Antibody and antibody pair for resisting human tumor necrosis factor receptor 1 and application

By designing high specificity and high affinity antibody pairs, the problem of insufficient specificity of existing antibodies is solved, and efficient and sensitive detection of human TNFR1 protein is achieved, which is suitable for scientific research and disease diagnosis.

CN120484118APending Publication Date: 2025-08-15WUHAN AIBO TAIKE BIOTECH CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510551917.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The existing anti-human tumor necrosis factor receptor 1 antibodies are not specific and/or lack of reliability, resulting in reduced detection specificity and sensitivity, especially in dual-anti-sandwich ELISA.

Method used

Two high-specific and high-affinity antibodies and their combination of antibody pairs are provided to construct a dual-anti-sandwich enzyme-linked immunosorbent assay system. Through the design of specific CDR amino acid sequences, it can achieve efficient and sensitive detection of human TNFR1 protein.

Benefits of technology

It has achieved high specificity and affinity recognition for human TNFR1 protein, and can build a dual-anti-sandwich ELISA detection system, with high sensitivity and wide linear range, and is suitable for scientific research and disease diagnosis, especially reliable detection of trace TNFR1 protein.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120484118A_ABST
    Figure CN120484118A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of antibodies, and particularly relates to an anti-human tumor necrosis factor receptor 1 antibody and application of an antibody pair. The antibody is a first antibody or a second antibody, amino acid sequences of light chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.3-5, and amino acid sequences of heavy chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.8-10; the amino acid sequences of light chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.13-15, and the amino acid sequences of heavy chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.18-20. The two antibodies have high specificity and affinity to the human TNFR1 protein, and can be used as paired antibodies to construct a double-antibody sandwich ELISA method, so that efficient, sensitive and reliable detection of the TNFR1 protein, especially trace level TNFR1 protein, is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of antibody technology, and particularly to antibodies and antibody pairs against human tumor necrosis factor receptor 1 and their applications. Background Technology

[0002] Tumor necrosis factor receptor 1 (TNFR1), also known as TNFRSF1A, CD120a, or p55, is a key receptor molecule in the tumor necrosis factor (TNF) signaling pathway. It belongs to the tumor necrosis factor receptor superfamily (TNFRSF) and has a molecular weight of approximately 55 kDa. It is a type I transmembrane glycoprotein composed of three functional domains: an extracellular domain, a transmembrane domain, and an intracellular domain. The extracellular domain contains four cysteine-rich domains (CRD1-4), which are key regions for TNFR1 to bind to TNF-α and determine the specificity of its ligand recognition. The intracellular domain contains the death domain (DD), which is a core element for activating downstream apoptosis signaling pathways. The structural features of TNFR1 enable it to precisely recognize and bind to its main ligand, TNF-α, thereby triggering a series of complex signal transduction cascades involving NF-κB, MAPKs, and apoptosis signaling pathways. Through the activation of these pathways, TNFR1 can regulate various biological processes such as inflammation, apoptosis, immune regulation, and tumorigenesis, making it a core node in the cell signal transduction network. TNF-α exists in two forms: soluble (sTNF-α) and transmembrane (tmTNF-α). sTNF-α primarily triggers inflammatory and apoptotic signals by binding to TNFR1, while tmTNF-α further enhances signal transduction efficiency by stabilizing receptor aggregation.

[0003] A growing body of research indicates that TNFR1 is widely involved in the pathophysiological processes of various diseases. In inflammatory diseases, such as autoimmune diseases, overactivation of TNFR1 is closely related to the exacerbation of inflammatory responses and cell death, and is a significant factor leading to disease progression. TNFR1 is also closely related to tumorigenesis and development, determining different cell fates in different cancer cells, thus exhibiting a dual role. On the one hand, it can activate pro-survival pathways such as NF-κB, inhibiting tumor cell apoptosis and promoting tumor growth; for example, in lung cancer, overexpression of TNFR1 is closely related to cell dedifferentiation, epithelial-mesenchymal transition (EMT), and tumor metastasis in squamous cell carcinoma, all of which contribute to malignant tumor progression. On the other hand, TNFR1 can also trigger apoptosis, inhibiting tumor development. Therefore, TNFR1 is of great significance in cancer treatment, requiring targeted intervention based on specific cancer types and microenvironments. Detecting changes in TNFR1 expression levels in patient samples can provide a basis for personalized treatment of diseases associated with abnormal TNFR1 expression.

[0004] Currently, enzyme-linked immunosorbent assay (ELISA) is widely used for the detection of antigenic proteins in biological samples such as serum, plasma, urine, tissue lysates, and cell culture media. However, commercially available anti-human TNFR1 antibodies suffer from low specificity and / or insufficient reliability. Furthermore, in double-antibody sandwich ELISA, the overlap of antigen-binding sites between the primary and secondary antibodies leads to reduced detection specificity and sensitivity, making it impossible to effectively monitor low concentrations of TNFR1 protein in pathological samples. Therefore, developing novel, high-performance anti-TNFR1 antibodies suitable for immunological analysis, especially for double-antibody sandwich ELISA, is of great significance. Summary of the Invention

