A siRNA for preventing, ameliorating and / or treating Alzheimer's disease and use thereof

By designing siRNA targeting EGFR, TNC, CRYAB, BAG3, and HSPB1 genes and using recombinant nucleic acid molecules and small extracellular vesicles (sEVs) for targeted delivery, the problems of limited efficacy and insufficient delivery efficiency in the treatment of Alzheimer's disease have been solved, and precise treatment of highly expressed AD genes has been achieved.

CN120478386BActive Publication Date: 2025-10-17NANJING UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510993745.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-18
Publication Date
2025-10-17
Estimated Expiration
2045-07-18

AI Technical Summary

Technical Problem

Existing Alzheimer's disease treatments have limited efficacy and adverse reactions, and RNAi therapies using traditional delivery systems have difficulty penetrating the blood-brain barrier, resulting in insufficient targeted delivery efficiency.

Method used

siRNA targeting EGFR, TNC, CRYAB, BAG3, and HSPB1 genes was designed, combined with recombinant nucleic acid molecules and small extracellular vesicles (sEVs) as delivery vectors, and rabies virus glycoprotein peptide (RVG) was used to penetrate the blood-brain barrier. Targeted delivery was achieved through the exosome-specific marker protein CD63 to achieve precise treatment of Alzheimer's disease.

Benefits of technology

Significantly knocking down highly expressed AD genes improves the therapeutic effect of Alzheimer's disease, avoids the limitations of traditional delivery systems, and achieves efficient targeted prevention and treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120478386B_ABST
    Figure CN120478386B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biotechnology, in particular to a siRNA for preventing, improving and / or treating Alzheimer's disease and use thereof. The present application provides a siRNA for preventing, improving and / or treating Alzheimer's disease, which comprises a siRNA designed according to at least one of EGFR gene, TNC gene, CRYAB gene, BAG3 gene and HSPB1 gene; the siRNA comprises a sense strand and an antisense strand, and the sense strand and the antisense strand are at least partially reverse complementary to form a double-stranded region; the present application finds that knocking down the above target genes can be used for preventing, improving and / or treating Alzheimer's disease.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a siRNA for preventing, improving and / or treating Alzheimer's disease and use thereof. BACKGROUND

[0002] Alzheimer's disease (AD), as the most common neurodegenerative disease, accounts for 60-80% of all neurodegenerative disease cases, and has become a major public health problem faced by the global aging society. The disease is characterized by gradually worsening cognitive dysfunction and memory impairment, and its pathological mechanism is complex, involving the interaction of multiple factors. The main factors include: (1) abnormal deposition of β-amyloid protein (Aβ), forming senile plaques; (2) tau protein hyperphosphorylation, leading to neurofibrillary tangles; (3) selective neuronal loss, accompanied by synaptic dysfunction. It is particularly noteworthy that astrocytes play a key role in the pathological process of AD; on the one hand, they can clear extracellular Aβ, and dynamically regulate glutamate circulation and metabolism through calcium signaling to support the stability of the nervous system; on the other hand, when they are pathologically activated, the expression of their glial fibrillary acidic protein (GFAP) increases significantly, which is spatially co-localized with Aβ plaque formation, and will accelerate the loss of dendritic spines in the hippocampus.

[0003] Currently, the treatment strategies for Alzheimer's disease (AD) are mainly divided into two categories: first, in the symptomatic treatment, cholinesterase inhibitors (such as donepezil) and NMDA receptor antagonists (such as memantine) can improve symptoms in the short term, but their efficacy is limited (cognitive scores are only increased by about 3-5 points), and they can cause adverse reactions in the central nervous system or periphery (such as the incidence of dizziness is about 17-24%). Second, in the field of disease modification therapy (DMTs), targeted monoclonal antibodies against β-amyloid protein (Aβ) (such as aducanumab, lanabeceport) have obtained the accelerated approval of FDA, but the results of clinical trials show that they can only slow down 27-35% of cognitive decline, and are associated with a high incidence of amyloid-related imaging abnormalities edema (ARIA-E) of up to 41%. As for targeted therapy for tau protein, such as antisense oligonucleotide BIIB080, it is currently in the phase II clinical trial stage, and its efficacy and safety are still being further verified.

[0004] Given the limitations of existing therapies, gene silencing technology based on RNA interference (RNAi) offers new hope for the treatment of Alzheimer's disease (AD). RNAi is a conserved gene silencing mechanism mediated by small interfering RNA (siRNA) and dependent on molecular components such as the Dicer enzyme and the RNA-induced silencing complex (RISC). It precisely regulates gene expression through sequence-specific degradation of target mRNAs or translational inhibition. Because RNAi can theoretically silence any gene, it holds great promise in disease treatment, particularly in modulating the expression of pathogenic genes associated with AD. However, naked siRNA is susceptible to degradation by serum nucleases and has difficulty penetrating the blood-brain barrier (BBB). Consequently, the clinical translation of RNAi therapies is highly dependent on the optimization of delivery vectors. While traditional delivery systems (such as lipid nanoparticles, cationic polymers, and viral vectors) have been extensively explored, they still face limitations such as low biocompatibility, short circulation half-lives, and insufficient targeted delivery efficiency. Therefore, it is crucial to develop siRNA that can be effectively delivered into the neural center and knock down AD highly expressed genes to achieve targeted prevention and treatment of AD. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to provide an siRNA for preventing, improving and / or treating Alzheimer's disease and its use, wherein the siRNA can be delivered into the neural center and knock down AD highly expressed genes, thereby achieving targeted prevention and treatment of AD.

