blue), Cy3 (red) and Alexa MDCK cells were observed under the 488 (green) channel, and the co-localization of M27-39@Ex-6'-SL and viral proteins in the cells was photographed and recorded.

[0092] The experimental results are as follows Figure 7, It can be seen therefrom that H1N1 exhibits green fluorescence in the cytoplasm. In the merged image, Cy3-labeled M27-39@Ex-6'-SL aggregates at the site of influenza virus protein expression, indicating that M27-39@Ex-6'-SL can target influenza virus.

[0093] Experimental Example 6 Evaluation of the in vivo lung treatment effect of engineered exosomes

[0094] Fifty-four healthy SPF-grade BALB / C mice were purchased from the Guangdong Provincial Center for Medical Laboratory Animals (Experimental Animal Production License SCXK (Guangdong) 2022-0287) and housed in the Biosafety Level 2 Laboratory of the Institute of Infectious Diseases, Shenzhen Bay Laboratory. The animals were allowed to acclimatize to the laboratory conditions for more than 7 days, including the quarantine period, and were used at 5-6 weeks of age. Relevant animal experiments were carried out strictly in accordance with the Laboratory Animal Management and Use Regulations of Shenzhen Bay Laboratory.

[0095] The mice were anesthetized by inhaling isoflurane using a small animal anesthesia machine. After anesthesia, the mice were randomly divided into six groups: Normal group, H1N1 group, M27-39 group, Ex group, Ex-6'-SL group, and M27-39@Ex-6'-SL group, with 3 mice in each group. 50 μL of PBS was administered to the mice in the Normal group, and 50 μL of TCID 50 with a concentration of 1.0×10 -3 / mL of H1N1 was instilled intranasally to establish the model. After modeling, the mice showed rough hair and piloerection, and slow movement after being infected with influenza virus, indicating successful modeling. On the 2nd day after successful modeling, the M27-39 group, Ex group, Ex-6'-SL group, and M27-39@Ex-6'-SL group were treated by aerosol inhalation with 100 μg of M27-39, Ex, Ex-6'-SL, and M27-39@Ex-6'-SL, respectively; inhalation of PBS in the PBS and H1N1 groups was used as a control. The mice were sacrificed after 5 consecutive days of treatment, and the lung tissues of each group were taken for photography and HE staining.

[0096] The experimental results are as Figure 8 shown. The lung tissues of the mice in the H1N1 group were severely damaged. After treatment with M27-39@Ex-6'-SL, the lung tissue damage of the mice was greatly repaired. HE sections showed that the epithelium of the bronchial wall in the lung tissue of the H1N1 group fell off, the alveolar structure was damaged (such as thickening of the alveolar septum and collapse of the alveolar wall), and a large number of inflammatory cells (lymphocytes, neutrophils) infiltrated the lung interstitium; after treatment with M27-39@Ex-6'-SL, the lung pathological sections showed that the tissue structure was close to normal, with only focal lesions or scattered inflammatory cells.

[0097] Experimental Example 7 Evaluation of the anti-inflammatory effect of engineered exosomes in vivo

[0098] Mice were grouped and nasal drop influenza virus modeled according to the method of Experimental Example 6 above, with 6 mice in each group. Four hours after successful modeling, the Normal group, H1N1 group, M27-39 group, Ex group, Ex-6'-SL group, and M27-39@Ex-6'-SL group were administered by aerosol inhalation. Lung tissue was collected after anesthesia 5 days later for subsequent experiments. Lung tissue homogenate was prepared and IFN-γ, TNF-α, IL-6, and IL-1β were detected using the method described in the instructions of the ELISA kit (purchased from Enzyme Immunity Biotechnology Co., Ltd.) to detect inflammatory factors in lung tissue.

[0099] The experimental results are as follows Figure 9 As shown, compared with the H1N1 group, the inflammatory factors in the lung tissue homogenates of the M27-39 group, Ex group, Ex-6'-SL group, and M27-39@Ex-6'-SL group were reduced, among which M27-39@Ex-6'-SL had the best effect.