[0005] To address the problems of low specificity and / or insufficient reliability of existing anti-human tumor necrosis factor receptor 1 antibodies, leading to reduced detection specificity and sensitivity, this invention provides two antibodies with high specificity and affinity for human TNFR1 protein and antibody pairs thereof, and provides the application of the aforementioned antibodies or antibody pairs in the efficient, sensitive, and reliable detection of human TNFR1 protein, especially at trace levels. To achieve this objective, this invention is implemented through the following technical solutions:

[0006] The first aspect of this invention provides an antibody against human tumor necrosis factor receptor 1, which is a first antibody or a second antibody, wherein: the amino acid sequences of the complementarity-determining regions (CDRs) 1-3 on the light chain variable region of the first antibody are shown in SEQ ID NO. 3-5, and the amino acid sequences of the complementarity-determining regions (CDRs) 1-3 on the heavy chain variable region are shown in SEQ ID NO. 8-10; the amino acid sequences of the complementarity-determining regions (CDRs) 1-3 on the light chain variable region of the second antibody are shown in SEQ ID NO. 13-15, and the amino acid sequences of the complementarity-determining regions (CDRs) 1-3 on the heavy chain variable region are shown in SEQ ID NO. 18-20.

[0007] Further, the amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.17.

[0008] Further, the amino acid sequence of the first antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; the amino acid sequence of the second antibody light chain is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.16.

[0009] Further, the first antibody and / or the second antibody are full-length antibodies or antigen-binding regions of the full-length antibody; the antigen-binding region is selected from at least one of the Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment, and sc(Fv)2 fragment.

[0010] A second aspect of the present invention provides a nucleic acid molecule or a recombinant vector, the recombinant vector containing the nucleic acid molecule, the nucleic acid molecule encoding a first antibody or a second antibody as described above.

[0011] Furthermore, the nucleic acid sequence of the light chain variable region of the first antibody is as shown in SEQ ID NO.22 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.24 or its complementary sequence; the nucleic acid sequence of the light chain variable region of the second antibody is as shown in SEQ ID NO.26 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.28 or its complementary sequence.

[0012] Further, the nucleic acid sequence of the first antibody light chain is as shown in SEQ ID NO.21 or is complementary to it, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or is complementary to it; the nucleic acid sequence of the second antibody light chain is as shown in SEQ ID NO.25 or is complementary to it, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or is complementary to it.

[0013] A third aspect of the present invention provides an antibody pair against human tumor necrosis factor receptor 1, comprising a first antibody and a second antibody as described above.

[0014] The fourth aspect of the present invention provides the use of the antibody or antibody pair against human tumor necrosis factor receptor 1 as described above in the preparation of a human tumor necrosis factor receptor 1 detection kit.

[0015] The fifth aspect of the present invention provides a human tumor necrosis factor receptor 1 detection kit, the detection kit comprising an antibody or antibody pair against human tumor necrosis factor receptor 1 as described above.

[0016] Furthermore, the detection kit is a double-antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is conjugated with a detection marker.

[0017] The present invention has the following beneficial effects:

[0018] The antibody of this invention exhibits high specificity and affinity for human TNFR1 protein, with an affinity constant in the range of 0.1 nM. It recognizes and binds to different epitopes of TNFR1 protein and can be used as a paired antibody to construct a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system for quantitative detection of human TNFR1 protein. It has the advantages of no cross-reactivity with homologous proteins, a wide linear detection range, and high sensitivity, enabling reliable detection of trace amounts of TNFR1 protein. It has important application value in scientific research targeting TNFR1 protein and in the early diagnosis, disease monitoring, and prognostic assessment of related diseases. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The vector map used to construct the monoclonal antibody expression vector in Example 1 of this invention, from left to right, is the pBR322 vector map carrying the light chain constant region and the heavy chain constant region;

[0021] Figure 2 This is an affinity curve of the monoclonal antibody binding to human tumor necrosis factor receptor 1 in Example 2 of the present invention;

[0022] Figure 3 This is a graph showing the recognition of the antigenic epitope of human tumor necrosis factor receptor 1 by the monoclonal antibody in Example 2 of the present invention.

[0023] Figure 4 This is the standard curve for detecting human tumor necrosis factor receptor 1 using a double-antibody sandwich enzyme-linked immunosorbent assay system based on monoclonal antibodies 5H7 and 5C12, as described in Example 3 of this invention.

[0024] Figure 5 The specific detection results of human tumor necrosis factor receptor 1 using the double-antibody sandwich enzyme-linked immunosorbent assay system based on monoclonal antibodies 5H7 and 5C12 established in Example 4 of the present invention are shown.

[0025] Figure 6 The results of the thermostability detection of human tumor necrosis factor receptor 1 using a double-antibody sandwich enzyme-linked immunosorbent assay system based on monoclonal antibodies 5H7 and 5C12, as described in Example 5 of this invention, are shown. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0027] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0028] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0029] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.

[0030] The terms “including,” “contains,” “includes,” “has,” and similar words are non-restrictive and can include other steps and other components that do not affect the result.

[0031] The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0032] The terms “first”, “second”, etc., are used to distinguish similar objects, not necessarily to describe a specific order or sequence. It should be understood that such usage can be interchanged where appropriate.

[0033] The terms "rabbit monoclonal antibody," "monoclonal antibody," "rabbit-derived antibody," and "rabbit monoclonal antibody," etc., have the same meaning. Unless otherwise specified, they all refer to rabbit-derived antibodies that specifically bind to human tumor necrosis factor receptor 1. The modifier "rabbit" indicates that the antibody's complementarity-determining region (CDR) is derived from a rabbit immunoglobulin sequence. The terms "tumor necrosis factor receptor 1," "TNFR1," "p55," and "CD120a," etc., have the same meaning and can be used interchangeably.

