Histidine kinase PhoG capable of sensing phosphate concentration change in external environment and application of histidine kinase PhoG
The histidine kinase PhoG induction phosphate concentration changes are regulated, and the biosynthesis of phospholactam A is regulated, which solves the problem of low yield in the prior art and achieves efficient natural product synthesis and dynamic regulation.
Patent Information
- Application Number
- CN202510668285.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-08-15
AI Technical Summary
In the prior art, the yield of phospholactam A is extremely low, which seriously restricts its functional research and engineering development. Moreover, the application of phosphorus signal sensing systems in the synthesis of phospholactam natural products has not been reported in literature.
It provides a histidine kinase PhoG, which regulates the biosynthesis of phospholactam A, a natural phosphonic acid product, constructs a recombinant plasmid and is heterologously expressed in actinomycetes, activates the expression of downstream biosynthetic gene clusters.
Under the conditions of optimal Pi concentration, the yield of phospholactam A, a natural product of phospholic acid in phoG gene-retaining strain, has increased by more than 10 times, realizing dynamic response and regulation of phosphate concentration, and improving the synthesis efficiency and yield of natural products.
Smart Images

Figure CN120485153A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of bioengineering and microbial secondary metabolism regulation, and in particular to a histidine kinase PhoG that can sense changes in phosphate concentration in the external environment and its application. Background Art
[0002] Phospholactam A is a pyrrolidone-based phosphonic acid natural product whose molecular backbone contains both a five-membered nitrogen heterocycle and a phosphonamide group. Similar in structure to SF2312, both are pyrrolidone-based phosphonic acid natural products. These compounds have been reported to exhibit excellent antibacterial and antitumor activities. However, the production of phospholactam A in its natural host is extremely low, severely hindering its functional research and engineering development. Therefore, increasing the production of phospholactam A is a key bottleneck in the current research of this class of phosphonic acid natural products.
[0003] Phosphonates, due to their stable CP bond structure and wide range of biological activities, hold an important position in the natural product family. However, most phosphonate natural products generally suffer from limited expression and low yield. The synthesis of such secondary metabolites by microorganisms is usually regulated by external environmental factors, among which the concentration of inorganic phosphate (Pi) is one of the important influencing factors. As a core component of basic structures and energy molecules such as nucleic acids, phospholipids and adenosine triphosphate (ATP), phosphorus is an indispensable element in the growth, metabolism and environmental adaptation of microorganisms. Under natural conditions where phosphorus is scarce, microorganisms need to selectively synthesize secondary metabolites by regulating metabolic flux distribution.
[0004] Among numerous regulatory mechanisms, the two-component system (TCS) is a widespread class of environmentally responsive regulatory modules found in prokaryotes. Typically composed of a histidine kinase (HK) and a response regulator (RR), TCSs sense external signals and transduce them into the cell, regulating the expression of downstream gene clusters. Currently, this system has been extensively studied and applied in fields such as antibiotic synthesis, cell differentiation, and osmotic pressure regulation. However, its application in regulating the synthesis of phosphonic acid natural products has not yet been reported. In particular, the connection between phosphorus signaling systems and the biosynthesis of phosphonic acid natural products remains largely unexplored. Summary of the Invention
[0005] To increase the yield of phosphonic acid natural products, a secondary metabolite of microorganisms, the present invention provides a histidine kinase PhoG that can sense changes in phosphate concentration in the external environment and its application. The histidine kinase PhoG of the present invention is encoded by the phoG gene of the actinomycete Streptomyces sp. M10731. The phoG gene can regulate the transcriptional expression of the biosynthetic gene cluster (BGC) of the downstream phosphonic acid natural product phospholactam A under different inorganic phosphorus (Pi) conditions, thereby affecting the synthesis of the phosphonic acid natural product phospholactam A.
[0006] One of the technical solutions of the present invention is to provide a molecular element that can sense changes in phosphate concentration in the external environment. The molecular element is selected from any one of histidine kinase PhoG and homologous proteins with a similarity of more than 50% thereto. The nucleotide sequence of the phoG gene encoding histidine kinase is shown in SEQ ID NO.1.
[0007] The second technical solution of the present invention is to provide the use of a molecular element that can sense changes in phosphate concentration in the external environment as described in one of the above technical solutions in regulating the biosynthesis of phosphonic acid natural products.
[0008] In some embodiments, the molecular element regulates the biosynthesis of phosphonic acid natural products within the phosphate concentration range of 0.3 mM to 5.1 mM.
[0009] In some embodiments, the phosphonic acid natural product is phospholactam A or other phosphonic acid natural products containing phosphonic acid groups / phosphinic acid groups.
[0010] In some embodiments, the molecular element promotes the biosynthesis of the phosphonic acid natural product phospholactam A within the phosphate concentration range of 0.6 mM to 2.6 mM.
[0011] The third technical solution of the present invention is to provide a microorganism for regulating the biosynthesis of phosphonic acid natural products, wherein the microorganism comprises the molecular element as described in one of the above technical solutions.
[0012] A fourth technical solution of the present invention is to provide a method for regulating the biosynthesis of phosphonic acid natural products using the molecular element described in one of the above technical solutions, comprising the following steps:
[0013] S1. Constructing a recombinant plasmid, wherein the recombinant plasmid comprises a phosphonic acid natural product biosynthetic gene cluster and a phoG gene encoding a histidine kinase, or the recombinant plasmid comprises a phosphonic acid biosynthetic gene cluster containing a phoG gene encoding a histidine kinase;
[0014] S2. The recombinant plasmid obtained in step S1 is transferred into actinomycetes for heterologous expression, and the yield of the phosphonic acid natural product is regulated under different phosphate concentration conditions.
