A recombinant strain of *M. molybdenum* producing D-pantothenic acid, its preparation method, and its application.

Abstract

This invention discloses a recombinant strain of *Fermentomonas motilityis* that produces D-pantothenic acid, its preparation method, and its applications. The genome of the recombinant strain integrates the hydroxymethyltransferase gene *panB*, the ketopantoacid reductase gene *panE*, and the pantothenic acid synthase gene *panC*. The recombinant strain is also transformed with an expression plasmid containing the acetyllactone synthase gene *Bsals*, the ketoacid reductase gene *ilvC*, and the dihydroxyacid dehydratase gene *ilvD*. The nucleotide sequences of genes *Bsals*, *ilvC*, *ilvD*, *panB*, *panE*, and *panC* are shown in SEQ ID NO. 1 to SEQ ID NO. 6, respectively. This invention systematically modifies *Fermentomonas motilityis* ZM4 using genetic engineering techniques. By screening hydroxymethyltransferases, pantothenic acid synthases, and ketopantoacid reductases from different sources, the optimal enzyme combination suitable for *Fermentomonas motilityis* was identified, laying a core foundation for the efficient operation of the D-pantothenic acid synthesis pathway and overcoming the technical bottleneck of traditional strains with single metabolic pathways and low synthesis efficiency.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a recombinant strain of *Morphozoa motilityis* that produces D-pantothenic acid, its preparation method, and its application. Background Technology

[0002] D-Pantothenic acid (vitamin B5) is a core precursor of coenzyme A and acyl carrier proteins in organisms, playing a crucial role in fatty acid metabolism, the tricarboxylic acid cycle, and cellular energy metabolism. Due to its wide range of biological functions, D-pantothenic acid is in high demand across multiple sectors, including pharmaceuticals, food, animal feed, and cosmetics. According to a report by Grand View Research, the global D-pantothenic acid market is projected to reach $650 million in 2023, with a CAGR of approximately 5.2%, indicating a promising market outlook.

[0003] Currently, the mainstream production of D-pantothenic acid relies on chemical synthesis, a process involving multiple reactions, such as the condensation of isobutyraldehyde and formaldehyde. This process suffers from high energy consumption, compound separation, and the use of toxic solvents (such as cyanide), increasing production costs and causing serious environmental pollution, which contradicts the current trend of green manufacturing. While biological production of D-pantothenic acid offers advantages such as high selectivity and low energy demand, existing microorganisms such as E. coli and Bacillus megaterium, which have undergone metabolic engineering, rely on aerobic fermentation, resulting in high fermentation costs and the generation of numerous byproducts, thus limiting large-scale industrial production.

[0004] *Fermentomonas motilityis*, a naturally occurring facultative anaerobic Gram-negative bacterium that produces ethanol, possesses a unique endogenous metabolic pathway (ED) and high sugar fermentation efficiency. It exhibits characteristics such as high ethanol yield, low biomass accumulation, strong ethanol tolerance, high osmotic pressure tolerance, and fermentation without the need for additional oxygen, making it an ideal industrial cell factory. In recent years, synthetic biology technology has driven its continuous expansion of applications, successfully achieving the biosynthesis of various high-value-added products. Crucially, the isobutanol biosynthesis pathway in *Fermentomonas motilityis* intersects with that of D-pantothenic acid at metabolic nodes. Both begin with pyruvate and share the key step in the conversion of pyruvate to α-ketoisovaleric acid. Furthermore, the validated key enzymes can provide a component library for the pantothenic acid synthesis module. Therefore, based on the existing high-yield isobutanol system and metabolic engineering experience of *Fermentomonas motilityis*, constructing a cell factory for D-pantothenic acid synthesis has significant potential and advantages. Summary of the Invention

[0005] The main objective of this invention is to propose a recombinant strain of *Z. motility fermentum* that produces D-pantothenic acid, its preparation method, and its application. The aim is to use *Z. motility fermentum* (ZM4) as the starting strain, modify the strain through genetic engineering, introduce specific exogenous genes, realize the synthesis of D-pantothenic acid in *Z. motility fermentum*, and then improve the yield of D-pantothenic acid through a series of genetic engineering and metabolic engineering modifications.

[0006] To achieve the above objectives, this invention proposes a recombinant strain of *Bacillus muscularis* that produces D-pantothenic acid. The genome of this recombinant strain integrates the hydroxymethyltransferase gene *panB*, the ketopantolysin reductase gene *panE*, and the pantothenic acid synthase gene *panC*. Furthermore, the recombinant strain is transformed with an expression plasmid containing the acetolactate synthase gene *Bsals*, the keto acid reductase gene *ilvC*, and the dihydroxy acid dehydratase gene *ilvD*.

[0007] The nucleotide sequences of genes Bsals, ilvC, ilvD, panB, panE, and panC are shown in SEQ ID NO.1 to SEQ ID NO.6, respectively.