[0034] An antibody is an immunoglobulin molecule that specifically binds to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In this invention, the term "antibody" is to be interpreted in the broadest sense and includes various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, provided they exhibit the desired antigen-binding activity. An antibody fragment may be one or more portions or fragments of a full-length antibody, retaining the antibody's ability to specifically bind to a target antigen.

[0035] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be classified into two types: κ chains and λ chains; heavy chains can be classified into five types: μ, δ, γ, α, and ε chains, with antibodies defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of both the heavy and light chains vary considerably, while the amino acid sequences of other parts are relatively constant. The regions with significant amino acid sequence variation near the N-terminus in both the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable region, also known as the complementarity-determining region (CDR), is a ring structure. Heavy chain CDRs and light chain CDRs are tightly joined together by the FR region and cooperate to form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the antibody's specificity and serving as the site for antibody recognition and antigen binding. The FR regions are the more conserved parts of the VH and VL, generally exhibiting a β-sheet configuration, linked by three CDRs forming a connecting loop. Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0036] CDRs and FRs can be identified according to Kabat definitions, Chothia definitions, the sum of Kabat and Chothia definitions, AbM definitions, contact definitions, IMGT unique numbering definitions and / or conformational definitions, or any CDR determination method known in the art. As used in this invention, they are defined by the Kabat numbering system.

[0037] The light chain constant region (CL) and heavy chain constant region (CH) do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as participating in antibody-dependent cell-mediated cytotoxicity (ADCC). The CL lengths of different Ig types (κ or λ) are generally consistent, but the CH lengths differ among Ig classes. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well-known in the art and can be obtained by searching the IMGT database.

[0038] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-type molecular structure. Therefore, in the context of this invention, "full-length antibody," "complete antibody," and "Y-type antibody" have the same meaning and can be used interchangeably.

[0039] An antibody fragment is one or more portions or segments of a full-length antibody that substantially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR region as the full-length antibody, and more preferably the same variable region, thereby retaining complete antigen recognition and binding sites, enabling it to bind to the same antigens, especially the same epitopes, as the full-length antibody. Typical examples of antibody fragments include Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2, which can be obtained using conventional techniques in the art.

[0040] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable and constant regions) and a portion of a heavy chain (variable and first constant region). Fragments such as Fab, F(ab')2, and Fab' can be obtained by protease cleavage of a full-length antibody. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab possesses an antigen-binding region and a portion of a constant region, it not only has antibody-antigen affinity and excellent tissue penetration like scFv, but also has a more stable structure.

[0041] (ii)F(ab)2: Contains a bivalent segment consisting of two Fabs connected by a disulfide bridge in the hinge region.

[0042] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment. It contains only the variable region and consists of a variable region of one light chain and one heavy chain. It is a non-covalently bound dimer of VH and VL (VH-VL dimer). The three CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind antigens, although the affinity is lower than that of the intact antibody.

[0043] (iv)(Fv)2: Consists of two Fv segments covalently linked together.

[0044] (v)scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) linked by a flexible linker (typically composed of 10-25 amino acids). It retains the original antibody's specificity for binding to the antigen. The linker in this invention is not particularly limited as long as it does not interfere with the expression of the antibody variable regions linked to its two ends. Compared to full-length antibodies, scFv has a smaller molecular weight, thus exhibiting higher penetration and lower immune side effects.

[0045] The (vi)sc(Fv)2 segment is formed by connecting two heavy chain variable regions and two light chain variable regions through a joint, etc.

[0046] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a complementarity-determining region (CDR) and a framework region (FR) derived from a rabbit immunoglobulin sequence. In other embodiments, the antibody may contain amino acid residues encoded by a non-rabbit immunoglobulin sequence, such as humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection response while maintaining the desired specificity and affinity. The term "chimeric antibody" refers to an antibody in which a portion is derived from a specific source or species, while the remainder is derived from a different source or species. The term "humanized antibody" is a chimeric antibody containing the CDR region of a non-human antibody, such as a rabbit antibody, and a region derived from a human FR. In some cases, the variable region of a non-human antibody binds to the constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR region of a non-human antibody binds to both the FR and constant regions derived from a human antibody sequence, i.e., the CDR region of a non-human antibody is grafted onto a human antibody framework (FR) sequence derived from the FR sequence of one or more other human antibody variable regions. In this invention, the CDR region in the chimeric antibody or humanized antibody is derived from the rabbit CDR region.

[0047] The terms "monoclonal antibody" or similar terms are used interchangeably and refer to a homogeneous group of antibodies, meaning that the individual antibodies constituting the group are identical except for a small number of naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation). A "monoclonal antibody" is highly specific, exhibiting a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous group of antibodies and should not be interpreted as limiting the source or method of preparation of the antibody. This antibody can be prepared by a variety of methods, including but not limited to hybridoma, phage display, yeast display, recombinant DNA, single-cell screening, or single-cell sequencing.

[0048] The term “specific binding” is a well-known term in the art. A molecule exhibits “specific binding” if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity for a particular target antigen or epitope than it reacts with other target antigens or epitopes. “Specific binding”, or “preferred binding”, does not necessarily require (although may include) exclusive binding.