[0015] In some specific embodiments, in step S1, the phosphonic acid natural product biosynthetic gene cluster and the phoG gene encoding histidine kinase or the phosphonic acid natural product phospholactam A biosynthetic gene cluster containing the phoG gene encoding histidine kinase are ligated with the pSET152 vector to construct a recombinant plasmid, wherein the nucleotide sequence of the phosphonic acid natural product phospholactam A biosynthetic gene cluster containing the phoG gene encoding histidine kinase is shown in SEQ ID NO.2.
[0016] The phoG gene, located upstream of the biosynthetic gene cluster for the phosphonic acid natural product phospholactam A, responds to external inorganic phosphorus concentration signals to activate the expression of downstream biosynthetic gene clusters, thereby regulating the synthesis rate and accumulation level of the target product. By regulating the uptake, intracellular transport, and extracellular accumulation of phosphorus resources in the metabolic pathway, the phoG gene improves the substrate supply efficiency for natural product synthesis.
[0017] In some specific embodiments, in step S2, the actinomycete is Streptomyces albus J1074.
[0018] A fifth technical solution of the present invention is to provide a detection kit for indicating the concentration of available phosphate in the environment, comprising any one of the molecular elements described in one of the above technical solutions or homologous proteins with a similarity of more than 50% thereto.
[0019] The present invention discloses a natural product regulation strategy based on environmental sensing, providing new genetic elements for activating silent gene clusters and regulating the synthesis of secondary metabolites. This is a phosphorus-adaptive regulatory mechanism centered on the phoG gene encoding histidine kinase, which establishes an effective dynamic coupling between product expression and adaptation to environmental conditions. This mechanism is particularly suitable for low-expression natural product systems that are sensitive to phosphorus concentration. On the one hand, the present invention clearly reveals for the first time the functional role of histidine kinase PhoG in regulating the biosynthesis of the phosphonic acid natural product phospholactam A. Under the conditions of the optimal Pi concentration (approximately 1.26mM), strains retaining the phoG gene are able to stably synthesize the phosphonic acid natural product phospholactam A, with a yield that is more than 10 times that of mutant strains with the phoG gene knocked out, indicating that histidine kinase PhoG plays a positive regulatory role in the activation of metabolic pathway expression and product accumulation. On the other hand, the present invention found that the phoG gene encoding histidine kinase has typical inductive regulation characteristics under different exogenous inorganic phosphorus concentration conditions. In a high Pi or low Pi environment, even if the phoG gene is retained, the strain no longer synthesizes the target product, the phosphonic acid natural product phospholactam A; in the context of knocking out the phoG gene, the expression level of the phosphonic acid natural product phospholactam A is extremely low but can still be detected in trace amounts, reflecting the core position of histidine kinase PhoG in regulating Pi-dependent metabolic responses.
[0020] The histidine kinase PhoG provided by the present invention not only serves as an element for sensing signals and regulating BGC expression, but also can improve the response efficiency of chassis strains to phosphorus resources in the environment by activating auxiliary pathways such as inorganic phosphorus absorption, transport and extracellular enrichment, thereby providing a stable precursor guarantee for the synthesis of the phosphonic acid natural product phospholactam A.
[0021] The histidine kinase PhoG signaling regulatory framework constructed in this study not only provides a theoretical basis and technical support for the inducible activation of silent gene clusters, enhanced natural product expression, and the development of controllable regulatory modules, but also opens up new avenues for the innovative application of phosphorus signaling response systems in synthetic biology and metabolic engineering. As an engineered regulatory factor with multiple functions—perception, response, and regulation—histidine kinase PhoG has promising application prospects and industrial development potential. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 This is the map of the pSet152-NC19-10 kb plasmid of the present invention.
[0023] Figure 2 This is a map of the phospholactam A biosynthetic gene cluster of the present invention.
[0024] Figure 3This is the plasmid map of pSet152-NC19-10 kb-△phoG of the present invention.
[0025] Figure 4 This is the enzyme digestion identification map of the pSet152-NC19-10 kb and pSet152-NC19-10 kb-△phoG plasmids of the present invention.
[0026] Figure 5 This is a PCR amplification diagram of the phoG gene of S.albus J1074 (pSet152-NC19-10 kb-△phoG) and S.albus J1074 (pSet152-NC19-10 kb) strains for verification of the present invention.
[0027] Figure 6 The results are a comparison of the yields of the natural phosphonic acid product phospholactam A between S.albus J1074 (pSet152-NC19-10 kb-△phoG) of the present invention and S.albus J1074 (pSet152-NC19-10 kb) in YL-4 medium.
[0028] Figure 7 This is a comparison chart of the yields of the natural phosphonic acid product phospholactam A in S.albus J1074 (pSet152), S.albus J1074, S.albus J1074 (pSet152-NC19-10 kb), and S.albus J1074 (pSet152-NC19-10 kb-△phoG) of the present invention in YL-4 culture medium with different Pi concentrations. DETAILED DESCRIPTION
[0029] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments.
[0030] In the following examples, unless otherwise specified, raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art.