[0100] Experimental Example 8 Evaluation of the antiviral effect of engineered exosomes in vivo

[0101] Mice were grouped and the nasal drop influenza virus model was established according to the method of Experimental Example 6 above. Two days after successful modeling, the Normal, H1N1, M27-39, Ex, Ex-6'-SL, and M27-39@Ex-6'-SL groups were administered with nebulized inhalation. Five days later, lung tissue was collected after anesthesia for subsequent experiments. Lung tissue was ground until there were no large solids. The grinding tube was centrifuged at 5000×g for 15 minutes. 150μL of supernatant was collected from each group, tissue RNA was extracted, and reverse transcribed into cDNA. Quantitative qRT-PCR was performed using the cDNA as a template to determine the NP and M2-related pathogenic genes of influenza virus lung tissue viruses.

[0102] M2-F:CAAGTGATCCTCTCGTCATTGC;

[0103] M2-R:ACTCTGCTGTTCCTGTTGATATTCT;

[0104] NP-F:GCCATAAGGACCAGGAGTG;

[0105] NP-R:GCTGAATGCTGCCATAACG;

[0106] β-actin-F: TCCATCATGAAGTGTGACGT;

[0107] β-actin-R:GAGCAATGATTCTTGATCTTCA.

[0108] The experimental results are as follows Figure 10 As shown, compared with the H1N1 group, the pathogen-related genes in the lung tissue homogenates of the M27-39 group, Ex group, Ex-6'-SL group, and M27-39@Ex-6'-SL group were reduced, among which M27-39@Ex-6'-SL had the best effect.

[0109] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the present invention. Anyone skilled in the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by one of ordinary skill in the art without departing from the spirit and technical principles disclosed herein are intended to be covered by the claims of the present invention.

Claims

1. A pathogen-targeted engineered exosome, characterized in that: Including drug-loaded exosomes, antimicrobial peptide M27-39, and 6'-sialyllactose.

2. The engineered exosome according to claim 1, wherein The drug-loaded exosomes are exosomes derived from human adipose-derived mesenchymal stem cells (hADSCs).

3. A method for preparing the engineered exosomes according to any one of claims 1-2, characterized in that: The steps include: S1. Extract and purify exosomes derived from human adipose-derived mesenchymal stem cells (hADSCs); S2. Prepare 0.5-1 mg / mL of antimicrobial peptide M27-39 preparative solution and 2-20 μg / mL of DSPE-PEG 2K -6'-SL solution, for later use; S3. Loading of active ingredients: The exosomes extracted in step S1 are loaded with DSPE-PEG in step S2. 2K -6'-SL solution was mixed, DSPE-PEG2K-6'-SL was loaded into exosome vesicles, incubated overnight, centrifuged, and the precipitate was resuspended to prepare Ex-6'-SL; S4. Synthesis of M27-39@Ex-6'-SL: Gently mix the Ex-6'-SL prepared in step S3 and the antimicrobial peptide M27-39 preparative solution in step S2, incubate overnight, remove unbound M27-39 by ultracentrifugation, and resuspend in PBS to obtain the product.

4. The preparation method according to claim 3, wherein The exosome extraction process described in step S1 is: using high-speed centrifugation to extract and separate exosomes derived from human adipose-derived mesenchymal stem cells (hADSCs).

5. The preparation method according to claim 3, wherein The preparation process of the antimicrobial peptide M27-39 preparatory solution in step S2 is as follows: adding the antimicrobial peptide M27-39 powder to a sterile PBS solution to prepare a 0.5-1 mg / mL antimicrobial peptide M27-39 preparatory solution.

6. The preparation method according to claim 3, wherein The DSPE-PEG 2K The preparation process of -6'-SL solution is as follows: DSPE-PEG with purity >95% HPLC 2K -6'-SL powder was added to a certain amount of PBS solution to prepare 2-20 μg / mL DSPE-PEG 2K -6'-SL solution.

7. The preparation method according to claim 3, wherein The centrifugation in step S3 is performed at a centrifugal force of 100,000 to 150,000 g at 4° C. for 60 to 80 minutes.

8. The preparation method according to claim 3, wherein The incubation process in step S4 is performed at 2-6° C. overnight, and the ultracentrifugation is performed at a speed of 100,000-150,000 g for 80-100 min.

9. Use of the engineered exosomes according to any one of claims 1 to 2 in the preparation of a drug for treating influenza virus.

10. A drug for treating influenza virus infection, characterized in that: The drug comprises the engineered exosomes according to any one of claims 1-2 or the engineered exosomes prepared by the method according to any one of claims 3-8.

Images