[0006] To this end, the present invention provides the following technical solutions:

[0007] An embodiment of the present invention provides an siRNA for preventing, improving and / or treating Alzheimer's disease, including an siRNA designed based on at least one of the EGFR gene, TNC gene, CRYAB gene, BAG3 gene, and HSPB1 gene; the siRNA includes a sense chain and an antisense chain, and the sense chain and the antisense chain are at least partially reverse-complemented to form a double-stranded region.

[0008] In some embodiments, the siRNA for preventing, improving and / or treating Alzheimer's disease comprises at least one of the following:

[0009] The siRNA targeting the EGFR gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 1, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or above identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 7, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or above identity and the same function thereof;

[0010] The siRNA targeting the TNC gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 2, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or above identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 8, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or above identity and the same function thereof;

[0011] The siRNA targeting the CRYAB gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 3, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or above identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 9, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or above identity and the same function thereof;

[0012] The siRNA targeting the BAG3 gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 4, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or above identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 10, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or above identity and the same function thereof;

[0013] The siRNA targeting the HSPB1 gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO. 5, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or more identity thereto and having the same function; the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 11, or a sequence with 80%, 83%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or more identity thereto and having the same function.

[0014] The recombinant nucleic acid molecule comprises an shRNA; the shRNA comprises the sense strand and the antisense strand of the siRNA; the sense strand and the antisense strand are separated by a stem-loop sequence to form a hairpin structure.

[0015] In some embodiments, the recombinant nucleic acid molecule further comprises a promoter, a gene fragment encoding a targeting peptide, and / or a gene fragment encoding a functional protein of an exosome-specific marker protein.

[0016] In some embodiments, the targeting peptide is selected from the group consisting of rabies virus glycoprotein (RVG), amyloid precursor-like protein 2 peptide (APLP-2), apolipoprotein (APOE), brain-targeting peptide (Angiopep-2), and / or cell-penetrating peptide (CPP);

[0017] And / or, the exosome-specific marker protein is selected from at least one of CD9, CD63, CD81, and PTGFRN;

[0018] And / or, the promoter is selected from the group consisting of cytomegalovirus promoter (CMV promoter), transthyretin binding globulin promoter (TBG promoter), and / or a promoter specifically used to drive gene expression in astrocytes (GfaABC1D promoter).

[0019] The recombinant plasmid expresses the siRNA; or the recombinant plasmid comprises the recombinant nucleic acid molecule. The initial plasmid vector of the recombinant plasmid includes but is not limited to pcDNA6.2 plasmid, pLKO.1 plasmid, PGEM-3zf plasmid, PUC19 plasmid, and / or PUC57 plasmid.

[0020] The engineered cell has the genome integrated with the siRNA; or the genome of the engineered cell is integrated with the recombinant nucleic acid molecule; or the engineered cell comprises the recombinant plasmid.

[0021] The embodiment of the present application provides a small extracellular vesicle, wherein the siRNA is wrapped in the small extracellular vesicle, or the recombinant nucleic acid molecule is wrapped in the small extracellular vesicle, or the recombinant plasmid is wrapped in the small extracellular vesicle, or the small extracellular vesicle is secreted by the engineered cell.

[0022] The embodiment of the present application provides application of the siRNA, the recombinant nucleic acid molecule, the recombinant plasmid, the engineered cell or the small extracellular vesicle in preparation of a drug for preventing, improving and / or treating Alzheimer's disease.

[0023] The embodiment of the present application provides a drug for preventing, improving and / or treating Alzheimer's disease, which comprises an active ingredient; the active ingredient comprises the siRNA, the recombinant nucleic acid molecule, the recombinant plasmid, the engineered cell or the small extracellular vesicle.

[0024] The technical scheme of the present application has the following advantages:

[0025] 1. The siRNA for preventing, improving and / or treating Alzheimer's disease provided by the present application comprises siRNA designed according to at least one of EGFR genes, TNC genes, CRYAB genes, BAG3 genes and HSPB1 genes; the siRNA comprises a sense strand and an antisense strand, and the sense strand and the antisense strand are at least partially reverse complementary to form a double-stranded region; the present application finds that knocking down the target genes can be used for preventing, improving and / or treating Alzheimer's disease.