[0031] Example 1:
[0032] 1. Construction of recombinant expression plasmid pSET152-NC19-10 kb
[0033] This example provides a method for ligating the phospholactam A biosynthetic gene cluster with a linearized pSET152 vector using T4 DNA ligase to construct a recombinant plasmid pSET152-NC19-10 kb. The map of the recombinant plasmid pSET152-NC19-10 kb is shown in FIG. Figure 1 shown.
[0034] The nucleotide sequence of the biosynthetic gene cluster of the phosphonic acid natural product phospholactam A is shown in SEQ ID NO. 2. The biosynthetic gene cluster of the phosphonic acid natural product phospholactam A includes phoA, phoB, phoC, phoD, phoE, phoF, and phoG. Figure 2 shown.
[0035] Phospholactam A biosynthetic gene cluster (SEQ ID NO. 2):
[0036]
[0037] The nucleotide sequence of the phoG gene encoding histidine kinase is shown in SEQ ID NO.1:
[0038] tcactccggaccgctgggcacatcggattcgtcccattgagcgagcagggcgtcggcgaggtccgtgtggggctcgcccgtgtcgtcgaggctctgctcggtccagatgaccttgccgttcatgctgtaccgggttccccagcgttcggcg tactgagcgacgaggaacaggccgcggccgccttcatccgtggcggcagccttgcgcaggtgcggtgaggtgctgctgctgtcggtgacctcgcagatgagagtgcggtcgtacagcagccggaccttgatgggcggagcgccgtagcggat cgcgttggtgaccagttcgctgaggatcagctgagtcacgaagccgatatcgtccaagccccaggccgccaactggcagtcggcttgagcgcggatgagagtgacggccgccgggtcggaaggcacatcccagtcggcgagacggtcgggg tcggtcagacgggtgcgggccacaagcagggcgtaaaagcggcggcatcggtgccgatgcgttcccaagcgaccctgggggccaagcccggcgagacgagggatctcggcacgagttcgccactctggagccctcgtccgcgccgggcacac
[0039] The specific construction steps of the recombinant plasmid pSET152-NC19-10 kb are as follows:
[0040] (1) First, a ligation reaction was prepared. The reaction system included the linearized pSET152 vector, the phospholactam A biosynthetic gene cluster fragment, T4 DNA ligation buffer (10×), T4 DNA ligase, and sterile water without nuclease contamination to adjust the total volume.
[0041] The recommended molar ratio of the ligation reaction is 1:3 between vector and insert. The specific composition of the system is as follows:
[0042]
[0043] Reaction conditions: 16°C, 12 h for ligation.
[0044] in,
[0045] The linearized empty vector pSET152 was used as a template, and the primers used for linearized fragment amplification were pSET-F1 and pSET-R1. The nucleotide sequences thereof are shown in SEQ ID NOs. 3-4:
[0046] pSET-F1 (SEQ ID NO.3): 5'-ctccagaagacgatggctccgtctagaggatccgc-3';
[0047] pSET-R1 (SEQ ID NO.4): 5'-cccgtcgccctctagagtcgacctgcagcccaag-3'
[0048] The linearized reaction system is shown in the following table:
[0049]
[0050] The linearization program was set as follows: pre-denaturation at 95°C for 5 minutes, followed by denaturation at 98°C for 10 seconds. The annealing temperature was set based on the Tm value of the amplification primers. When the annealing temperature was above 55°C, the annealing time was set to 5 seconds; if it was below 55°C, the annealing time was set to 15 seconds. The extension step was performed at 72°C or 68°C, with the extension time set at 15 seconds / kb or 5 seconds / kb, respectively, depending on the size of the amplified fragment. The reaction was repeated for 30-35 cycles, followed by a final extension at 72°C for 5 minutes to obtain the linearized amplification product. The linearized amplification product was detected by electrophoresis on a 0.8% agarose gel at 180V: 1.5 μL of the amplified product was loaded, and DNA bands of the expected molecular weight were excised based on the electrophoresis results. The DNA was then purified using a PCR product recovery kit for subsequent homologous recombination assembly experiments.
[0051] (2) The electroporation operation steps are as follows: add 50 μL of the ligation reaction product with a concentration greater than 50 ng and 100 μL of Escherichia coli DH10B competent cells to a 1.8 mm electroporation cup and place them on ice for pre-cooling for 5 to 10 minutes to ensure that all materials and instruments reach a low temperature state to improve the electroporation efficiency. Set the electroporation conditions to 2.5 kV voltage, 25 μF capacitance, and 200 Ω resistance for pulse electroporation.
[0052] (3) Immediately after electroporation, add 600 μL of antibiotic-free LB medium to the electroporation cup, mix gently, and transfer to a 1.5 mL sterile centrifuge tube. Resuscitate at 37°C and 220 rpm for 1 hour. After recovery, centrifuge at 9000 rpm for 1 minute, discard the supernatant, and add 100 μL of antibiotic-free LB medium to gently resuspend the cells.
[0053] (4) Spread all resuspended cells evenly on the surface of LB solid medium containing apramycin (Apr) antibiotic to facilitate resistance screening. After spreading, incubate at 37°C in the dark for 24 hours until monoclonal colonies are formed.