[0008] SEQ ID NO.1 (Bsals):

[0009]

[0010] SEQ ID NO.2(ilvC):

[0011]

[0012] SEQ ID NO.3(ilvD):

[0013]

[0014] SEQ ID NO.4(panB):

[0015] atgtcagccatcccttcttctaataagcgccgaactattcccgagcttcgcgcgcgtaaaggcaagtcgccgatcgttgctttaacggcttacagtgctttaaccgcccgttttgttgatccttacgccgatttcattcttgtcggggacagtcttgccatggtcgaacatggtatggcgacgactattggtgcctcgcttgatatgatgattttacatggtcaaagcgtgatgcgcggttccgagaaggccgctgtcgtcatcgacatgccttttggttcttacgaagcgagtccacaggaagcctatcataatgctgtccgtattttgtccgaaacaggatgttcagccgtaaaacttgaaggcggctctcatctcgcgcctgttatcgccttcctcacagcacgaggggtgccggttatggggcatattgggttgacgcctcaatatgttcagactttgggcggtttcaaaatacaaggccatagctcggaacaacaagacaagattaaacaggatgctcttgattttgaggccgccggtgctttttccgtcgtgctagaaggggtgaccgaaccgcttgcccgtgaaattacggataatatcgcgataccaacgattggtatcggtgcctcttcttattgtgatggccaagttttggttttggaagatatgctgggcttcaatgacaaggtgccgcgtttcgtcaaaaaatttgctcatcttggggatgacatcaaaaaagcggtttcagactatgccactgcggtttcaaatcgtagttttccagcagaagacaacatctacaggccaaaatcttaa

[0016] SEQ ID NO.5(panE):

[0017] Atgaaaattgcgatcgttggcgctggtgcagttggtggatatttcggagcgttgttacaagaatctggtgcagatatcacgatggttgcacgtggacgaacattagaagccttgaagtctaaaggactccacatcaacgatgcaagaggcgaacgctacgtaccaattcctgcagttgcgagcgtgcaagaactaaaagatgcagatgtagtgatgattgctactaaagcattatcgctgtcctcagatctcgctgaacttttgggtgggatacctgcgaattcggtggtcgcgattactcagaattcgattgaaactgctgatctagcagcgaagagtatcggtgctgatcgtgtgtggcctggtgtggttcgtgggttctttgttcatgaggggccagcctcagtgtcatacaagggaggcccactgtcctacacgtttggtgattctggtgaactttctaggcaattcgcaagcactcttgaacaggccggtattgacggagttctgcatcccgatattttggtggatgtgtgggagaaagccatgttcgtagaggttttcggcgggttgggggctttcgtcgaaaagcaattaggtaccttgcgtacgcattttagggcttccctggaagccttgatggaagaggtggctgaggtggctcgcgcagcaggtgttgcgttgccgagcgatgcggtggagcgcaccatgaattttacggatcggatgcctgagaattcgacgagttcgatgcagcgtgatttggccgcgggagtggctagtgagcttgaggctcagacaggtgcaattgtgcgggcagcacacaaagtgggtgtgaaaactccgcttcatgaccttatttatgctggtcttaagctgaaagaagaggaaaattcactttag

[0018] SEQ ID NO.6(panC):

[0019] ttgctcgttattcataccatagccgaacttcgcgcccatcttgatgaacatcgccaaaatcgccgcaaaattggcttggtgcctacaatgggtttcttacatcaaggacatatggccttagcgcaaaaagcgagggaagaatctgatgtggtggtgcttagtatttttgttaacccgatacagttcggcgttaatgaagatctcgatgtttacccaagagatttacctcacgacatcgcgttatgtaaagaaaatggggtagatatcatttttgcgccttcggtggctgaaatctatccagaaccgataatgacctcggtcgaggttcaatcactttccaatattttgattggtcgtcatcgtcccaatcatttccgtggcgtgacgacgatcgtcgcaaagttattgaatattgtcgaacccgataagattattttcggagaaaaggactatcaacagcttattatagtccgtcggatgatccgtgatctttcctacaaagccgaagtgattggggtgccgatagttcgtgaaaaggacggcttggcctgttcttcgcgcaatgcaagattgaccaaagaagatcgcgctgcggcggtcattctttcgcaatccttgaaaaaagcccaaaaaaggattttggaaggcgaaaaagatgtctccactatccgccagttaatagaagacgatatcaaaagcgaagcacgggcaaaaattcaatctattgatatctgccatgctacaaaattagatactctcgacaggatagataatcagccgattgttattctactcgctgtcgcttttggtgacgtcgttctgatcgatcagcagctcgttacgcccaaggagaaagcgctctaa

[0020] Preferably, the genes Bsals, ilvC and ilvD are expressed through the pEZ15A vector to obtain plasmid A4, and are expressed using the inducible promoter Ptet.

[0021] Preferably, the genes panB and panC are derived from any one of the following: panB1-panC from endogenous *Fermentomonas motilityis*, panB2-panC from endogenous *Fermentomonas motilityis*, EcpanB-EcpanC from *Escherichia coli*, and CgpanB-CgpanC from *Corynebacterium glutamicum*.

[0022] Preferably, the genes panB and panC are derived from the endogenous panB2-panC of *Mammotrophic motility*.

[0023] Preferably, the gene panE is derived from any one of EcpanE of Escherichia coli, CgpanE of Corynebacterium glutamicum, BspanE of Bacillus subtilis, and BlpanE of Bacillus licheniformis.

[0024] Preferably, the gene panE is derived from CgpanE of Corynebacterium glutamicum.

[0025] Preferably, the recombinant strain further includes overexpression of the phosphoglycerate dehydrogenase gene serA, a key enzyme in serine synthesis, and the serine hydroxymethyltransferase gene glyA.