[0049] To make the above-mentioned objectives and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0050] This invention provides an antibody against human tumor necrosis factor receptor 1, which is either a first antibody or a second antibody. The antibody includes a light chain variable region and a heavy chain variable region. Both the light chain variable region and the heavy chain variable region include three complementarity-determining regions (CDRs), named CDR1, CDR2, and CDR3, respectively. Specifically: the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NO. 13, SEQ ID NO. 14, and SEQ ID NO. 15, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO. 18, SEQ ID NO. 19, and SEQ ID NO. 20, respectively.

[0051] The two high-affinity and highly specific antibodies against human tumor necrosis factor receptor 1 (TNFR1) provided by this invention have affinity constants for human TNFR1 protein in the 0.1 nM range and recognize and bind to different epitopes of the TNFR1 protein. They can be used as paired antibodies to construct a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system. Using one antibody as the capture antibody and the other, labeled with biotin, as the detection antibody, quantification of human TNFR1 protein is achieved. This method offers advantages such as high specificity, no cross-reactivity with homologous proteins, a wide linear detection range, and high antigen recognition sensitivity. The detection limit can be as low as 1.82 pg / mL, which is beneficial for the reliable detection of TNFR1 protein, especially at trace levels. This invention provides high-performance antibodies and antibody pairs, as well as detection systems and kits, for the detection of TNFR1 protein content based on immunological analysis techniques. It has significant application value in scientific research targeting TNFR1 protein and in the early diagnosis, disease monitoring, and prognostic assessment of related diseases.

[0052] Optionally, both the light chain variable region and the heavy chain variable region include four frame regions (FRs), which are arranged in an alternating sequence with three core parameters (CDRs) to form the variable region. The amino acid sequence of the first antibody light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7. The amino acid sequence of the second antibody light chain variable region is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.17.

[0053] Optionally, the antibody of the present invention further includes a light chain constant region (CL) and a heavy chain constant region (CH), where CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant regions of the antibody are typically obtained by querying the IMGT online database.

[0054] Optionally, the amino acid sequence of the first antibody light chain (FL) is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.6. The amino acid sequence of the second antibody light chain (FL) is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.16.

[0055] It should be noted that the antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or the antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length antibody. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining an intact antigen recognition and binding site, capable of binding to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antigen-binding regions can be obtained using conventional techniques in the art.

[0056] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the aforementioned nucleic acid molecule, or a host cell containing the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes a first antibody and / or a second antibody as described above.

[0057] Nucleic acid molecules can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand. The sequence of a nucleic acid molecule can be derived from the antibody's amino acid sequence using conventional methods such as codon coding rules.

[0058] The full-length sequence of a nucleic acid molecule or its fragments can usually be obtained by PCR amplification, recombination, or artificial synthesis.

[0059] For example, the nucleic acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.22 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.24 or its complementary sequence. The nucleic acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.26 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.28 or its complementary sequence.

[0060] For example, the nucleic acid sequence of the first antibody light chain is as shown in SEQ ID NO.21 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or its complementary sequence. The nucleic acid sequence of the second antibody light chain is as shown in SEQ ID NO.25 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or its complementary sequence.

[0061] Those skilled in the art will understand that, due to the degeneracy of the genetic code, nucleic acid molecules other than those in the above examples can also encode the antibodies of the present invention. Therefore, the nucleic acid molecules in the above examples should not be regarded as limiting the scope of protection of the present invention.

[0062] The original vector used to construct the recombinant vector is any vector conventional in the art, as long as it can contain the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series, pcDNA series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1, and M13), viscera, and mini-chromosomes. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules into a host and multiply them in host cells) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule. This is a well-known technique in the art.

[0063] The nucleic acid molecules encoding the antibodies FL and FH of this invention can be inserted into two vectors, which can be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain can be isolated from the host cell expressing it, and the isolated heavy and light chains can be mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules encoding antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence ligated downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy and light chains can be operatively ligated to different promoters, or the nucleic acid sequences encoding the heavy and light chains can be operatively ligated to a single promoter, such that both the heavy and light chains can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibodies.

[0064] Recombinant vector transfection or transformation into host cells is performed using conventional techniques. When the host is a prokaryote such as *E. coli*, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2; alternatively, methods such as microinjection, electroporation, liposome packaging, or gene gun can be used. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or gene gun.

[0065] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in this invention include, but are not limited to, *Escherichia coli* (e.g., DH5α, JM109, BL21, W3110), *Bacillus* spp. (e.g., *Bacillus subtilis*, *Bacillus thuringiensis*), *Enterobacterium* strains (e.g., *Salmonella typhimurium*, *Serratia marcescens*), and *Pseudomonas* spp. Eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining host cells transfected or transformed with the recombinant vector described above, they can be cultured under suitable conditions to express antibodies, which can then be isolated to obtain purified antibodies.

[0066] In a typical embodiment, the preparation method of the antibody of the present invention includes: tandemly loading the light chain and heavy chain genes of the antibody with a signal peptide, respectively, onto the expression vector pBR322, co-transfecting human renal epithelial cells (293F), culturing the 293F cells, collecting the cell culture supernatant, and purifying to obtain the target antibody strain. The sequence of the signal peptide is designed according to the host cell, and the present invention does not have any special limitations in this regard. The signal peptide encoding gene is located upstream (5' end) of the antibody gene.