[0054] (5) Select the monoclonal colonies that have grown well and inoculate them into 1 mL LB liquid culture medium containing apramycin (Apr). Shake and culture at 30°C and 220 rpm for about 12 hours. Take 1 μL of the bacterial solution as a PCR template to verify the amplification of the target fragment. The plasmids of the clones that are positive by PCR are further extracted and the enzyme digestion results are confirmed as follows: Figure 4 As shown in (A), the bands were consistent with the expected ones.
[0055] 2. Electroporate the recombinant expression plasmid pSET152-NC19-10 kb into Escherichia coli ET12567 / pUZ8002
[0056] (1) Place 100 μL of competent E. coli ET12567 / pUZ8002 culture medium and 50 μL of recombinant expression plasmid pSET152-NC19-10 kb (with a concentration greater than 50 ng) in a 1.8 mm electroporation cuvette. Gently pipette to mix thoroughly and pre-cool for 5 to 10 minutes.
[0057] (2) Set the electroporation parameters to 2.5 kV voltage, 25 μF capacitance, and 200 Ω resistance for electroporation.
[0058] (3) After the electroporation, 1000 μL of LB liquid medium without antibiotics was immediately added to the electroporation cup. After mixing, the bacterial solution was transferred to a 1.5 mL sterile centrifuge tube and resuscitated at 37°C and 220 rpm for about 1 hour.
[0059] (4) After recovery, centrifuge at 12,000 rpm for 1 min, discard 900 μL of supernatant, resuspend the bacteria in 100 μL of liquid, and evenly spread on an LB solid plate containing kan and chl resistance. Incubate inverted at 37°C for 12-16 h to allow colonies to grow.
[0060] 3. Construction of Streptomyces albus J1074 (pSET152-NC19-10 kb)
[0061] This embodiment provides a method for introducing a recombinant expression plasmid into a Streptomyces host strain, Streptomyces albus J1074, through biparental conjugation transfer.
[0062] (1) Pick a single clone of the donor strain Escherichia coli ET12567 / pUZ8002 containing the target expression plasmid pSET152-NC19-10kb and inoculate it into 6 mL of LB liquid medium containing Apr antibiotics. Incubate it at 37°C and 220 rpm overnight. The next day, inoculate it into 2 mL of fresh resistant LB liquid medium at a volume ratio of 5% and continue to culture for 3-4 hours. 600 When the value reaches 0.4-0.6, take 2 mL of bacterial solution and place it in a sterile EP tube, centrifuge at 4000 rpm for 2 min, and discard the supernatant.
[0063] (2) The collected donor bacterial cells were gently resuspended in 2 mL of antibiotic-free LB medium, then centrifuged and washed twice to completely remove the resistant components. Finally, the cells were resuspended in 800 μL of antibiotic-free LB medium for later use.
[0064] (3) Pretreatment of Streptomyces (S.albus J1074) spores: 5 mL of TES buffer was added dropwise to the surface of the solid culture medium for culturing S.albus J1074. The S.albus J1074 spores were gently scraped with a sterile cotton swab and collected in a sterile 50 mL centrifuge tube. The tube was centrifuged at 12,000 rpm for 10 min and the supernatant was discarded. The spores were resuspended in 5 mL of TES buffer and heat-shocked in a 50°C water bath for 10 min. Subsequently, 5 mL of 2× spore pre-germination solution and 10 μL of 5 M CaCl2 solution were added and the tube was cultured at 37°C and 220 rpm for 2 h. After treatment, the tube was centrifuged at 12,000 rpm for 10 min, the supernatant was discarded, and the spores were resuspended in 300 μL of LB medium without antibiotics for later use.
[0065] (4) In the conjugation transfer operation between the two parents, 50-200 μL of the treated Streptomyces spore suspension was mixed evenly with the prepared donor bacterial solution at a volume ratio of 1:1, 1:2, and 2:1. The mixed bacterial solution was added dropwise and evenly spread onto the surface of the MS solid culture medium plate. The plate was allowed to stand and air-dry in a clean bench for about 12 hours. After ensuring that the surface of the culture medium was completely dry, it was transferred to a 30°C constant temperature incubator for upright culture for 15-17 hours.
[0066] (5) After the initial culture, prepare an antibiotic mixture (add 30 μL of nalidixic acid and 24 μL of apramycin per 1 mL of sterile water) and spread the antibiotic solution evenly on the surface of the conjugation culture plate. After the plate is blown dry, continue to invert and culture at 30°C for 3 days to screen for conjugants.
[0067] (6) During the screening step, observe whether the surface of the screening plate has grown conjugative colonies. Pick a single colony and streak it onto a MS solid resistance plate containing apramycin. Incubate at 30°C for 4-5 days. Then pick a single colony and inoculate it into 3 mL of TSB liquid medium containing apramycin and nalidixic acid. Incubate at 30°C and 220 rpm for 24-48 hours.
[0068] (7) The pSET152-NC19-10 kb recombinant expression plasmid was successfully introduced into the S. albus J1074 host strain using the above-mentioned conjugation transfer method. PCR was also used to amplify and verify the upstream and downstream junction regions of the plasmid in the recombinant strain to ensure complete insertion of the target fragment and verify its correctness.
[0069] Comparative Example:
[0070] 1. Construction of recombinant expression plasmid pSET152-NC19-10 kb-△phoG
[0071] This example provides a method for constructing a recombinant expression plasmid pSET152-NC19-10 kb-△phoG lacking the phoG gene based on a multi-fragment homologous recombination strategy. The resulting plasmid pSET152-NC19-10 kb-△phoG is shown in the figure. Figure 3 As shown, the enzyme cleavage pattern is as follows Figure 4 (B) shown.