[0026] 2. The siRNA for preventing, improving and / or treating Alzheimer's disease, comprising at least one of: siRNA targeting EGFR gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 1, or a sequence with more than 80% identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 7, or a sequence with more than 80% identity and the same function thereof; siRNA targeting TNC gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 2, or a sequence with more than 80% identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 8, or a sequence with more than 80% identity and the same function thereof; siRNA targeting CRYAB gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 3, or a sequence with more than 80% identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 9, or a sequence with more than 80% identity and the same function thereof; siRNA targeting BAG3 gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 4, or a sequence with more than 80% identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 10, or a sequence with more than 80% identity and the same function thereof; siRNA targeting HSPB1 gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO. 5, or a sequence with more than 80% identity and the same function thereof; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 11, or a sequence with more than 80% identity and the same function thereof; the present application found that the above designed siRNA has high inhibitory activity on the corresponding EGFR gene, TNC gene, CRYAB gene, BAG3 gene and HSPB1 gene, and can be used for preparing drugs for preventing, improving and / or treating Alzheimer's disease.

[0027] 3. The present invention provides a recombinant nucleic acid molecule, comprising shRNA; the shRNA comprises the sense strand and antisense strand of the siRNA; the sense strand and antisense strand are separated by a stem-loop sequence to form a hairpin structure; the recombinant nucleic acid molecule further comprises a promoter, a gene fragment encoding a targeting peptide, and / or a gene fragment encoding a functional protein of an exosome-specific marker protein; the present invention utilizes synthetic biology methods to fuse a targeting peptide capable of penetrating the blood-brain barrier, such as a rabies virus glycoprotein peptide (RVG), with the N-terminus of an exosome-specific marker protein, such as CD63, and concatenate the siRNA gene to obtain a gene loop, which is then injected intravenously into the body, utilizing the body's own liver as a biological reaction base to produce small extracellular vesicles (sEVs) encapsulating therapeutic siRNA, thereby achieving precise delivery of RNAi drugs for Alzheimer's disease and multi-target combined treatment.

[0028] 4. The present invention provides a small extracellular vesicle (sEV) encapsulating the siRNA, or the recombinant nucleic acid molecule, or the recombinant plasmid, or secreted by the engineered cells. Small extracellular vesicles (sEVs), as endogenous delivery vehicles (30-150 nm in diameter), have become a research hotspot for novel drug delivery platforms due to their natural bilayer lipid structure, low immunogenicity, and ability to deliver drugs across the BBB. sEVs participate in intercellular communication by carrying nucleic acids and proteins derived from parent cells. Their surface membrane proteins can inhibit clearance by the mononuclear phagocytic system, significantly prolonging circulation time in vivo. The present invention uses sEVs to deliver siRNAs targeting highly expressed Alzheimer's disease genes. The sEV-encapsulated therapeutic siRNAs exhibit significant inhibitory effects on Alzheimer's disease target genes, effectively preventing, ameliorating, and / or treating Alzheimer's disease. They also effectively avoid the challenges associated with using exogenous cell-derived extracellular vesicles for delivery, such as complex technical procedures, high costs, and the presence of endotoxins. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0030] Figure 1 This is the test result of the relevant siRNA in Example 1 of the present invention in reducing the expression of the target gene in vitro;

[0031] Figure 2 is a CMV-RVG-siR containing 5 siRNAs in tandem in the embodiment 2 of the present application EGFR+TNC+CRYAB+BAG3+HSPB1 the map of the recombinant plasmid (referred to as CMV-RVG-siRNA);

[0032] Figure 3 is a gene circuit containing 5 siRNAs in tandem and its reaction schematic in the liver in the embodiment 2 of the present application; wherein A is a gene circuit containing 5 siRNAs in tandem, and B is a reaction schematic of the gene circuit in the liver;

[0033] Figure 4 is the result of knocking down the relative level of mRNA of EGFR, TNC, CRYAB, BAG3 and HSPB1 in each group in the embodiment 2 of the present application;

[0034] Figure 5 is the schematic diagram of the novel object recognition method and the Morris water maze detection method of each group in the embodiment 3 of the present application; wherein A is the schematic diagram of the novel object recognition method; and B is the schematic diagram of the Morris water maze detection method;

[0035] Figure 6 is the detection result of the Morris water maze detection method of each group in the embodiment 3 of the present application, wherein A is the detection result of the escape time of each group; B is the detection result of the total distance of each group; C is the detection result of the number of times of crossing the platform of each group on the 6th day; D is the detection result of the time length of staying in the target quadrant of each group on the 6th day; and E is the route detection result of each group in the quadrant;

[0036] Figure 7 is the detection result of the novel object recognition method of each group in the embodiment 3 of the present application; wherein A is the detection result of the discrimination index of each group; and B is the detection result of the exploration time length of the new and old objects of each group. DETAILED DESCRIPTION

[0037] The following examples are provided to better further understand the present application, and are not limited to the best mode, and do not constitute a limitation on the content and protection scope of the present application. Any person under the inspiration of the present application or the combination of the present application with other prior art features can obtain any product same or similar to the present application, which falls within the protection scope of the present application.

[0038] The specific experimental steps or conditions not mentioned in the examples can be performed according to the conventional experimental steps described in the literature in the art or the operation or conditions. The reagents or instruments not mentioned by the manufacturer are conventional reagent products that can be obtained by market purchase.