[0026] Preferably, the recombinant strain further includes strains that weaken the expression of the pantothenic acid kinase coaA gene in the D-pantothenic acid degradation pathway;

[0027] Overexpression of the endogenous glucose-6-phosphate dehydrogenase gene zwf in *Mammotrophic motility*;

[0028] The heterologous aspartate decarboxylase gene panD from Corynebacterium glutamicum was introduced.

[0029] This invention also proposes a method for constructing a recombinant strain of *Bacillus simulans* that produces D-pantothenic acid, as described above, characterized by comprising the following steps:

[0030] S1. Construct expression plasmids;

[0031] S2. Transform the expression plasmid into *Bacillus simulans* to obtain transformants;

[0032] S3. Construct editing plasmids and homologous recombination plasmids, and integrate the selected genes and strategies into relevant sites in the genome of *Mammotrophic motility*.

[0033] The present invention also proposes the application of a recombinant strain as described above in the production of D-pantothenic acid.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0035] (1) This invention systematically modifies *Zygomorpha motileis* ZM4 using genetic engineering techniques. Based on the pyruvate-to-α-ketoisovalerate biotransformation module, it innovatively performs heterologous screening of three key enzyme genes (panB, panE, and panC) in the D-pantothenic acid synthesis pathway. Using a dual-plasmid co-expression system of pEZ15A vector (A4 plasmid) and 39P plasmid, carbon flux allocation is precisely controlled, ensuring sufficient carbon flux in the acetolactate pathway while successfully constructing a recombinant strain capable of D-pantothenic acid synthesis. This process, through screening hydroxymethyltransferase, pantothenic acid synthase, and ketopantolysin reductase from different sources, clarifies the optimal enzyme combination suitable for *Zygomorpha motileis*, laying a core foundation for the efficient operation of the D-pantothenic acid synthesis pathway and breaking through the technical bottleneck of traditional strains having a single metabolic pathway and low synthesis efficiency.

[0036] (2) This invention achieves increased D-pantothenic acid production through a multi-dimensional modular optimization strategy. First, the expression efficiency of target genes is enhanced by targeting the promoters of key enzyme genes. Second, overexpression of NADPH-related genes and one-carbon unit-related genes precisely balances energy and material supply during metabolism. Simultaneously, by weakening the D-pantothenic acid degradation pathway and supplementing the endogenously missing β-alanine synthesis pathway, product loss is effectively reduced and D-pantothenic acid accumulation is increased. After integration and optimization, the strain can synthesize 120 mg / L of D-pantothenic acid through anaerobic fermentation in pure glucose medium. Under β-alanine supplementation, the yield increases to 220 mg / L, and a stable synthesis level of 160 mg / L is finally achieved through strategy integration, which is significantly better than similar research results, demonstrating the significant advantages of modular metabolic engineering in improving microbial synthetic efficiency.

[0037] (3) The *Mammotrophic leptospira* strain used in this invention is a facultative anaerobic microorganism, and its unique metabolic characteristics endow this recombinant strain with significant industrial application potential. During anaerobic fermentation, no additional oxygen supply or complex equipment such as stirring and aeration sterilization is required, significantly reducing energy consumption and equipment investment costs, thus meeting the development needs of green biomanufacturing. Furthermore, the strain can simultaneously produce ethanol while synthesizing D-pantothenic acid, and the metabolic pathways of the two processes do not interfere with each other; ethanol production is unaffected by D-pantothenic acid synthesis. This multi-product co-production characteristic further enhances the economic efficiency and resource utilization of the fermentation process. The successful construction of this strain provides a new technical path for the low-cost, high-efficiency industrial production of D-pantothenic acid, and is expected to promote industrial upgrading and sustainable development in related biochemical fields. Attached Figure Description

[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0039] Figure 1 The diagram (A) shows the construction of the recombinant strains DPA-0, DPA-1, DPA-2, DPA-3, and DPA-4 of this invention, and the diagram (B) shows their D-pantothenic acid production.

[0040] Figure 2 The diagram (A) shows the construction of the recombinant strains DPA-2, DPA-6, DPA-7, and DPA-8 of this invention, and the diagram (B) shows their D-pantothenic acid production.

[0041] Figure 3 The diagram (A) shows the construction of the recombinant strains DPA-11, DPA-12, DPA-13, DPA-14, DPA-15, and DPA-16 of this invention, and the diagram (B) shows their D-pantothenic acid production.

[0042] Figure 4 The diagram (A) shows the construction of the recombinant strains DPA-17, DPA-18, DPA-19 and DPA-20 of this invention, and their D-pantothenic acid production (B).

[0043] Figure 5 The diagram (A) shows the construction of the recombinant strains DPA-9, DPA-21 and DPA-22 of this invention, and the diagram (B) shows their D-pantothenic acid production.

[0044] Figure 6 The diagram (A) shows the construction of the recombinant strains DPA-9 and DPA-23 of this invention, and the diagram (B) shows their D-pantothenic acid production.

[0045] Figure 7 The diagram (A) shows the construction of the recombinant strains DPA-26, DPA-27 and DPA-28 of this invention, and the diagram (B) shows their D-pantothenic acid production.