[0067] Another embodiment of the present invention provides an antibody pair against human tumor necrosis factor receptor 1, which consists of a first antibody and a second antibody as described above.

[0068] The first and second antibodies of this invention can be used as paired antibodies in a bispecific antibody sandwich, providing a reliable antibody tool for constructing a bispecific antibody sandwich ELISA method.

[0069] In another embodiment of the present invention, the use of the antibody or antibody pair against human tumor necrosis factor receptor 1 as described above in the preparation of a human tumor necrosis factor receptor 1 detection kit is provided.

[0070] The advantages of the antibody or antibody pair against human tumor necrosis factor receptor 1 in the preparation of human tumor necrosis factor receptor 1 detection kit are the same as those of the antibody or antibody pair against human tumor necrosis factor receptor 1 described above, and will not be repeated here.

[0071] Based on the same inventive concept described above, embodiments of the present invention also provide a human tumor necrosis factor receptor 1 detection kit, the kit comprising the first antibody and / or the second antibody as described above.

[0072] It should be noted that the first and second antibodies can be used individually or in pairs, and can also be bound or conjugated separately to a detection marker (for detection purposes). In immunoassay, if the first and second antibodies are used separately, the antibody acts as an antigen-binding antibody (capture antibody), specifically recognizing and binding to TNFR1 protein in the sample to be tested. A recognizable signal change is then generated through the detection marker conjugated to it. Alternatively, a recognizable signal change can be generated by the specific binding of the antibody of this invention to a detection antibody conjugated with a detection marker, such as IgG, thereby achieving qualitative or quantitative detection of human TNFR1 protein. When used in pairs, one of the two antibodies serves as the primary antibody or capture antibody, and the other as the secondary antibody or detection antibody.

[0073] The detection methods employ conventional immunological techniques, such as enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence assay (IF), Western blotting (WB), and flow cytometry (FC). The detection targets include recombinantly expressed human TNFR1 protein as well as naturally secreted or expressed human TNFR1 protein from cells / tissues. Samples include, but are not limited to, serum, plasma, urine, cells or cell culture medium, tissue or tissue homogenate.

[0074] Preferably, the kit is a double-antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody serves as a capture antibody (or primary antibody), and the second antibody serves as a detection antibody (or secondary antibody) and is conjugated with a detection marker.

[0075] The aforementioned detection markers used to generate identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as acridinium ester, umbelliferone, fluorescein, anthocyanin, fluorescein isothiocyanate (FITC), rhodamine, dichlorotriazineamine fluorescein, dansyl chloride), fluorescent proteins (such as isophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0076] Optionally, the double-antibody sandwich enzyme-linked immunosorbent assay kit further includes a diluent, a blocking solution, a horseradish peroxidase-labeled streptavidin solution, and a 3,3',5,5'-tetramethylbenzidine chromogenic solution.

[0077] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0078] Example 1: Screening and preparation of rabbit-derived antibodies against human tumor necrosis factor receptor 1 (TNFR1)

[0079] This embodiment utilizes a monoclonal antibody development technique based on single B lymphocyte screening and culture. B lymphocytes capable of recognizing the target antigen were enriched and isolated from rabbit spleens immunized with human TNFR1. These cells were then cultured as single cells to obtain monoclonal antibodies secreted by the B lymphocytes. Finally, the encoding genes of these monoclonal antibodies were expressed using gene recombination expression technology for mass production. Functional screening yielded monoclonal antibodies 5H7 and 5C12. Antibody sequencing was performed by Kinkai Biotechnology Co., Ltd. The amino acid (AA) and nucleotide (DNA) sequences of antibodies 5H7 and 5C12 are shown in Tables 1-2, respectively. For ease of description, the light chain CDR1-3 are denoted as LCDR1-3, and the heavy chain CDR1-3 are denoted as HCDR1-3, respectively.

[0080] Table 1. Sequence information of monoclonal antibody 5H7 in this embodiment.

[0081]

[0082] Table 2. Sequence information of monoclonal antibody 5C12 in this embodiment.

[0083]

[0084]

[0085] 1.1 Animal Immunization: Two New Zealand white rabbits were immunized with commercially available recombinant Human TNFR1 protein (from ABclonal, catalog number RP01347, protein sequence see UniProt number: P19438) at a dose of 200 μg / rabbit. Before the first immunization, the immunogen was mixed with an equal volume of complete Freund's adjuvant to prepare an emulsion, which was injected subcutaneously at multiple sites on the abdomen and back of the rabbits. Three weeks later, 100 μg of the immunogen was mixed with an equal volume of incomplete Freund's adjuvant to prepare an emulsion, which was also injected subcutaneously at multiple sites on the abdomen and back of the rabbits for two booster immunizations. After the three immunizations, serum was collected, and the antibody titer against TNFR1 protein was determined by ELISA. Rabbits with high serum titers were given a second booster immunization with 200 μg of the immunogen. Three days later, the animals were sacrificed, and their spleens were harvested.

[0086] 1.2 Isolation of B lymphocytes and sorting of antigen-specific B lymphocytes in the spleen: For relevant methods, please refer to the published patents “Method for efficient isolation of single antigen-specific B lymphocytes from spleen cells (Publication No.: CN110016462A, Publication Date: 2019-07-16)” and “An in vitro culture system for B lymphocytes and its application (Publication No.: CN111518765A, Publication Date: 2020-08-11)”.