[0039] Example 1

[0040] The present embodiment provides screening of therapeutic targets for Alzheimer's disease, comprising the following steps:

[0041] 1. siRNA design

[0042] According to the siRNA of the gene encoding the receptor tyrosine kinase (EGFR gene), the siRNA of the gene encoding the extracellular matrix glycoprotein (TNC gene), the siRNA of the gene encoding the small heat shock protein family member (CRYAB gene), the siRNA of the gene encoding Bcl-2 associated anti-apoptotic gene 3 (BAG3 gene), and the coding region sequence of the gene encoding heat shock protein 27 (HSPB1 gene), the siRNA targeting EGFR gene, TNC gene, CRYAB gene, BAG3 gene and HSPB1 gene is designed (see Table 1 for details), and the siRNA is as follows:

[0043] The siRNA targeting the EGFR gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO. 1, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 7;

[0044] The siRNA targeting the TNC gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO. 2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 8;

[0045] The siRNA targeting the CRYAB gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO. 3, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 9;

[0046] The siRNA targeting the BAG3 gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO. 4, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 10;

[0047] The siRNA targeting the HSPB1 gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO. 5, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 11;

[0048] Table 1, siRNA and its sequence

[0049]

[0050] 2. Screening

[0051] 5 μL of transfection reagent lipo2000 (purchased from Sigma) was mixed with 100 μL of Opti-MEM (purchased from Sigma) and allowed to stand for 5 min to obtain mixture A; each strand of different siRNA in Table 1 was diluted to a concentration of 100 pmol with 100 μL of Opti-MEM and allowed to stand for 5 min to obtain mixture B; mixture A (volume 105 μL) and mixture B (volume 105 μL) were gently mixed and allowed to stand for 20 min to obtain transfection solution containing different siRNA;

[0052] The mouse astrocyte C8D1A cells (purchased from the Chinese Academy of Sciences Cell Bank) were inoculated into a 6-well plate at a seeding amount of 1 x 10 6 The cells were observed on the second day, and when the cells were about 70% confluent, a blank control group (mock), a negative control group (siNC), and an experimental group siRNA (siR5 × were set up in the 6-well plate, with 3 replicate wells for each group.

[0053] After the setup, the transfection solution containing different siRNA (volume 210 μL) was added to the wells of the experimental group, the transfection solution containing siNC (nucleotide sequence of siNC is shown in Table 1 SEQ ID NO. 6 and SEQ ID NO. 12) was added to the wells of the negative control group at the same volume, and the transfection solution without siRNA was added to the wells of the blank control group at the same volume. The cells were cultured in a 5% (v / v) CO2, 37°C cell incubator for 6 h for transfection. After 6 h of transfection, the old cell culture medium was discarded, 2 mL of new DMEM containing 10% (v / v) fetal bovine serum was added to each well of the 6-well plate, and the cells were cultured in a 5% (v / v) CO2, 37°C cell incubator for 24 h for transfection.

[0054] After 24h transfection, cell lysate (purchased from Sigma) was added to the 6-well plate at an addition of 500ul per well, fully lysed and moved to a 1.5ml EP tube, and chloroform was added at an addition of 100ul per tube, vortexed vigorously, placed on ice for 5min, and centrifuged at 12000rpm, 4°C for 15min; after centrifugation, the supernatant was taken, and an equal volume of isopropanol (about 400ul) was added, mixed well by inverting, and placed in a -20 refrigerator overnight. The next day, centrifuge at 12000rpm, 4°C for 15min; after centrifugation, discard the supernatant, add 1ml of freshly prepared 75% (v / v) ethanol to resuspend the precipitate, centrifuge at 12000rpm, 4°C for 10min; after centrifugation, the precipitate was taken to obtain mRNA. The extracted mRNA was used as the sample to be tested, and the expression of target gene in cells after different siRNA interference was detected by qPCR to verify the interference efficiency of the designed siRNA. Data processing: all experiments in this study were repeated at least three times independently. All significant analyses were processed by GraphPad Prism 8.0 software, and the data were presented as mean ± SEMs, and the difference analysis was compared by t-tests, : P < 0.05, statistically significant difference; : P < 0.01, significant difference; : P < 0.001, very significant difference. When meeting normal distribution, Two-way ANOVA (Multiple comparisons) was used for analysis.

[0055] The verification results are shown in Figure 1 , in which NC is the negative control group, and MOCK is the blank control group. As can be seen from the figure, the mRNA level of the experimental group is knocked down to about 50%, and it can be concluded that the siRNA targeting EGFR gene, TNC gene, CRYAB gene, BAG3 gene and HSPB1 gene designed in this embodiment can reduce the expression of target gene, which can be used for treating Alzheimer's disease.