[0046] Figure 8 The diagram (A) shows the construction of the recombinant strains DPA-A1, DPA-A2, DPA-A3, DPA-A4, and DPA-A5 of this invention, and the diagram (B) shows their D-pantothenic acid production.

[0047] Figure 9 The diagram (A) shows the construction of the recombinant strains DPA-A5, DPA-A8, and DPA-A9 of this invention, and the diagram (B) shows their D-pantothenic acid production.

[0048] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0050] This invention uses *Zygomorpha motileis* ZM4 as the starting strain and first modifies the strain using genetic engineering techniques. Based on the constructed and validated pyruvate to α-ketoisovalerate biotransformation module (containing the als, ilvC, and ilvD catalytic element system), heterologous screening is performed on the last three key enzyme genes (panB, panE, and panC) in the D-pantothenic acid synthesis pathway. It should be noted that, based on the results of the isobutanol research, to ensure sufficient carbon flux in the acetolactate pathway, the Bsals, ilvC, and ilvD gene clusters (named A4 plasmid) need to be expressed using the pEZ15A vector. Therefore, in this study, the A4 plasmid was also used to express the genes (Bsals, ilvC, ilvD) of the pyruvate to α-ketoisovaleric acid pathway to ensure carbon flux, and the 39P plasmid was used to express the genes (panB, panE, panC) of the α-ketoisovaleric acid to D-pantothenic acid pathway. Co-expression of the two plasmids yielded strains capable of D-pantothenic acid production, and the D-pantothenic acid content was measured to screen for the optimal enzyme in the synthetic pathway. Then, the accumulation of D-pantothenic acid was gradually increased by optimizing the promoters of key enzyme genes, overexpressing the cofactor NADPH supply-related genes, overexpressing the one-carbon unit supply-related genes, weakening the D-pantothenic acid degradation pathway, and completing the β-alanine synthesis pathway.

[0051] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0052] Example 1: Analysis and Screening of Hydroxymethyltransferase and Pantothenic Acid Synthase

[0053] By screening and introducing key enzyme genes panB and panC into *Fermentomonas motilityis*, the biosynthetic pathway from α-ketoisovaleric acid to D-pantothenic acid can be enhanced, thereby increasing the accumulation of the target product. The panB and panC genes screened in this invention include two endogenous *Fermentomonas motilityis* genes, panB1-panC and panB2-panC, *E. coli*-derived EcpanB-EcpanC, and *Corynebacterium glutamicum*-derived CgpanB-CgpanC. After PCR amplification of these enzyme genes, they were inserted into a 39P vector for co-expression and screening. Simultaneously, an A4 plasmid expressing the Bsals, ilvC, and ilvD gene clusters using the inducible promoter Ptet was electroporated into wild-type *Fermentomonas motilityis* ZM4 to construct strain DPA-0 as a control strain. 39P plasmids containing panB and panC genes from the above different sources were electroporated into strain DPA-0 to obtain strains DPA-1, DPA-2, DPA-3, and DPA-4, respectively. The constructed recombinant strain was subjected to shake-flask fermentation. During fermentation, 0.5 μg / mL tetracycline was added to induce gene expression on the A4 plasmid, and 2 g / L β-alanine was added exogenously as a precursor for D-pantothenic acid synthesis. The fermentation results are as follows: Figure 1 As shown, strain DPA-2 had the highest yield, reaching 40 mg / L, and the endogenous panB2 and panC genes from *Mammotrophic motility* exhibited the best catalytic activity. The nucleotide sequences of genes Bsals, ilvC, ilvD, panB, panE, and panC are shown in SEQ ID NO.1 to SEQ ID NO.6, respectively.

[0054] Example 2: Screening and optimization of promoter expression of the rate-limiting enzyme panB2-panC gene.

[0055] Optimizing promoters can increase the expression level of target genes, thereby improving the yield of target products. Therefore, to optimize the D-pantothenic acid synthesis pathway and increase D-pantothenic acid yield, this study screened and optimized the panB2-panC gene expression cassette. Furthermore, a promoter system library with different strengths was constructed based on omics datasets in previous studies of *M. motile fermentum*. Therefore, four constitutively strong promoters were selected from the promoter system library for optimization and comparison, including Pgap, Pgap6M, Peno, and Ppdc. The panB2-panC gene expression cassette was inserted into the 39P vector and expressed using the Pgap6M, Pgap, and Ppdc promoters to obtain expression plasmids. The constructed plasmids were then electroporated into the DPA-0 strain to obtain DPA-6, DPA-7, and DPA-8 strains. These strains were compared with the DPA-2 strain in shake-flask fermentation tests, and the fermentation results are as follows: Figure 2As shown, strain DPA-6 had the highest yield, reaching 50 mg / L. Therefore, using the Pgap6M promoter to express the panB2-panC gene expression cassette is more beneficial for the synthesis of D-pantothenic acid in *Bacillus motility-fermenting monocytogenes*.