[0087] 1.3 Cloning of genes encoding monoclonal antibodies: The supernatant from cultured B cells was used to identify antigen-specific B lymphocytes using an ELISA method coated with TNFR1 protein. The cells were then collected, lysed, and analyzed using Quick-RNA... TM RNA was extracted using the MicroPrep kit (purchased from ZYMO, catalog number R1051) and reverse transcribed into cDNA. Using cDNA as a template, the naturally paired antibody light chain variable region (VL) and heavy chain variable region (VH) were amplified by PCR. The PCR reaction mixture consisted of: 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 12.5 μL 2×Gloria HiFi (from ABclonal, catalog number RK20717), and 6.5 μL H2O. The amplification program was: 98℃ for 30 s, followed by 40 cycles of 98℃ for 10 s, 64℃ for 30 s, and 72℃ for 30 s, with a final temperature of 72℃ for 5 min. The reaction mixture was stored at 4℃. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent the forward and reverse primers, respectively.

[0088] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (SEQ ID NO. 29);

[0089] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (SEQ ID NO. 30);

[0090] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (SEQ ID NO. 31);

[0091] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (SEQ ID NO. 32).

[0092] The amplified products were sequenced to obtain the variable region of the antibody and its encoding gene sequence; the heavy chain constant region (CH) was obtained by searching the rabbit-derived IgG gamma C reign and the light chain constant region (CL) by searching the rabbit-derived IgG Kappa C reign, thus obtaining the complete antibody gene and protein sequence.

[0093] 1.4. Large-scale production of monoclonal antibodies 5H7 and 5C12: The obtained antibody heavy chain and light chain genes were loaded into the expression vector pBR322, respectively. In this example, CL and heavy chain CH were pre-inserted into pBR322, and the resulting vector map is shown below. Figure 1 In this model, pBR322 origin and f1 origin are replication promoters, Ampcillin is the resistance gene, CMV promoter is the transcription promoter, SV40 PA terminator is the tailing signal, the light chain constant is the CL gene sequence (left figure), and the heavy chain constant is the CH gene sequence (right figure). The amplified VL and VH genes were then ligated to the pBR322 expression vector carrying the CL and CH genes, linearized with XbaI and NheI restriction endonucleases respectively, via homologous recombination to obtain the FL and FH gene expression vectors. Sequencing confirmed the successful vector construction.

[0094] To facilitate antibody purification, a signal peptide is added upstream of VL and VH to achieve secretory expression of the antibody. Commonly used antibody expression signal peptides in the field can be used, such as those in the patents "Rabbit Monoclonal Antibody Against Human Interferon α2 and Its Application (Publication No.: CN116063487A, Publication Date: 2023-05-05)" and "High Affinity Human IL-5 Rabbit Monoclonal Antibody and Its Application (Publication No.: CN115819578A, Publication Date: 2023-03-21)". Upstream of VL, there is a signal peptide "MDTRAPTQLLGLLLLWLPGATF" (in this embodiment, the encoded gene is atggacacgagggcccccactcagctgct gggactgctgttgctttggctgccgggcgccacgttt or atggacacgagggcccccactcagctgctggggctcctcctgctgtggctgccc). The antibody sequence VH contains a signal peptide "METGLRWLLLVAVLKGVQC (in this embodiment, the encoded gene is atggagactgggctgcgctggcttctcctggtcgctgttcttaaaggggtgcagtgc or atggagactgggctgcgctggcttctcctggtggc tgtactcaagggcgtgcagtgc)". Of course, those skilled in the art can replace the signal peptide with another after obtaining the antibody sequence of this invention; therefore, the signal peptide sequence is not shown in Tables 1-2 of this embodiment.

[0095] The successfully constructed expression vectors containing FL and FH genes were co-transfected into 293F cells. After transfection, the cells were cultured for 72-96 hours, and the culture supernatant was collected. Recombinant rabbit antibodies 5H7 and 5C12 recognizing human TNFR1 were purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA023100), with a purity greater than 95%.

[0096] Example 2: Performance detection of antibodies 5H7 and 5C12 against TNFR1 protein

[0097] Antigen-antibody binding curves were determined using the Gator Prime biomolecular interaction analyzer from Probe Life to identify antibody affinity and antigen recognition epitopes.

[0098] 2.1 Affinity Test: The probe is an HFC (Anti-HIgG FC) probe. The specific method is as follows: 1) Pre-wet: Before use, wet the probe by shaking at 1000 rpm for 300 seconds in the accompanying buffer; 2) Baseline 1: Place the probe in the buffer for start-point calibration to ensure that the probe is initially in a stable state, and process at 1000 rpm for 60 seconds; 3) Loading: Load the Human... TNFR1 was immobilized on the probe at a concentration of 3 μg / mL and treated at 1000 rpm for 120 s; 4) Baseline 2: The probe with immobilized antigen was placed in buffer solution and washed by shaking, and treated at 1000 rpm for 60 s; 5) Association: The probe with immobilized antigen was placed in the antibody solution to be tested, with antibody 5H7 concentration of 10.2 μg / mL and antibody 5C12 concentration of 6.8 μg / mL, and treated at 1000 rpm for 300 s to test the antibody binding ability to antigen; 6) Dissociation: When the antigen-antibody binding reached saturation, the probe was transferred to the dissociation system to complete the dissociation process, and treated at 1000 rpm for 600 s.