[0056] The specific steps of qPCR are as follows:

[0057] (1) Extract RNA:

[0058] a) After washing the cells with 1xPBS, add 1ml of RNA extraction lysate;

[0059] b) Lysate in ice for 30min, shake vigorously every 10min;

[0060] c) To remove cell residues, centrifuge the sample at 4°C, 12000xg for 10min, and transfer the liquid;

[0061] d) Add 200 μL chloroform, shake vigorously, and let stand on ice for about 5 minutes to allow the layers to separate;

[0062] e) Centrifuge the sample at 12000 x g at 4°C for 15 minutes. Be careful not to disturb the liquid when removing the sample. Slowly pipette the supernatant, about 500 μL;

[0063] f) Add 500 μL isopropanol, mix slowly, and let stand in a -20°C refrigerator for 3 hours. If the amount of RNA is small, you can choose to stand overnight. If the amount of RNA is large, you can also choose to stand at room temperature for 10 minutes;

[0064] g) After standing, centrifuge the sample at 12000 x g at 4°C for 20 minutes. A white RNA precipitate can be seen;

[0065] h) During centrifugation, prepare 75% ethanol with RNase-free water. After centrifugation, slowly tilt the tube to pour out the liquid, making sure that the RNA precipitate does not flow out with the liquid. Add 1 mL of 75% ethanol and invert the tube to wash the precipitate. Centrifuge the sample at 12000 x g at 4°C for 10 minutes;

[0066] i) After centrifugation, slowly tilt the tube to pour out the liquid and perform a short centrifugation. Use a pipette to remove the excess liquid. Invert the tube and air dry the precipitate;

[0067] j) Add an appropriate amount of RNase-free water to dissolve the precipitate. To prevent incomplete dissolution of the precipitate, let it stand on ice for 30 minutes to 1 hour;

[0068] k) Before measuring the RNA concentration, vortex the sample and perform a short centrifugation. The A260 / 280 should be around 2.0.

[0069] (2) Reverse transcription

[0070] Add the reagents to the 200 μL enzyme-free centrifuge tube according to the reaction system in Table 2. After vortexing, place the tube in a PCR instrument to obtain cDNA (see Table 2 for the specific reverse transcription reaction program).

[0071] Table 2 Reverse transcription reaction system and reaction program

[0072]

[0073] After mixing, place the tube in a PCR instrument for reverse transcription reaction.

[0074] (3) Real time PCR

[0075] The 18S was used as an internal reference for quantitative detection by SYBR Green method. The qRT-PCR reaction system was prepared according to the qRT-PCR system shown in Table 3 and added to a 200 μL enzyme-free centrifuge tube, the qPCR primers are shown in Table 4, vortexed and centrifuged, and then added to a 96-well plate (the specific qPCR reaction program is shown in Table 3).

[0076] Table 3, qPCR reaction system and reaction program

[0077]

[0078] Mix the above system, and put it into an LC480 fluorescence quantitative PCR instrument for PCR reaction.

[0079] Table 4, qPCR primers

[0080]

[0081] Example 2 Influence of self-assembled exosome sEV-siRNA on mRNA in vitro

[0082] (1) Construction of recombinant plasmid CMV-RVG-siR EGFR+TNC+CRYAB+BAG3+HSPB1

[0083] The specific method steps are as follows:

[0084] According to the siRNA targeting the EGFR gene with the nucleotide sequence of the sense strand shown in SEQ ID NO. 1 and the nucleotide sequence of the antisense strand shown in SEQ ID NO. 7, an shRNA was designed and named siEGFR, and the nucleotide sequence of the shRNA was: 5'-TGTGGCTTCTCTTAACTCCTGTTTTGGCCACTGACTGACAGGAGTTAAGAGAAGCCACA- 3' (see SEQ ID NO. 25);

[0085] According to the siRNA targeting the TNC gene with the nucleotide sequence of the sense strand shown in SEQ ID NO. 2 and the nucleotide sequence of the antisense strand shown in SEQ ID NO. 8, an shRNA was designed and named siTNC, and the nucleotide sequence of the shRNA was: 5'-CCAGCAACTTCCGAAATCTGTTTTGGCCACTGACTGACAGATTTCGGAAGTTGCTGG-3' (see SEQ ID NO. 26);

[0086] ​The siRNA targeting CRYAB gene according to the nucleotide sequence of the sense strand as shown in SEQ ID NO. 3 and the nucleotide sequence of the antisense strand as shown in SEQ ID NO. 9, the shRNA is designed and named as siCRYAB, and the nucleotide sequence of the shRNA is: 5'-GGAACTCAAAGTCAAGGTTCTGTTTTGGCCACTGACTGACAGAACCTTGACTTTGAGTTCC-3' (see SEQ ID NO. 27);

[0087] The siRNA targeting BAG3 gene according to the nucleotide sequence of the sense strand as shown in SEQ ID NO. 4 and the nucleotide sequence of the antisense strand as shown in SEQ ID NO. 10, the shRNA is designed and named as siBAG3, and the nucleotide sequence of the shRNA is: 5'CCTAAGGACACTGCATCTTCAGTTTTGGCCACTGACTGACTGAAGATGCAGTGTCCTTAGG-3' (see SEQ ID NO. 28);

[0088] The siRNA targeting HSPB1 gene according to the nucleotide sequence of the sense strand as shown in SEQ ID NO. 5 and the nucleotide sequence of the antisense strand as shown in SEQ ID NO. 11, the shRNA is designed and named as siHSPB1, and the nucleotide sequence of the shRNA is: 5'GATCACCATTCCGGTTACTTTGTTTTGGCCACTGACTGACAAAGTAACCGGAATGGTGATC-3' (see SEQ ID NO. 29);