[0056] Example 3: Analysis and Screening of Ketopantolytic Acid Reductase

[0057] The *panE* gene encodes ketopanolytic acid reductase. The *panE* gene is absent from the *Fermentomonas motilityis* genome, possibly due to the evolution of isoenzymes that have replaced it. For example, the ketoacid reductase encoded by *ilvC* could perform the function of ketopanolytic acid reductase. This study constructed *panE* genes from various sources, including *EcpanE* from *Escherichia coli*, *CgpanE* from *Corynebacterium glutamicum*, *BspanE* from *Bacillus subtilis*, and *BlpanE* from *Bacillus licheniformis*. These genes were then compared and screened with the endogenous *ilvC* gene from *Fermentomonas motilityis* and the *FtpanG* gene from *Francis*. Based on the *panB2-panC* gene identified in the previous screening, the *panB*, *panE*, and *panC* genomes were assembled into an expression cassette and inserted into the 39P vector according to the metabolic pathway sequence. Electroporation of this recombinant plasmid into strain DPA-0 yielded strains DPA-11, DPA-12, DPA-13, DPA-14, DPA-15, and DPA-16. These recombinant strains were subjected to shake-flask fermentation, and the fermentation results are as follows: Figure 3 As shown, strain DPA-12 had the highest yield, reaching 58 mg / L. Compared with the results in Example 1, strain DPA-12 had a yield 18 mg / L higher than strain DPA-2, an increase of nearly 50%. This indicates that the introduction of ketopantolysin effectively increases D-pantothenic acid production, and CgpanE derived from Corynebacterium glutamicum exhibited the best catalytic activity.

[0058] Example 4: Screening and Optimization of Promoter Expression of the Rate-Limiting Enzyme CgpanE Gene

[0059] To optimize the D-pantothenic acid (DPA) synthesis pathway and increase DPA yield, this study screened and optimized the promoter of the panE gene. Based on omics datasets, a promoter system library with different strengths was constructed in previous studies of *M. motile fermentum*. Therefore, four constitutively strong promoters were selected from this library for optimization and comparison: Peno, Ppdc, Ptuf, and Pzwf. The panE genome was inserted into the 39P vector and expressed using the Peno, Ppdc, Ptuf, and Pzwf promoters to obtain expression plasmids. The panB2-panC gene was integrated into the 1650 locus of the DPA-0 genome to obtain the DPA-9 strain. The DPA-9 strain showed essentially no difference in DPA accumulation compared to the DPA-2 strain. The plasmids were then transformed into the DPA-9 strain to obtain DPA-17, DPA-18, DPA-19, and DPA-20 strains. These strains were then subjected to shake-flask fermentation tests, and the fermentation results are as follows: Figure 4 As shown, strain DPA-18 had the highest yield, reaching 70 mg / L. Therefore, expressing the panE gene using the Ppdc promoter is more beneficial for the synthesis of D-pantothenic acid in *Mammotrophic Cytosporum*.

[0060] Example 5: Enhancing the supply of one-carbon units to increase D-pantothenic acid accumulation.

[0061] PanB, an hydroxymethyltransferase, is the rate-limiting enzyme in the D-pantothenic acid synthesis pathway. This step is affected by the supply of one-carbon units, which are reversibly generated from 5,10-CH2-THF and serine under the catalysis of serine hydroxymethyltransferase. In this study, overexpression of the key serine synthesis gene serA and the serine hydroxymethyltransferase gene glyA was used to increase the supply of one-carbon units, thereby increasing D-pantothenic acid production. Based on strain DPA-9, the serA and glyA genes were expressed using Peno and integrated into the genomic locus 0038 using homologous recombination, resulting in strains DPA-21 and DPA-22. Shake-flask fermentation tests were performed on these strains and DPA-9, and the fermentation results are as follows: Figure 5 As shown, compared to strain DPA-9, the yield of strain DPA-21 remained essentially unchanged; strain DPA-22 showed a significant increase in yield, and D-pantothenic acid accumulation further increased with the increase in the concentration of exogenously added serine. This indicates that overexpression of the serA gene, a key enzyme in serine synthesis, alone is insufficient to provide the strain with enough one-carbon units; overexpression of serine hydroxymethyltransferase can improve the supply of one-carbon units to increase D-pantothenic acid accumulation, and with the supplementation of the substrate serine, the availability of one-carbon units increases, and D-pantothenic acid accumulation also increases accordingly.

[0062] Example 6 weakens the degradation pathway and enhances D-pantothenic acid accumulation.

[0063] In prokaryotes, the main degradation pathway of D-pantothenic acid is its conversion to coenzyme A under the catalysis of pantothenic acid kinase CoaA. Ideally, this degradation pathway should be weakened, not blocked. Therefore, in this study, we reduced CoaA enzyme activity to increase D-pantothenic acid accumulation based on the characteristic that start codon bias affects gene expression levels. The start codon of the coaA gene in strain DPA-9 was replaced with the low-biased GTG via homologous recombination to reduce pantothenic acid kinase activity and increase D-pantothenic acid accumulation, thus obtaining strain DPA-23. Shake-flask fermentation tests were conducted on strain DPA-23 and strain DPA-9, and the fermentation results are as follows: Figure 6 As shown, compared to strain DPA-9, strain DPA-23 exhibited a significant increase in D-pantothenic acid production, with D-pantothenic acid accumulation reaching 60 mg / L, an increase of 50%. This indicates that weakening the D-pantothenic acid degradation pathway can effectively increase D-pantothenic acid accumulation. The nucleotide sequence of the pantothenic acid kinase coaA gene is shown in SEQ ID NO.7.

