Small nucleic acid molecule targeting lncRNA USP30-AS1 and application
By targeting small nucleic acid molecules of lncRNA USP30-AS1, especially siRNA and shRNA, the problem of lack of effective targets for breast cancer treatment is solved, inhibiting breast cancer cell proliferation and slowing down tumor growth is achieved, and new therapeutic strategies are provided.
Patent Information
- Application Number
- CN202510567707.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-15
AI Technical Summary
In the prior art, the specific role of lncRNA USP30-AS1 in cancer pathogenesis is not clear, and its regulatory role in breast cancer has not been effectively utilized, resulting in a lack of effective targets for breast cancer treatment.
Small nucleic acid molecules targeting lncRNA USP30-AS1, such as siRNA and shRNA, were designed and synthesized to lncRNA USP30-AS1, and recombinant vectors and pharmaceutical compositions were developed for delivery by regulating the expression of USP30-AS1, inhibiting its effect with the HnRNPF/p21 and EZH2/c-Myc/p21 axes.
It significantly inhibits breast cancer cell proliferation, blocks cell cycle, and slows tumor growth. Animal experiments show that the tumor growth rate of the shRNA knockdown group is significantly lower than that of the negative control group, providing a new target for breast cancer treatment.
Smart Images
Figure CN120485180A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of small nucleic acid drugs, and specifically relates to a small nucleic acid molecule targeting lncRNA USP30-AS1 and its application. Background Art
[0002] Long noncoding RNAs (lncRNAs) are transcribed by RNA polymerase II and typically consist of more than 200 nucleotides, similar in structure to mRNA molecules. LncRNAs are widely distributed throughout the human body and play a crucial role in gene expression at the epigenetic, transcriptional, and post-transcriptional levels.
[0003] Genome-wide association studies have found that many lncRNAs are associated with various human cancers. Increasing evidence shows that dysregulated lncRNA expression contributes to unrestricted proliferation, disrupted differentiation, anti-apoptosis, enhanced migration and invasion, and abnormal angiogenesis in cancer cells. Therefore, lncRNAs are becoming candidates for diagnostic and prognostic biomarkers and targets for cancer therapy. Breast cancer is the leading cause of cancer-related death in women worldwide, with high metastatic potential and poor prognosis. Increasing evidence shows that lncRNAs play a role in tumor suppression or carcinogenesis by regulating key cellular processes in cancer, including 68 cell proliferation, apoptosis, migration, invasion, epithelial-mesenchymal transition (EMT), stemness, and drug resistance.
[0004] Ubiquitin-specific peptidase 30 antisense RNA1 (USP30-AS1) is a recently discovered lncRNA located on chromosome 12 (q24.11). It is transcribed from the antisense strand of USP30, a mitochondrially localized deubiquitinase known to inhibit mitophagy. USP30-AS1 is upregulated in cervical cancer, glioblastoma, and acute myeloid leukemia (AML), playing a role in promoting tumor progression. In cervical cancer cells, loss of USP30-AS1 inhibits cell proliferation and invasion while promoting apoptosis through the USP30-AS1 / miR-299-3p / PTP4A1 axis. USP30-AS1 inhibits autophagy and disrupts mitochondrial homeostasis in glioblastoma cells, a mechanism associated with poor survival outcomes in patients with primary and recurrent gliomas. In AML, USP30-AS1 promotes disease progression by cis-regulating adjacent genes. 90 Conversely, USP30-AS1 is downregulated in colon cancer tissues, and its forced expression inhibits malignant progression by targeting miR-765, suggesting a tumor suppressor role. These findings highlight the dual regulatory role of USP30-AS1 in cancer development. However, its specific role in cancer pathogenesis remains unclear and requires further investigation. Summary of the Invention
[0005] The inventors discovered that the lncRNA USP30-AS1 is significantly upregulated in breast cancer tissues. They further elucidated that the transcription factor SPI1 acts upstream to regulate USP30-AS1 expression. Gene set enrichment analysis revealed that USP30-AS1 is involved in signaling pathways that control cell proliferation. In vitro and in vivo experiments demonstrated that knockdown of USP30-AS1 inhibits breast cancer cell proliferation and tumor growth by upregulating CDKN1A / p21 expression. Based on these findings, the present invention was developed.
[0006] The first aspect of the present invention provides a small nucleic acid molecule targeting lncRNA USP30-AS1, wherein the small nucleic acid molecule is siRNA, shRNA or antisense oligonucleotide;
[0007] The siRNA comprises a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is any one of SEQ ID NOs: 1 to 2, or is a nucleotide sequence obtained by chemically modifying the nucleotide sequence of any one of SEQ ID NOs: 1 to 2;
[0008] The nucleotide sequence of the shRNA is shown in any one of SEQ ID NOs: 3 to 4.