[0089] The siRNA targeting HSPB1 gene according to the nucleotide sequence of the sense strand as shown in SEQ ID NO. 6 and the nucleotide sequence of the antisense strand as shown in SEQ ID NO. 12, the shRNA is designed and named as siNC, and the nucleotide sequence of the shRNA is: 5'CAGTCAGGAGGATCCAAAGTGGTTTTGGCCACTGACTGACCTCTTTGGTTCCTCCTGTCTG-3' (see SEQ ID NO. 30);

[0090] The promoter CMV, the gene encoding the peptide targeting peptide rabies virus glycoprotein peptide segment (RVG), the gene encoding the exosome-specific marker protein CD63, siREGFR, siRTNC, siRCRYAB, siRBAG3, siRHSPB are sequentially connected in series, and the obtained recombinant nucleic acid molecule is named as a multi-target gene loop, as shown in A of Figure 3 The reaction schematic diagram of the gene loop in the liver is shown in B of Figure 3 .

[0091] The recombinant nucleic acid molecule was inserted into the plasmid vector pcDNA6.2. The specific method was as follows: the multi-target gene loop and the pcDNA6.2 plasmid vector (purchased from Shanghai Jima Co., Ltd.) were double-enzymed by BamHI and XhoI (purchased from Thermo Fisher Scientific) (see Table 5 for the enzyme digestion system, 37°C for 30 minutes and then inactivated at 85°C for 5 minutes). After the enzyme digestion reaction was completed, the product was electrophoresed and run on a gel, and the target fragment was recovered from the gel to obtain the double-enzyme-digested vector and the inserted fragment; T4 17 The double-digested vector and insert were ligated using DNA ligase and T4 DNA ligase buffer (purchased from Takara) (see Table 6 for the ligation system, incubated at 16°C for 14 h) to obtain a ligation product. The ligation product was transformed into Escherichia coli competent cells DH5α (purchased from Qingke Biotechnology) to obtain a transformation product. The transformation product was streaked onto LB agar plates (formula: 5 g / L yeast, 10 g / L peptone, 10 g / L sodium chloride, and 18 g / L agar powder) containing 50 μg / mL ampicillin (Amp), incubated at 37°C for 12 h, and a single colony was picked. The single colony was inoculated into 3 mL of LB liquid medium (formula: 5 g / L yeast, 10 g / L peptone, and 10 g / L sodium chloride) containing 50 μg / mL spectinomycin and incubated at 37°C for 14 h to obtain a bacterial solution. The recombinant plasmid in the bacterial solution was extracted and purified for sequencing. The recombinant plasmid was obtained if sequencing was successful.

[0092] The final recombinant plasmid CMV-RVG-siR EGFR+TNC+CRYAB+BAG3+HSPB1 The map of (abbreviated as CMV-RVG-siRNA) is as follows Figure 2 As shown, the nucleotide sequence of the recombinant plasmid CMV-RVG-siRNA is shown in SEQ ID NO.31.

[0093] Table 5 Enzyme digestion system

[0094]

[0095] Table 6 Connection system

[0096]

[0097] (2) Effects of self-assembled sEV-siRNA on mRNA in vitro

[0098] The control empty plasmid and the recombinant plasmid CMV-RVG-siRNA were injected into the tail veins of 6-week-old C57BL / 6J male mice (purchased from the Jisui Yakang) at a dose of 10 mg (recombinant plasmid or empty plasmid content) / kg (mouse body weight) (solvent: 200 μL of PBS buffer), twice a day, for a total of four injections. Six hours after the last injection, the mouse plasma was obtained by enucleation, and the exosomes were extracted from the mouse plasma. The exosomes were sEV-siRNA produced by the self-assembly of the multi-target gene circuit in the mouse body. The exosomes of the recombinant plasmid CMV-RVG-siRNA were sEV-siRNA 5× The exosomes of the control empty plasmid were sEV-scrR.

[0099] Further, the above-obtained exosomes were co-incubated with C8D1A cells. The specific incubation method was as follows: C8D1A cells were inoculated into a 6-well plate at a seeding amount of 1×10 6 μL of 2% (v / v) fetal bovine serum-containing high-glucose medium was added to the well containing the cultured C8D1A cells, and co-incubation was performed in a 5% (v / v) CO2, 37°C cell incubator. At the same time, a PBS group was set up, and 100 μL of PBS buffer was used instead of the exosomes. After incubation, the cell RNA was extracted 24 hours later to detect the expression amount of mRNA, and the specific method was as follows:

[0100] A. Add 1 ml of RNA extraction lysis solution to the cell suspension;

[0101] B. Lyse on ice for 45 minutes, and shake vigorously every 15 minutes;

[0102] C. To remove cell residues, centrifuge the sample at 4°C, 12000×g for 10 minutes, and transfer the liquid;

[0103] D. Add 200 μL of chloroform, shake vigorously, and stand on ice for stratification for about 5 minutes;

[0104] E. Centrifuge the sample at 4°C, 12000×g for 15 minutes. When taking out, do not shake the liquid, and slowly suck the upper liquid, with a volume of about 600 μL;

[0105] F, Add 600 μL of isopropyl alcohol, mix slowly, and then place in a -20°C refrigerator for 3 hours. If the amount of RNA is small, you can choose to stand overnight. If the amount of RNA is large, you can also choose to stand at room temperature for 10 minutes.