[0072] The specific steps for constructing the plasmid pSET152-NC19-10 kb-△phoG are as follows:
[0073] (1) Using the recombinant plasmid pSET152-NC19-10 kb prepared in the example as a template, high-fidelity PCR was used to amplify two DNA fragments: an upstream region fragment without the phoG gene, a downstream region fragment without the phoG gene, and a linearized pSET152 empty vector backbone fragment.
[0074] The primers used for amplifying the upstream region fragment that does not contain the phoG gene are ΔphoG-1-F and ΔphoG-1-R, and their nucleotide sequences are shown in SEQ ID NOs. 5-6:
[0075] △phoG-1-F (SEQ ID NO.5): 5'-gcgagactgaaagcagggcgtaaaagcggc-3';
[0076] ΔphoG-1-R (SEQ ID NO. 6): 5'-tggacgggcgcaccaactc-3'.
[0077] The primers used for amplifying the downstream region fragment that does not contain the PhoG gene are ΔphoG-2-F and ΔphoG-2-R, and their nucleotide sequences are shown in SEQ ID NOs. 7-8:
[0078] △phoG-2-F (SEQ ID NO.7): 5'-gagttggtgcgcccgtccacc-3';
[0079] ΔphoG-2-R (SEQ ID NO. 8): 5'-gctatgagaaagcgccacgct-3'.
[0080] The primers used for amplification of the linearized pSET152 vector fragment were pSET-F and pSET-R, and their nucleotide sequences are shown in SEQ ID NOs. 9 to 10:
[0081] pSET-F2 (SEQ ID NO.9): 5'-agcgtggcgctttctcatagc-3';
[0082] pSET-R2 (SEQ ID NO. 10): 5'-gccctgctttcagtctcgccggcaggc-3'.
[0083] (2) The total volume of the PCR amplification system is 20 μL, and the amplification system includes 10 μL KOD One TM PCR Master Mix.
[0084] The reaction system is shown in the following table:
[0085]
[0086] The PCR program was set as follows: pre-denaturation at 95°C for 5 minutes, denaturation at 98°C for 10 seconds, and annealing temperature was set according to the Tm value of the amplification primer. When the annealing temperature was above 55°C, the annealing time was set to 5 seconds; if it was below 55°C, the annealing time was set to 15 seconds. The extension step was performed at 72°C or 68°C, with the extension time set at 15 seconds / kb or 5 seconds / kb, respectively, depending on the size of the amplified fragment. The entire reaction was repeated for 30-35 cycles, followed by a final extension at 72°C for 5 minutes to obtain the PCR product. The PCR amplification product was detected by electrophoresis on a 0.8% agarose gel at 180V: 1.5 μL of the amplified product was loaded, and DNA bands of the expected molecular weight were excised based on the electrophoresis results. The DNA was then recovered and purified using a PCR product purification kit for use in subsequent homologous recombination assembly experiments.
[0087] (3) Fragment assembly was performed using the 2×MultiF Seamless Assembly Mix homologous recombination enzyme system provided by ABclonal. Through a seamless connection strategy based on homologous sequence recombination, the upstream and downstream region fragments without phoG were efficiently assembled with the linearized pSET152 backbone fragment to achieve the construction of the target plasmid pSET152-NC19-10 kb-△phoG.
[0088] In the assembly reaction system, the optimal amount of linearized vector is set to 0.03 pmol, and the molar ratio of insert to vector is 1:2 or 1:3. This example uses 1:2 as an example for calculation. The dosage conversion formula is as follows:
[0089] X = optimal linearization vector dosage (0.03 pmol) / fragment recovery concentration = 0.02 × base pairs (bp) ng / fragment
[0090] Recovery concentration = 0.02 × 6084 bp = 121.68 ng / fragment recovery concentration;
[0091] Y = optimal amount of inserted fragment (0.06 pmol) / fragment recovery concentration = 0.02 × number of base pairs (bp) ng / fragment recovery concentration = 0.02 × 4851 bp = 97.02 ng / fragment recovery concentration.
[0092] Z = optimal amount of insert (0.06 pmol) / fragment recovery concentration = 0.02 × number of base pairs (ng) / fragment recovery concentration
[0093] =0.02×4988bp=99.76ng / fragment recovery concentration
[0094] The reaction system is as follows:
[0095]
[0096]
[0097] Reaction conditions: 50°C, 40 min.
[0098] 2. Electroporate the recombinant expression plasmid pSET152-NC19-10 kb-△phoG into Escherichia coli ET12567 / pUZ8002
[0099] (1) Place 100 μL of competent E. coli ET12567 / pUZ8002 culture medium and 50 μL of recombinant expression plasmid pSET152-NC19-10 kb-△phoG (with a concentration greater than 50 ng) in a 1.8 mm electroporation cuvette. Gently pipette to mix thoroughly and precool for 5 to 10 minutes.
[0100] (2) Set the electroporation parameters to 2.5 kV voltage, 25 μF capacitance, and 200 Ω resistance for electroporation.
[0101] (3) After the electroporation, 1000 μL of LB liquid medium without antibiotics was immediately added to the electroporation cup. After mixing, the bacterial solution was transferred to a 1.5 mL sterile centrifuge tube and resuscitated at 37°C and 220 rpm for about 1 hour.