[0064] SEQ ID NO.7 (pantothenic acid kinase coaA):

[0065] atgctgctcgctattgatgccggcaatacaaatatagtttttgcgttggtcgatgggcgggaaattcgggcgcgatggcggattgctacagaaggtcggcggacagcagatgaatatgccgtttggctagtacagctaatggctatcggaggatttacacgcgaagaaattgatagtgtcgttatttgcaccgtagttccgcggacgttacataatcttgaggtcttatcggccaaatatttcggggtgaaagccttgattgccggaacgccgcctttggattgggggattgatattgatgttatcagtcctgaaacggtgggcgcggatcggttggttaatgcgttggccgcgcatcaccttcattccggccataaaatagcgattgatttcggaaccgcgacaacttttgactgggtggatgaaaaaggggcttatcgtggagggattattgccccgggtattaacctgtccttggatgccttggtcggaaaagcggctcgcttgccgcgtatcgcgatcgagataccaaaaacggacagtgtaatcggccgtagcaccgaagaaagtatgcatagcggtatctattggggatatatcgctatgattgaaggcttaaccgagaggatgaaacaggaaataggacagcctgtgactgtgatcgcgaccggtggtctggcctctctctttgcggtccatacgtctgtttttgacgtgatcgagcctgatttgactattcgagggatggcgctcctttacgaacagaaagcgccaacgaaattcactgcgcattccggtgggtttgccgcagattttagccccctgtaa

[0066] Example 7 Intracellular cofactor NADPH balance to enhance D-pantothenic acid accumulation

[0067] In the biosynthetic pathway of D-pantothenic acid, the synthesis of 1 mol of D-pantothenic acid requires the consumption of 2 mol of NADPH. NADPH is continuously consumed in reactions catalyzed by ketoacid reductase and ketopantolysin reductase, leading to intracellular redox imbalance. Therefore, adjusting the intracellular redox balance can effectively improve the biosynthesis of D-pantothenic acid. The genes ppnK and zwf encode NAD+ kinase and glucose-6-phosphate dehydrogenase, respectively; NAD+ catalyzes the synthesis of NADP+ from NAD+, ultimately promoting the conversion of NADH to NADPH; glucose-6-phosphate dehydrogenase participates in the conversion of glucose-6-phosphate to ribose-5-phosphate and then converts NADP+ to NADPH. Therefore, overexpression of the ppnK and zwf genes was selected to increase D-pantothenic acid accumulation through cofactor balancing. Based on the DPA-9 strain, the CgpanE gene was integrated into the genomic locus 0038 using homologous recombination to obtain the DPA-26 strain. Furthermore, the ppnK and zwf genes were overexpressed at locus 0038 of the genome, ligated after the CgpanE gene using RBS, resulting in strains DPA-27 and DPA-28. Shake-flask fermentation tests were then performed on these strains along with strain DPA-26, and the fermentation results are as follows... Figure 7 As shown, compared to strain DPA-26, only strain DPA-28 showed a significant increase in yield, increasing by approximately 85%. Overexpression of endogenous glucose-6-phosphate dehydrogenase in *Mammotrophic motility-fermenting* to enhance NADPH supply and balance intracellular redox capacity effectively helps increase D-pantothenic acid production. The nucleotide sequence of the glucose-6-phosphate dehydrogenase gene zwf is shown in SEQ ID NO. 8; the nucleotide sequence of the heterologous aspartate decarboxylase gene panD is shown in SEQ ID NO. 9.

[0068]

[0069] SEQ ID NO.9 (aspartate decarboxylase panD of Corynebacterium glutamicum): atgctgcgcaccatcctcggaagtaagattcaccgagctactgtcactcaagctgatctagattatgttggctctgtaaccatcgacgccgacctggttcacgccgccggattgatcgaaggcgaaaaagttgccatcgtagacatcaccaacggcgctcgtctggaaacttatgtcattgtgggcgacgcc ggaacgggcaatatttgcatcaatggtgccgctgcacaccttattaatcctggcgatcttgtgatcatcatgagctaccttcaggcaactgatgcggaagctaaggcgt atgagccaaagattgtgcacgtggacgccgacaaccgcatcgttgcgctcggcaacgatcttgcggaagcgctacctggatccgggcttttgacgtcgagaagcatttag

[0070] Example 8: Combining different strategies to improve D-pantothenic acid production

[0071] To further increase the yield of the target product, multiple effective modular strategies can be combined to maximize product yield. In this study, modular strategies for effectively increasing D-pantothenic acid accumulation, such as key enzyme gene screening, promoter screening optimization, NADPH cofactor supply, one-carbon unit supply, and degradation pathway weakening, have been implemented. These strategies were then sequentially integrated into the ZM4 background strain, resulting in strains DPA-A1, DPA-A2, DPA-A3, DPA-A4, and DPA-A5. The construction strategies for each strain are shown in Table 1. Fermentation results are as follows: Figure 8 As shown, with the integration of these effective strategies, the accumulation of D-pantothenic acid gradually increased, from no product accumulation in the ZM4 strain to 160 mg / L D-pantothenic acid accumulation in the DPA-A5 strain.