[0106] G, After standing, centrifuge the sample at 4°C and 12000 x g for 20 minutes. You can see white RNA precipitate.

[0107] H, During centrifugation, prepare 75% ethanol with RNase-free water. After centrifugation, slowly tilt and pour out the liquid to ensure that the RNA precipitate does not flow out with the liquid. Add 1 mL of 75% ethanol and invert the precipitate. Centrifuge the sample at 4°C and 12000 x g for 10 minutes.

[0108] I, After centrifugation, slowly tilt and pour out the liquid, and perform a short centrifugation. Use a pipette to remove excess liquid, and invert the centrifuge tube to dry the precipitate.

[0109] J, Add an appropriate amount of RNase-free water to dissolve the precipitate. To prevent incomplete dissolution of the precipitate, you can place it on ice for 30 minutes to 1 hour.

[0110] K, Before measuring the RNA concentration, vortex the sample and perform a short centrifugation. The concentration should be around 1000 ng / μL, and A260 / 280 should be around 2.0.

[0111] Reverse transcription

[0112] The reverse transcription of mRNA obtained cDNA, and then do q-PCR (system see Table 2, Table 3).

[0113] Data processing method: All experiments in this study were repeated at least three times independently. All significant analyses were processed by GraphPad Prism 8.0 software, and the data were presented as mean ± SEMs, and the difference analysis was compared by t-tests, : P < 0.05, statistically significant difference; : P < 0.01, significant difference; : P < 0.001, very significant difference. When the normal distribution is met, Two-way ANOVA (Multiple comparisons) is used for analysis.

[0114] The results are: Figure 4 Compared with the control empty plasmid, the sEV-siRNA obtained by the recombinant plasmid CMV-RVG-siRNA can significantly knock down the mRNA expression of EGFR, TNC, CRYAB, BAG3, and HSPB1. 5×

[0115] ​Example 3 Therapeutic effect of self-assembled exosome sEV-siRNA in Alzheimer's disease model mice in vivo

[0116] The 8-month-old APP / PS1 male mice (Alzheimer's disease model mice, purchased from Jiangsu Jizhu Pharmaceutical Kang) were injected with CMV-RVG-siRNA through the tail vein. EGFR+TNC+CRYAB+BAG3+HSPB1 The plasmid (experimental group, CMV-RVG-siRNA prepared in Example 2) and negative control group (CMV-RVG-siNC plasmid was prepared according to the method of Example 2), 10 mg / kg (mouse weight) twice a day. After one month, behavioral experiments (new object recognition and Morris water maze test) were performed. A blank control group was set up, which was 8-month-old wild-type C57BL / 6J male mice. 15 mice in each group.

[0117] New object recognition method (as Figure 5 Figure A in the middle): Stage 1: Habituation; the animal was placed alone in an empty experimental box and freely explored for 5-10 minutes. Once a day for 2-3 consecutive days. Stage 2: Training / Familiarization; two identical objects (A1 and A2) were placed symmetrically in the box. The animal was placed in and freely explored for 5 minutes. The total exploration time was recorded. Stage 3: Test; after 2 hours, one of the familiar objects was replaced with a new object B (A2 was placed at the original A1 position, and B was placed at the A2 position). The same animal was placed in and freely explored for 5 minutes again. The time of exploring the new object (B) and the familiar object (A2) was recorded. Nose tip distance to the object ≤ 2 cm and facing the object were recorded as exploration.

[0118] Recognition index (RI) in data analysis: discrimination index = (exploration time of new object - exploration time of familiar object) / (exploration time of new object + exploration time of familiar object) x 100%; normal memory: RI > 50% (significant preference for new objects).

[0119] Memory impairment: RI ≈ 50% (random exploration).

[0120] Morris water maze test method (as Figure 5Middle Panel B): Stage 1: Place navigation test. The experiment began with mice placed in a pool (with a platform visible above the water surface) and allowed to swim freely for 2 minutes to familiarize them with the maze. The experiment lasted for 5 days, with four training sessions scheduled daily for the next four days. At the beginning of training, the platform was placed in the north-west quadrant. Mice were placed into the pool facing the wall from any of four starting points on the pool wall. A free video recording system recorded the time it took the mice to find the platform (escape latency) and their swimming path. During the four training sessions, mice were placed in the water from four different starting points (in different quadrants). If the mice found the platform or failed to find it within 60 seconds (latency was counted as 60 seconds), the experimenter would place them on the platform and let them rest on it for 15 seconds before the next trial. The average latency of the four training sessions was used as the daily result. Phase 2: Spatial probe test: On the 6th day, the original platform was removed and the mice were placed into the water at any water entry point. All mice must enter the water at the same entry point, and the number of times the mice crossed the original platform within 11 minutes was recorded.