[0009] According to a specific embodiment of the present invention, the nucleotide sequence of the siRNA molecule is:
[0010] Sense strand: 5′-GCGACUUUGGAAACUCCAUdTdT-3′ (SEQ ID NO: 1);
[0011] Antisense strand: 5′-AUGGAGUUUCCAAAGUCGCdTdT-3′ (SEQ ID NO: 5);
[0012] Or:
[0013] Sense strand: 5′-GGCCCAUCUCUGACGAUAUdTdT-3′ (SEQ ID NO: 2);
[0014] Antisense strand: 5'-AUAUCGUCAGAGAUGGGCCdTdT-3' (SEQ ID NO: 6).
[0015] According to a specific embodiment of the present invention, the sequence of the shRNA molecule is:
[0016] shRNA sequence 1:
[0017] 5'-GGGTCAGGCCTCTGCTATAATTTCAAGAGAATTATAGCAGAGG CCTGACCCTT-3' (SEQ ID NO: 3), wherein GGGTCAGGCCTCTGCTATAAT is the targeting sequence, or,
[0018] shRNA sequence 2:
[0019] 5'-GCAGAGGAAGGAACTTTAATGTTCAAGAGACATTAAAGTTCCT TCCTCTGCTT-3' (SEQ ID NO: 4), wherein GCAGAGGAAGGAACTTTAATG is the targeting sequence.
[0020] According to a preferred embodiment of the present invention, the chemical modification is at least one of the following modifications:
[0021] (1) Modification of the phosphodiester bonds connecting nucleotides in the siRNA nucleotide sequence;
[0022] (2) modification of the 2'-OH group of ribose in the nucleotide sequence of the siRNA;
[0023] (3) Modification of bases in the nucleotide sequence of the siRNA.
[0024] The second aspect of the present invention provides a recombinant vector comprising the above-mentioned shRNA, wherein the recombinant vector includes but is not limited to a lentiviral vector, an adeno-associated virus (AAV) vector or a plasmid.
[0025] A third aspect of the present invention provides a pharmaceutical composition comprising the aforementioned small nucleic acid molecule or the aforementioned recombinant vector and a pharmaceutically acceptable delivery system, including but not limited to lipid nanoparticles, cationic polymers, or exosomes.
[0026] The fourth aspect of the present invention provides a conjugate, which contains the above-mentioned small nucleic acid molecule and a conjugation group conjugated to the small nucleic acid molecule.
[0027] The fifth aspect of the present invention provides a kit, which contains the aforementioned small nucleic acid molecule, the aforementioned recombinant vector, the aforementioned pharmaceutical composition, or the aforementioned conjugate.
[0028] The sixth aspect of the present invention provides at least one of the following uses of the aforementioned small nucleic acid molecule or the aforementioned recombinant vector:
[0029] (1) preparing drugs for treating breast cancer;
[0030] (2) Preparation of breast cancer cell proliferation inhibitors;
[0031] (3) Preparation of breast cancer cell cycle inhibitors.
[0032] By validating the key role of USP30-AS1 in breast cancer progression through the HnRNPF / p21 and EZH2 / c-Myc / p21 axes, researchers identified USP30-AS1 as a potential therapeutic target for breast cancer intervention. Furthermore, they designed and synthesized small nucleic acid molecules targeting the lncRNA USP30-AS1. Experimental results demonstrated that both siRNA and shRNA significantly inhibited target gene expression and breast cancer cell proliferation. Animal experiments demonstrated that tumor growth in the shRNA knockdown group was significantly lower than in the negative control group.
[0033] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] The above and other objects, features and advantages of the present invention will become more apparent through a more detailed description of exemplary embodiments of the present invention with reference to the accompanying drawings.
[0035] Figure 1 It was shown that the long noncoding nucleic acid UP30-AS1 is highly expressed in breast cancer cells and tissues.
[0036] Figure 2 The results of small nucleic acid knockdown efficiency verification are shown: (a) USP30-AS1 siRNA#1 and siRNA#2 were transfected into MDA-MB-231 cells, and the knockdown efficiency was detected by qRT-PCR; (b) The cells were infected with lentivirus to construct a stable knockdown cell line, and the knockdown efficiency of shRNA#1 and shRNA#2 was analyzed by qRT-PCR.