[0102] (4) After recovery, centrifuge at 12,000 rpm for 1 min, discard 900 μL of supernatant, resuspend the bacteria in 100 μL of liquid, and evenly spread on an LB solid plate containing kan and chl resistance. Incubate inverted at 37°C for 12-16 h to allow colonies to grow.
[0103] 3. Construction of Streptomyces albus J1074 (pSET152-NC19-10 kb-△phoG)
[0104] This embodiment provides a method for introducing a recombinant expression plasmid into a Streptomyces host strain, Streptomyces albus J1074, through biparental conjugation transfer.
[0105] (1) Pick a single clone of the donor strain Escherichia coli ET12567 / pUZ8002 containing the target expression plasmid pSET152-NC19-10kb-△phoG and inoculate it into 6 mL of LB liquid medium containing Apr antibiotics. Incubate it at 37°C and 220 rpm overnight. The next day, inoculate it into 2 mL of fresh resistant LB liquid medium at a volume ratio of 5% and continue to culture for 3-4 hours. 600 When the value reaches 0.4-0.6, take 2 mL of bacterial solution and place it in a sterile EP tube, centrifuge at 4000 rpm for 2 min, and discard the supernatant.
[0106] (2) The collected donor bacterial cells were gently resuspended in 2 mL of antibiotic-free LB medium, then centrifuged and washed twice to completely remove the resistant components. Finally, the cells were resuspended in 800 μL of antibiotic-free LB medium for later use.
[0107] (3) Pretreatment of Streptomyces (S.albus J1074) spores: 5 mL of TES buffer was added dropwise to the surface of the solid culture medium for culturing S.albus J1074. The S.albus J1074 spores were gently scraped with a sterile cotton swab and collected in a sterile 50 mL centrifuge tube. The tube was centrifuged at 12,000 rpm for 10 min and the supernatant was discarded. The spores were resuspended in 5 mL of TES buffer and heat-shocked in a 50°C water bath for 10 min. Subsequently, 5 mL of 2× spore pre-germination solution and 10 μL of 5 M CaCl2 solution were added and the tube was cultured at 37°C and 220 rpm for 2 h. After treatment, the tube was centrifuged at 12,000 rpm for 10 min, the supernatant was discarded, and the spores were resuspended in 300 μL of LB medium without antibiotics for later use.
[0108] (4) In the conjugation transfer operation between the two parents, 50-200 μL of the treated Streptomyces spore suspension was mixed evenly with the prepared donor bacterial solution at a volume ratio of 1:1, 1:2, and 2:1. The mixed bacterial solution was added dropwise and evenly spread onto the surface of the MS solid culture medium plate. The plate was allowed to stand and air-dry in a clean bench for about 12 hours. After ensuring that the surface of the culture medium was completely dry, it was transferred to a 30°C constant temperature incubator for upright culture for 15-17 hours.
[0109] (5) After the initial culture, prepare an antibiotic mixture (add 30 μL of nalidixic acid and 24 μL of apramycin per 1 mL of sterile water) and spread the antibiotic solution evenly on the surface of the conjugation culture plate. After the plate is blown dry, continue to invert and culture at 30°C for 3 days to screen for conjugants.
[0110] (6) During the screening step, observe whether the surface of the screening plate has grown conjugative colonies. Pick a single colony and streak it onto a MS solid resistance plate containing apramycin. Incubate at 30°C for 4-5 days. Then pick a single colony and inoculate it into 3 mL of TSB liquid medium containing apramycin and nalidixic acid. Incubate at 30°C and 220 rpm for 24-48 hours.
[0111] (7) The pSET152-NC19-10 kb-△phoG recombinant expression plasmid was successfully introduced into the S. albus J1074 host strain using the above-mentioned conjugation transfer method. PCR was also used to amplify and verify the upstream and downstream junction regions of the plasmid in the recombinant strain to ensure complete insertion of the target fragment and verify its correctness.
[0112] To further verify the knockout of the phoG gene in the recombinant strain obtained by conjugation transfer, a specific primer pair was designed for PCR amplification detection in this comparative example. The primers are PhoG-F and PhoG-R, and their nucleotide sequences are shown in SEQ ID NOs. 11 to 12:
[0113] PhoG-F (SEQ ID NO. 11): 5'-cacaccccgaattcaggggt-3';
[0114] PhoG-R (SEQ ID NO. 12): 5'-ggctgagagtggacgcatgac-3'.
[0115] The PCR reaction system is as follows:
[0116]
[0117] The PCR reaction conditions were set as follows: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s; annealing temperature set according to the primer Tm value (annealing for 5 s when Tm ≥ 55°C, annealing for 15 s when Tm < 55°C); extension at 72°C or 68°C (15 s / kb or 5 s / kb) for a total of 30-35 cycles; final extension at 72°C for 5 min; the final product was stored at 4°C until use.
[0118] The PCR amplification products were separated by electrophoresis on a 0.8% agarose gel at 180 V and detected using a UV imager. Electrophoretic analysis revealed that the PCR amplification product of the phoG gene-containing strain was approximately 750 bp in size, while the PCR amplification product of the phoG gene-knockout strain was approximately 275 bp in size.