[0072] Table 1. Strategy for strain construction

[0073] strain DPA-A1 DPA-A2 DPA-A3 DPA-A4 DPA-A5 PanBC + + + + + PanE + + + + coaA + + + glyA + + zwf +

[0074] Example 9: Completion of the β-alanine pathway for the synthesis of D-pantothenic acid

[0075] Pantothenic acid and β-alanine are two important precursors for D-pantothenic acid synthesis. However, *Fermentomonas motilityis* is a β-alanine-deficient strain. Therefore, this study introduced and screened heterologous panD genes from *Escherichia coli* and *Corynebacterium glutamicum* into *Fermentomonas motilityis*. Based on strain DPA-A5, the *EcpanD* and *CgpanD* genes were expressed using Peno and integrated into the genomic locus 0038 using homologous recombination, resulting in strains DPA-A8 and DPA-A9. These two strains were then subjected to shake-flask fermentation under two different conditions: no exogenous β-alanine addition and normal β-alanine addition. The fermentation results are as follows: Figure 9 As shown, the strain can accumulate a certain concentration of D-pantothenic acid even without the addition of β-alanine; and the concentration of D-pantothenic acid accumulated by the strain is further increased when β-alanine is added; the DPA-A9 strain reaches the highest concentration to date, approximately 220 mg / L. A heterologous panD gene was successfully introduced into *Corynebacterium motilityis* and accumulated D-pantothenic acid, with the CgpanD gene derived from *Corynebacterium glutamicum* showing better activity.

[0076] Example 10: Construction, optimization process, and product detection of the highest-yielding strain DPA-A9

[0077] 1. Construction of plasmids

[0078] In this embodiment, the construction and optimization process of the highest-yielding strain DPA-A9 is described in detail, with plasmid and strain construction using DPA-2 as an example. First, the D-pantothenic acid synthesis pathway was established in ZM4. The inducible promoter Ptet was used to drive the tandem formation of the Bsals, ilvC, and ilvD genes to obtain an operon, which was then constructed into plasmid pEZ15A to obtain plasmid A4. The panB and panC genes were inserted into the 39P vector for co-expression. Primers for target fragment amplification included:

[0079] TY-panB2-F:tttaagaaaggtttcgatatgtcagccatcccttcttctaataagc

[0080] TY-(RBS2)-panB2-R:tttctcctctttaatttaagattttggcctgtagatgttgtcttct

[0081] TY-(RBS2)-panC-F:attaaagaggagaaattgctcgttatcataccatagccga

[0082] TY-panC-R:gcagcggccgctactagtttagagcgctttctccttgggc

[0083] The two DNA fragments panB and panC were ligated into a single long fragment using overlap PCR and then transferred to competent *E. coli* DH5α cells via Gibson assembly with the 39P vector backbone. Positive clones on the plates were verified by PCR, and the plasmid was extracted after overnight culture (plasmid extraction was performed according to the standard procedure of the plasmid extraction kit). To improve the plasmid electroporation efficiency, the plasmid obtained from the target *E. coli* DH5α strain was extracted and transformed into competent *E. coli* trans110 cells. Positive clones on the plates were verified by PCR, and the plasmid was extracted after overnight culture.

[0084] When constructing the plasmid, the obtained fragment and vector were mixed at a ratio of 3:1. After preparing the reaction system according to the table below, it was incubated on ice for 5 minutes, and then competent cells were added for chemical transformation. Screening was performed using spectinomycin-resistant (100 μg / mL) plates, and single colonies were picked and verified by PCR using appropriate primers. The PCR amplification program was set as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 55℃ annealing for 10 s, 72℃ extension for 80 s, for a total of 30 cycles. Band sizes consistent with expectations were verified by sequencing.

[0085]

[0086] 2. Construct the recombinant plasmid into the target motile fermentation monoclonal bacteria.

[0087] (1) Objective: Preparation of competent cells of *Morphozoa motilityis* strains

[0088] Using an inoculation loop, pick an appropriate amount of *ZM4* glycerol-containing *M. motile fermentomonas* and streak it onto an RMG5 solid medium (RMG5: 50 g / L glucose, 10 g / L yeast extract, 2 g / L KH2PO4, 3 g / L agar) plate. Incubate at 30°C upside down for 2–3 days to activate the colony. Transfer activated single colonies to approximately 10 mL of RMG5 liquid medium (RMG5: 50 g / L glucose, 10 g / L yeast extract, 2 g / L KH2PO4) and incubate at 30°C until mid-log phase to use as seed culture. Transfer the seed culture to a 50 mL centrifuge tube containing 40 mL of RMG5 liquid medium, controlling the initial OD between 0.025 and 0.03. Incubate at 30℃ until the OD is between 0.4 and 0.6; centrifuge the centrifuge tube containing the bacterial culture at 4000 rpm / min for 10 min to collect the bacterial cells and discard the supernatant; add 40 mL of pre-chilled sterile water to the centrifuge tube to resuspend and wash the bacterial cells, mix well, centrifuge at 4000 rpm / min for 10 min and discard the supernatant; add 40 mL of pre-chilled 10% glycerol to the centrifuge tube to resuspend and wash the bacterial cells, mix well, centrifuge at 4000 rpm / min for 10 min and discard the supernatant, and repeat this step once; add 1% (v / v) of pre-chilled 10% glycerol to resuspend the bacterial cells, mix slowly and well, and aliquot on ice, 50 μL each into sterile 1.5 mL centrifuge tubes, flash freeze in liquid nitrogen and store at -80℃.

[0089] (2) The recombinant plasmid was transferred into competent cells of the target motile fermentation mononuclear bacteria.