[0099] The affinity curves of antibodies 5H7 (top) and 5C12 (bottom) binding to TNFR1 protein are shown in the figure below. Figure 2 As shown in the figure, the vertical axis represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, and the horizontal axis represents the binding time. The dark gray curve is the real-time binding numerical curve, and the light gray curve is the fitted average curve. The affinity constant obtained through curve fitting and calculation is shown in Table 3, and the dissociation coefficient K... off A constant characterizing the rate of antibody-antigen dissociation, the binding coefficient K. on The affinity constant K is a constant characterizing the rate at which an antibody binds to its target. D For K off / K on The ratio of the antigen to the antibody-antigen ratio represents the dissociation equilibrium constant between the antibody and the antigen. It can be seen that antibodies 5H7 and 5C12 reach saturation with the antigen in a relatively short time and show no significant dissociation over a longer period, exhibiting good affinity for TNFR1 protein. The affinity constant K is [value missing]. D They are 9.86×10 -10 and 3.40×10 -10 (M).

[0100] Table 3. Affinity parameter determination results for monoclonal antibodies 5H7 and 5C12.

[0101] Antibody <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> 5H7 <![CDATA[2.55×10 -4 ]]> <![CDATA[2.58×10 5 ]]> <![CDATA[9.86×10 -10 ]]> 5C12 <![CDATA[4.86×10 -4 ]]> <![CDATA[1.43×10 6 ]]> <![CDATA[3.40×10 -10 ]]>

[0102] 2.2 Identification of antigen recognition epitopes: The procedure is basically the same as affinity assay, except that: the concentration of the solidified antigen protein is 2 μg / mL, the probe of the solidified antigen is placed in a 3 μg / mL antibody 5H7 solution and treated at 1000 rpm for 420 s to allow the first antibody to bind to the target protein until saturation, and then the probe is placed in a 3 μg / mL antibody 5C12 solution and treated at 1000 rpm for 300 s to allow the second antibody to bind. By analyzing the signal change after the antibody binds to the antigen, the epitope it recognizes is determined.

[0103] The antigenic determinant recognition results for the two antibodies are shown in the figure. Figure 3 The graph shows the change in the thickness of the conjugate after the probe binds to the antibody and protein, with the horizontal axis representing the binding time between the antibody and the antigen protein. It is evident that the probe, after binding to antibody 5H7, can still bind to antibody 5C12 after immobilizing the TNFR1 protein, indicating that these two antibodies recognize different antigenic epitopes.

[0104] Example 3: Establishment of a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) based on antibodies 5H7 and 5C12 and its sensitivity analysis.

[0105] 5C12 antibody biotin labeling: 5C12 antibody and biotin (purchased from Biosbio, catalog number B5064) were mixed at a mass ratio of 10:1 and reacted at 4℃ for 16-20h to obtain biotin-labeled antibody 5C12 (5C12-biotin).

[0106] A double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system was established using antibody 5H7 as the capture antibody and antibody 5C12-biotin as the detection antibody. The steps are as follows: 1) Coating with capture antibody 5H7: Prepare a 2 μg / mL antibody 5H7 solution with 1×PBS and add 100 μL / well to a 96-well microplate. Incubate at 4℃ for 16-20 h; 2) Washing: After incubation, discard the liquid in the wells, wash once with 300 μL of 1×PBST, let stand for 40 s, and then discard the liquid in the wells; 3) Blocking: Add 200 μL / well of E013 blocking buffer (1×PBS containing 2% BSA, 5% sucrose, 0.05% Tween 20 and 0.1% Proclin 300, pH 7.2) to the wells and block at 37℃ for 2 h. After blocking, discard the blocking buffer and dry in a 37℃ oven for 0.5-2 h; 4) Adding antigen protein: Add Human... TNFR1 protein was serially diluted using E003 dilution buffer (1×PBS containing 2% BSA, 0.05% Tween 20, and 0.1% Proclin 300, pH 7.2) to concentrations of 500, 250, 125, 62.5, 31.25, 15.625, 7.8125, and 0 pg / mL. 100 μL was added to each well of a plate and incubated at 37°C for 2 h. 5) Washing: Same as step 2). 6) Adding the detection antibody 5C12-biotin: Prepare a 0.125 μg / mL 5C12-biotin solution and add 100 μL to each well of a plate. Incubate at 37°C for 1 h. 7) Washing: Same as step 2). 8) Adding SA-HRP: ... 9) Dilute 100× horseradish peroxidase-labeled streptavidin solution (SA-HRP, purchased from Wuhan Sanying, catalog number SA00001-0) concentrate and add 100 μL / well to each well of the plate, incubate at 37℃ for 0.5 h; 10) Wash the plate: same as step 2); 11) Add chromogenic solution: add 100 μL / well of 3,3',5,5'-tetramethylbenzidine (TMB) chromogenic solution (purchased from Sizhengbai, catalog number 4ATMB1000) to each well of the plate, incubate at 37℃ for 15 min; 12) Read the values: remove the microplate, add 50 μL of 1mol / L hydrochloric acid to each well to stop the reaction, and immediately read the values ​​using a microplate reader. Replace the antibody solution with the diluted solution as a blank control.