[0119] like Figure 5 As shown, the PCR amplification product of the S.albus J1074 (pSet152-NC19-10 kb) strain (hereinafter referred to as WT) was approximately 750 bp, which was in line with expectations; while the PCR amplification products of each recombinant S.albus J1074 (pSet152-NC19-10 kb-△phoG) strain (sample numbers 1-7) were all around 275 bp, indicating that the phoG gene was successfully knocked out.
[0120] Test Example 1: S. albus J1074 (pSet152-NC19-10 kb) prepared in Example and S. albus J1074 (pSet152-NC19-10 kb-ΔphoG) prepared in Comparative Example were fermented to produce the phosphonic acid natural product phospholactam A.
[0121] (1) The recombinant strains of S. albus J1074 (pSet152-NC19-10 kb), S. albus J1074 (pSet152-NC19-10 kb-△phoG), and S. albus J1074 (pSet152) were evenly spread on solid MS culture plates containing 0.1% apramycin antibiotics, while the wild-type strain of S. albus J1074 was inoculated on MS solid culture plates without antibiotics and cultured in an inverted manner at 30°C for 4 days until the strain produced fully developed white spores.
[0122] (2) Using a sterile cotton swab moistened with TES buffer, gently scrape spores from the surface of the solid plate and suspend the scraped spores in 5 mL of TES buffer to prepare a spore suspension. After thorough mixing, the spore suspension was inoculated into YL-4 liquid fermentation medium at a 1.8% (v / v) inoculum level.
[0123] The YL-4 medium formula is as follows: pH 7.2, 15 g peptone, 10 g yeast extract, 8 g tryptic soytone, 20 g soluble starch, 2.5 g ammonium sulfate, 1 g sodium chloride, 3 g potassium dihydrogen phosphate, 1 g calcium carbonate, 2.5 g soybean oil. The volume is adjusted to 1 L with deionized water and sterilized at 121°C for 20 min.
[0124] (3) After inoculation, the culture was shaken at 30°C and 220 rpm for 7 days. The conical flask was sealed with eight layers of gauze to ensure good ventilation and stability of the culture system during the culture process.
[0125] (4) In order to extract the fermentation products, a fermentation broth treatment process based on methanol precipitation was adopted.
[0126] First, the fermentation broth was centrifuged at 12,000 rpm for 10 minutes at room temperature. The supernatant was collected and concentrated to dryness using a rotary evaporator. The residue was thoroughly dissolved in no more than 10 mL of ultrapure water and transferred to a sterile centrifuge tube for later use.
[0127] Then, 3 volumes of methanol were added to the above solution to a final concentration of 75%, and after thorough mixing, the solution was placed in a -20°C refrigerator for 12-15 hours to promote the precipitation of proteins and impurities.
[0128] Finally, remove the rested mixture and centrifuge at 12,000 rpm for 10 minutes. Collect the supernatant and concentrate again to dryness using a rotary evaporator. The dried sample is thoroughly dissolved twice with 1-1.5 mL of 25% deuterated water. Once completely dissolved, transfer to a 2 mL sterile EP tube and centrifuge at 12,000 rpm for 1 minute to obtain a sample for NMR analysis.
[0129] (5) The fermentation products of the phoG gene-retained strain (WT) and the phoG knockout strain (△phoG) in YL-4 medium were analyzed. The results showed that the yield of the phosphonic acid natural product phospholactam A in the phoG gene-retained strain was significantly higher than that in the phoG gene knockout strain, with the yield increased by more than ten times. Figure 6 shown.
[0130] Further combined with metabolite analysis, it was speculated that histidine kinase PhoG not only participates in the regulation of secondary metabolites by regulating the expression of downstream BGCs during signal transduction, but may also activate physiological pathways related to phosphorus absorption, transport and extracellular enrichment, optimize the chassis strain's acquisition and utilization of environmental phosphorus resources, and provide sufficient precursor guarantee and energy support for the synthesis of the phosphonic acid natural product phospholactam A.
[0131] Test Example 2: The effect of histidine kinase PhoG sensing the phosphorus element in the external environment on the production level of the phosphonic acid natural product phospholactam A in S. albus J1074 (pSet152-NC19-10 kb) and S. albus J1074 (pSet152-NC19-10 kb-△phoG).
[0132] This test example is based on the fermentation system established in Test Example 1, and further explores the effect of changes in inorganic phosphorus (Pi) concentration sensed by histidine kinase PhoG in the environment on the ability of S.albus J1074 (pSet152-NC19-10 kb) and S.albus J1074 (pSet152-NC19-10 kb-△phoG) strains to synthesize the phosphonic acid natural product phospholactam A.
[0133] Using the YL-4 liquid fermentation system in Test Example 1 as a control, fermentation cultures were performed under different Pi concentrations. The medium formulation was identical to that of YL-4, differing only in the amount of inorganic phosphorus (potassium dihydrogen phosphate) added. The specific concentrations are shown in the table below. The medium was sterilized at 121°C for 20 minutes.
[0134] Conditioned culture medium with different exogenous inorganic Pi concentrations
[0135]
[0136]
[0137] Strain culture and fermentation conditions were consistent with those in Test Example 1, i.e., spores were inoculated at a 1.8% inoculum into YL-4 medium at various Pi concentrations and cultured at 30°C, 220 rpm, and shaken for 7 days. Good ventilation was maintained during the culture process, using a gauze-sealed Erlenmeyer flask system.