[0090] Collect ZM4 competent cells of *Fermentomonas motilityis* on ice. After thawing, add 50 μL of the thawed cells to an electroporation cuvette, along with 1 μg of plasmid (A4 plasmid first, then 39P plasmid). Electroporation conditions: 1600 V, 25 μF, 200 Ω. After electroporation, thaw the cells in RMG5 liquid medium at 30°C. Spread 100 μL of the thawed culture (4-6 hours later) onto a 100 μg / mL spectinomycin-resistant plate and incubate at 30°C for 2 days.

[0091] After colonies grew, the recombinant strain was subjected to colony PCR detection. The PCR amplification program was set as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 55℃ annealing for 10 s, 72℃ extension (set at 10 s / kb according to fragment length), for a total of 30 cycles; after the cycle reaction, the temperature was maintained at 72℃ for 3 min; the reaction system is as follows:

[0092]

[0093] After activating the obtained positive clones in RMG5 medium (containing 100 μg / mL spectinomycin), they were preserved with 60% glycerol.

[0094] 3. Homologous recombination and genome integration

[0095] Editing of the target gene can be achieved by setting two homologous arms on the pUC homologous recombination plasmid, and by combining the resistance gene (facilitating recombinant selection) and specific sequence (the gene sequence to be integrated) between the homologous arms. Homologous arm design: recommended length: 1000 bp (GC content ~50%, perfectly matching the target site); primer design: avoid secondary structures, Tm value ≥60℃. Transform into competent E. coli DH5α cells using the Gibson assembly method, verify positive clones on the plate by PCR, and extract the plasmid after overnight culture (plasmid extraction should follow the standard procedure of the plasmid extraction kit). Electroporate the homologous recombination plasmid into the strain according to the above method to achieve editing.

[0096] 4. Shake-flask fermentation test of strains

[0097] Aseptically, 5 μL of glycerol-preserved bacterial culture was inoculated onto RMG solid medium containing the corresponding antibiotic using the streak method and incubated at 30°C in an inverted incubator for 48-72 hours for activation. Aseptically, a single morphologically typical colony was inoculated into 2 mL of RMG5 liquid medium and incubated at 30°C with shaking (250 rpm) for primary amplification until the strain reached mid-logarithmic growth. The cells were then collected by centrifugation at 8000 rpm for 2 minutes. An appropriate volume of bacterial culture was added to 40 mL of RMG5 medium containing the corresponding tetracycline concentration (0.5 μg / mL) and 2 g / L β-alanine, ensuring an initial OD600 value of approximately 0.1. Three replicates were prepared for each group and incubated at 30°C with shaking at 100 rpm. Samples were taken at 48 hours and centrifuged at 12,000 rpm for 2 minutes to collect the fermentation supernatant. The supernatant was filtered through a 0.22 μm filter into 2 mL EP tubes and stored at -80°C for later use.

[0098] 5. HPLC detection of fermentation products

[0099] An Agilent ZORBAX XDB-C18 (4.6 × 250 mm 5 μm) column was used, with ultrapure water (i.e., V1) containing 0.1% phosphoric acid and 5% acetonitrile as the mobile phase. 超纯水 V 磷酸 V 乙腈 =949:1:50), elution conditions were isocratic elution, column temperature 30℃, flow rate 0.9 mL / min, time 15 min, and detection wavelength 200 nm. The product D-pantothenic acid was detected as a peak at approximately 8 min.

[0100] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. A recombinant strain of *Bacillus mossophila* that produces D-pantothenic acid, characterized in that, The recombinant strain integrates the hydroxymethyltransferase gene panB, the ketopantolysin reductase gene panE, and the pantothenic acid synthase gene panC into its genome; the recombinant strain is also transformed with an expression plasmid containing the acetolactate synthase gene Bsals, the keto acid reductase gene ilvC, and the dihydroxy acid dehydratase gene ilvD. The recombinant strain also includes strains that weaken the expression of the pantothenic acid kinase coaA gene in the D-pantothenic acid degradation pathway; Overexpression of the endogenous glucose-6-phosphate dehydrogenase gene zwf in *Mammotrophic motility*; Introducing the heterologous aspartate decarboxylase gene panD from Corynebacterium glutamicum; The nucleotide sequences of genes Bsals, ilvC, ilvD, panB, panE, and panC are shown in SEQ ID NO. 1 to SEQ ID NO. 6, respectively.

2. The recombinant strain according to claim 1, characterized in that, The genes Bsals, ilvC, and ilvD were expressed in plasmid A4 using the pEZ15A vector and expressed using the inducible promoter Ptet.

3. The recombinant strain according to claim 1, characterized in that, The recombinant strain also includes overexpression of the phosphoglycerate dehydrogenase gene serA, a key enzyme in serine synthesis, and the serine hydroxymethyltransferase gene glyA.

4. A method for constructing a recombinant strain of *Bacillus mossophila* producing D-pantothenic acid as described in claim 1, characterized in that, Includes the following steps: S1. Construct expression plasmids; S2. Transform the expression plasmid into *Bacillus simulans* to obtain transformants; S3. Construct editing plasmids and homologous recombination plasmids, and integrate the selected genes and strategies into relevant sites in the genome of *Mammotrophic motility*.

5. The use of the recombinant strain as described in claim 1 in the production of D-pantothenic acid.

Images