[0121] Data processing methods: Inter-group comparison: T test or one-way analysis of variance (ANOVA). Intra-group comparison: paired T test. indicates, p < 0.05 compared with the negative control group (siNC); Indicates, p < 0.01 compared with the negative control group (siNC).

[0122] The results are as follows Figure 6 As shown, Figure 6 A to E in the middle are the results of Morris water maze test. The experimental group was siR 5× The negative control group is siNC, and the blank control group is Control. It can be seen that siNC and siR 5× The escape time and total distance of the Alzheimer's disease model mice in the group were higher than those of the healthy mice in the blank control group, but the siNC and siR 5× Comparison between groups, siR 5× The siNC group was lower than that of the siNC group, and the siNC and siR 5× The number of times the mice crossed the platform and the time they stayed in the target quadrant on the 6th day in the group were lower than those in the blank control group. However, the siNC and siR 5× Comparison between groups, siR 5× The expression of siR in the siNC group was significantly higher than that in the siNC group (P < 0.01). 5× The group could be used to treat Alzheimer's disease. Figure 7 A and B show the detection results of the new object recognition method. It can be seen that the experimental group siR 5×It can significantly improve the discrimination index and the exploration time of new objects. In summary, the experimental group siR 5× Can treat Alzheimer's disease, the CMV-RVG-siR of the present invention EGFR+TNC+CRYAB+BAG3+HSPB1 The plasmid can undergo gene looping in the animal body and self-assemble to produce exosome sEV-siRNA, achieving precise delivery and multi-target combined treatment of Alzheimer's disease RNAi drugs, which can effectively improve Alzheimer's disease in mice.

[0123] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A recombinant nucleic acid molecule, characterized in that The recombinant nucleic acid molecule comprises shRNA; the shRNA comprises siRNA targeting the EGFR gene, siRNA targeting the TNC gene, siRNA targeting the CRYAB gene, siRNA targeting the BAG3 gene, and siRNA targeting the HSPB1 gene, which are sequentially connected in series; the siRNA comprises a sense strand and an antisense strand; the sense strand and the antisense strand are separated by a stem-loop sequence to form a hairpin structure; in: The siRNA targeting the EGFR gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO.1; the nucleotide sequence of the antisense strand is shown in SEQ ID NO.7; The siRNA targeting the TNC gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO. 2; the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 8; The siRNA targeting the CRYAB gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO.3; the nucleotide sequence of the antisense strand is shown in SEQ ID NO.9; The siRNA targeting the BAG3 gene: the nucleotide sequence of the sense strand is shown in SEQ ID NO.4; the nucleotide sequence of the antisense strand is shown in SEQ ID NO.10; The siRNA targeting the HSPB1 gene: the nucleotide sequence of the sense strand is shown as SEQ ID NO.5; the nucleotide sequence of the antisense strand is shown as SEQ ID NO.

11.

2. The recombinant nucleic acid molecule according to claim 1, characterized in that The recombinant nucleic acid molecule further comprises a promoter, a gene segment encoding a targeting peptide and / or a gene segment encoding a functional protein of an exosome-specific marker protein.

3. The recombinant nucleic acid molecule according to claim 2, characterized in that The targeting peptide is selected from rabies virus glycoprotein, amyloid precursor-like protein 2 peptide, apolipoprotein, brain targeting peptide and / or cell penetrating peptide; And / or, the exosome-specific marker protein is selected from at least one of CD9, CD63, CD81, and PTGFRN; And / or, the promoter is selected from a cytomegalovirus promoter, a thyroxine-binding globulin promoter and / or a promoter specifically used to drive gene expression specifically in astrocytes.

4. A recombinant plasmid, characterized in that The recombinant plasmid comprises the recombinant nucleic acid molecule according to any one of claims 1 to 3.

5. An engineered cell, characterized in that The genome of the engineered cell is integrated with the recombinant nucleic acid molecule according to any one of claims 1 to 3; or, the engineered cell contains the recombinant plasmid according to claim 4.

6. A small extracellular vesicle, characterized in that The small extracellular vesicles encapsulate the recombinant nucleic acid molecule according to any one of claims 1 to 3; or, the small extracellular vesicles encapsulate the recombinant plasmid according to claim 4; or, the small extracellular vesicles are secreted by the engineered cells according to claim 5.

7. Use of the recombinant nucleic acid molecule according to any one of claims 1 to 3, the recombinant plasmid according to claim 4, the engineered cell according to claim 5, or the small extracellular vesicle according to claim 6 in the preparation of a medicament for preventing, ameliorating and / or treating Alzheimer's disease.

8. A drug for preventing, improving and / or treating Alzheimer's disease, characterized in that: Comprising an active ingredient; the active ingredient includes the recombinant nucleic acid molecule according to any one of claims 1 to 3, the recombinant plasmid according to claim 4, the engineered cell according to claim 5, or the small extracellular vesicle according to claim 6.

Citation Information

Patent Citations

  • Quality control of BAG3 and proteins in brain

    CN119255814A

  • Bag 3 methods and uses for treatment of cardiac amyloidosis

    WO2024059756A1