[0138] After fermentation, each fermentation sample was subjected to methanol precipitation and crude extraction, referring to the method described in Test Example 1. First, the fermentation broth was centrifuged at 12,000 rpm for 10 minutes. The supernatant was collected and concentrated to dryness by rotary evaporation. The supernatant was then reconstituted with ultrapure water and mixed with methanol in a 1:3 volume ratio to a final concentration of 75%. The mixture was allowed to stand at -20°C for 12-15 hours to promote the precipitation of proteins and impurities. The supernatant was then collected by centrifugation again, dried by rotary evaporation, and finally dissolved in 25% deuterated water to prepare a solution for NMR analysis.
[0139] The samples were tested using a 600M nuclear magnetic resonance spectrometer to evaluate the synthesis level of the target product under different Pi concentration conditions. Three biological replicates were set up for each group of experiments to ensure the reliability of the data. The results are shown in Figure 2. Figure 7 shown.
[0140] In the present invention, under moderate inorganic phosphorus (Pi) concentration conditions (approximately 1.26 mM), the strain S. albus J1074 (pSET152-NC19-10 kb) containing the phoG gene can stably synthesize the phosphonic acid natural product phospholactam A at a yield of approximately 2 mg / L; while the yield of the phosphonic acid natural product phospholactam A in the phoG gene-knockout strain S. albus J1074 (pSET152-NC19-10 kb-ΔphoG) is significantly reduced to less than 0.2 mg / L, a yield difference of more than 10 times.
[0141] Based on these preliminary observations, fermentation validation experiments were further conducted under different inorganic phosphorus concentrations (high Pi concentration and low Pi concentration). The test results showed that even with the phoG gene retained, the strain failed to detect the synthesis of the phosphonic acid natural product phospholactam A in high or low Pi concentration environments. Moreover, in the phoG knockout background, the expression of the phosphonic acid natural product phospholactam A continued to remain at an extremely low level, and no significant increase in yield was observed.
[0142] Comprehensive analysis of the above experimental data shows that the histidine kinase PhoG encoded by the phoG gene can sense the optimal Pi concentration in the environment (approximately 1.26 mM) and, under this condition, positively regulate the expression level of the biosynthetic gene cluster (BGC) of the phosphonic acid natural product phospholactam A, thereby significantly improving the synthesis efficiency of the target product, the phosphonic acid natural product phospholactam A. This can provide a reference for the subsequent metabolic regulation of the production of other phosphonic acid natural products containing phosphonic acid groups / phosphinic acid groups.
[0143] The research results of the present invention determine the key role of histidine kinase PhoG in the regulation mechanism of phosphorus signal response of natural products, and at the same time provide a solid theoretical basis and operational technical support for optimizing the production of phosphonic acid natural product phospholactam A or other phosphonic acid natural products containing phosphonic acid groups / phosphinic acid groups based on environmental factor regulation.
[0144] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.
Claims
1. A molecular element that can sense changes in phosphate concentration in the external environment, characterized in that: The molecular element is selected from any one of histidine kinase PhoG and its homologous proteins with a similarity of more than 50%, and the nucleotide sequence of the phoG gene encoding histidine kinase is shown in SEQ ID NO.
1.
2. Use of the molecular element according to claim 1 that can sense changes in phosphate concentration in the external environment in regulating the biosynthesis of phosphonic acid natural products.
3. The use according to claim 2, characterized in that When the phosphate concentration varies within the range of 0.3 mM to 5.1 mM, the molecular element regulates the biosynthesis of phosphonic acid natural products.
4. The use according to claim 3, characterized in that The phosphonic acid natural product is phospholactam A or other phosphonic acid natural products containing phosphonic acid groups / phosphinic acid groups.
5. The use according to claim 3, characterized in that When the phosphate concentration varies within the range of 0.6 mM to 2.6 mM, the molecular element promotes the biosynthesis of the phosphonic acid natural product phospholactam A.
6. A microorganism for regulating the biosynthesis of phosphonic acid natural products, characterized in that: Comprising the molecular element according to claim 1.
7. A method for regulating the biosynthesis of phosphonic acid natural products using the molecular element according to claim 1, characterized in that: The steps include: S1. Constructing a recombinant plasmid, wherein the recombinant plasmid comprises a phosphonic acid natural product biosynthetic gene cluster and a phoG gene encoding a histidine kinase, or the recombinant plasmid comprises a phosphonic acid natural product biosynthetic gene cluster containing a phoG gene encoding a histidine kinase; S2. The recombinant plasmid obtained in step S1 is transferred into actinomycetes for heterologous expression, and the yield of the phosphonic acid natural product is regulated under different phosphate concentration conditions.
8. The method according to claim 7, characterized in that In step S1, the phosphonic acid natural product biosynthetic gene cluster and the phoG gene encoding histidine kinase or the phosphonic acid natural product phospholactam A biosynthetic gene cluster containing the phoG gene encoding histidine kinase are ligated with the pSET152 vector to construct a recombinant plasmid, wherein the nucleotide sequence of the phosphonic acid natural product phospholactam A biosynthetic gene cluster containing the phoG gene encoding histidine kinase is shown in SEQ ID NO.
2.
9. The method according to claim 7, characterized in that In step S2, the actinomycete is Streptomyces albus J1074.
10. A detection kit for indicating the concentration of available phosphate in the environment, characterized in that: The invention comprises any one of the molecular elements according to claim 1 or homologous proteins with a similarity of more than 50% thereto.