[0107] Plotting human TNFR1 protein concentration on the x-axis, OD 450nm Plot the absorbance value on the ordinate, and the standard curve is shown below. Figure 4 As shown in the figure, the paired antibodies 5H7 and 5C12 exhibit good linearity for ELISA detection of human TNFR1. The sensitivity was calculated by substituting the average absorbance (AV) of the 16 blank control wells with twice the standard deviation (SD) into the standard curve (see Table 4). The detection limit was 1.82 pg / mL, demonstrating high sensitivity and accuracy.

[0108] Table 4 shows the sensitivity of the double-antibody sandwich enzyme-linked immunosorbent assay based on antibodies 5H7 and 5C12.

[0109]

[0110] Example 4: Specificity assay for a double-antibody sandwich enzyme-linked immunosorbent assay based on antibodies 5H7 and 5C12.

[0111] The antigen recognition specificity of the double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) established in Example 3 was detected by cross-reactivity with various proteins that are structurally similar to or highly homologous to human TNFR1. The cross-reactivity test proteins were: Human EGF (catalog number RP01030), Human IL-1β (catalog number RP00002), Human IL-2 (catalog number RP01039), Human IL-4 (catalog number RP00995), Human IL-6 (catalog number RP00201), Human IL-8 (catalog number RP00052), Human IL-10 (catalog number RP00093), Mouse EGF (catalog number RP01684), and Mouse IL-1β (catalog number RP01340), all derived from ABclonal, with a detection concentration of 10 ng / mL for each protein.

[0112] See results Figure 5 In the figure, Positive Control represents Human TNFR1, Blank represents the control group without added protein, H. represents Human, and M. represents Mouse. It can be seen that the paired antibodies 5H7 and 5C12 bind only to human TNFR1 and do not exhibit any cross-reaction with other proteins. This demonstrates that the double-antibody sandwich ELISA method constructed based on the aforementioned paired antibodies in this application has high specificity, specifically recognizing and binding to human TNFR1 protein.

[0113] Example 5: Thermostability Testing of a Double Antibody Sandwich Enzyme-Linked Immunosorbent Assay Based on Antibodies 5H7 and 5C12

[0114] The ELISA plate coated with the capture antibody 5H7, lyophilized human TNFR1 protein, and 100× concentrated detection antibody 5C12-biotin were sealed and stored at 37°C for thermal destruction. After 7 days, the plate was removed and detected using the double-antibody sandwich ELISA method described in Example 3, with the plate stored at -20°C serving as a baseline control. The coefficients of variation of the standard curves established under different treatment conditions were compared to analyze the thermal stability of the detection system.

[0115] The results are shown in Table 5 and Figure 6The results showed that the coefficient of variation (CV) of the detection antibody and the coated antibody after 7 days of heat destruction at 37°C was 3.16% and 3.34% respectively compared with the control group, and the CV of the whole-component destruction group was 2.89% compared with the control group, indicating that the paired antibodies of the present invention have good stability.

[0116] Table 5 shows the stability of the double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) based on antibodies 5H7 and 5C12.

[0117]

[0118]

[0119] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An anti-human tumor necrosis factor receptor 1 antibody, characterized in that is a first antibody or a second antibody, wherein: The amino acid sequences of CDR1, CDR2, and CDR3 in the light chain variable region of the first antibody are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 in the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively; The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.20, respectively.

2. The anti-human tumor necrosis factor receptor 1 antibody according to claim 1, characterized in that The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO. 7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The anti-human tumor necrosis factor receptor 1 antibody according to claim 1, characterized in that The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The anti-human tumor necrosis factor receptor 1 antibody according to claim 1, characterized in that The first antibody or the second antibody is a full-length antibody or an antigen-binding region of the full-length antibody; The antigen binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. A nucleic acid molecule or recombinant vector, characterized in that: The recombinant vector comprises the nucleic acid molecule, which encodes the first antibody or the second antibody according to any one of claims 1 to 4.

6. The nucleic acid molecule or recombinant vector according to claim 5, characterized in that The nucleic acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO. 24 or a sequence complementary thereto; The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

7. The nucleic acid molecule or recombinant vector according to claim 6, characterized in that The nucleic acid sequence of the light chain of the first antibody is shown in SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO. 23 or a sequence complementary thereto; The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

8. An anti-human tumor necrosis factor receptor 1 antibody pair, characterized in that: The method comprises the first antibody and the second antibody as described in any one of claims 1 to 4.

9. A human tumor necrosis factor receptor 1 detection kit, characterized in that: The kit comprises the anti-human tumor necrosis factor receptor 1 antibody according to any one of claims 1 to 4 or the anti-human tumor necrosis factor receptor 1 antibody pair according to claim 8.

10. The human tumor necrosis factor receptor 1 detection kit according to claim 9, characterized in that: The detection kit is a double antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is coupled with a detection marker.

Citation Information

Patent Citations

  • Method for efficiently separating single antigen-specific B lymphocyte from spleen cells

    CN110016462A

  • B lymphocyte in vitro culture system and applications thereof

    CN111518765A

  • High-affinity Human IL-5 rabbit monoclonal antibody and application thereof

    CN115819578A

  • Anti-human interferon alpha 2 rabbit monoclonal antibody and application thereof

    CN116063487A