[0037] Figure 3 The results show that small nucleic acids inhibit breast cancer cell proliferation: (a) USP30-AS1 was knocked down in MDA-MB-231 cells by transient siRNA transfection and stable shRNA transfection, and the cell proliferation ability was detected by CCK-8 assay (n=3); (b) USP30-AS1 was knocked down by transient or stable transfection in MDA-MB-231 cells, and the cell cloning ability was determined by clonogenic assay.
[0038] Figure 4 The results show that small nucleic acids induce tumor cell cycle arrest: (a) MDA-MB-231 cells were transiently transfected with siRNA, and the cell cycle distribution was analyzed by flow cytometry; (b) MDA-MB-231 cells were transfected with siRNA, and the proportion of cells in the S phase was analyzed by EdU kit.
[0039] Figure 5The figure shows the tumor-bearing mouse experiment confirming that USP30-AS1 small nucleic acid inhibits tumor proliferation: (a) tumor proliferation curve; (b) mouse weight curve; (c) tumor was removed and photographed after the experiment; (d) tumor tissue HE staining was used to observe cell density and pathological characteristics. DETAILED DESCRIPTION
[0040] The preferred embodiments of the present invention will be described in more detail below. Although the preferred embodiments of the present invention are described below, it should be understood that the present invention can be implemented in various forms and should not be limited to the embodiments set forth herein.
[0041] In the examples, if the specific conditions are not specified, all experiments were carried out under conventional conditions or those recommended by the manufacturer. All reagents or instruments used, if the manufacturer is not specified, are commercially available conventional products.
[0042] In the following embodiments:
[0043] Bioinformatics Analysis: RNAseq data were obtained from The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO), and The Cancer Cell Line Encyclopedia (CCLE) databases. Because USP30-AS1 is the antisense transcript of USP30, meaning its transcription direction is opposite to that of USP30, base calling can distinguish the two by analyzing the transcription direction in the RNA-seq data: USP30 transcripts read in one direction, while USP30-AS1 transcripts read in the opposite direction. By aligning the sequencing data with a reference transcriptome, base calling can further identify specific exon-intron structures or splice variants, allowing precise differentiation of the two gene transcripts. Combining base calling results with the alignment tool HISAT2 and the annotation tool StringTie provides detailed transcript annotation information, enabling accurate differentiation of USP30 and USP30-AS1 transcripts. Expression data for USP30-AS1 were further extracted, and the median values of different groups were further analyzed using the Mann-Whitney U test.
[0044] Transfection and Construction of Stable Cell Lines: siRNAs targeting USP30-AS1, HnRNPF, and a negative control (siNC) and their respective shRNAs were synthesized by Gene Pharma (Shanghai, China). The USP30-AS1-expressing plasmid pcDNA3.1-USP30-AS1 (Hunan, China) was constructed, and pMyc-TA-luc (#D2198-100 μg) and pRL-TK (#D2760-100 μg") plasmids were obtained from Beyotime (Shanghai, China). Transfection was performed using Jetprime (polyplus, #10100046). Lentivirus-infected cells were cultured in medium containing 2 mg / mL puromycin (Beyotime, ST551) for selection and generation of stable cell lines.
[0045] The sequence information of siRNA and shRNA is as follows:
[0046]
[0047] Cell culture: MDA-MB-231, MCF-7, and HEK-293 cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, USA). MDA-MB-231 and HEK-293 cells were cultured in DMEM medium containing 4.5 g / L d-glucose (Gibco, New York, USA), and MCF-7 cells were cultured in RPMI 1640 medium (Gibco, New York, USA). All culture media were supplemented with 10% FBS (Biowest, France) and 1% antibiotic-antimycotic (Sangon Biotech, #E607011). Cells were incubated in a 37°C humidified incubator containing 5% CO2.
[0048] qRT-PCR: RNA was harvested using Trizol 156 reagent (Thermo Fisher, #15596026) and then reverse transcribed into cDNA. SYBR Green-based real-time qPCR was used to detect gene expression (Trans, #AQ601), which was calculated using 2-ΔΔCt.
[0049] In situ hybridization: RNA FISH of USP30-AS1 was performed using Stellaris TMThe designed probe was used. Briefly, cells were cultured on round coverslips and fixed for 5 minutes. In addition, 0.1% Triton X-100 was used to permeabilize the cells. USP30-AS1 RNA was labeled with a specific fluorescent probe in a molecular hybridization box at 37°C overnight. Then, the cells were washed and treated with DAPI (Beyotime, #P0131-25ml). Finally, the cells were imaged using an Olympus FV1000 microscope. A specific fluorescent probe was used to bind to USP30-AS1, which exhibited red fluorescence under 555nm excitation light.
[0050] Flow cytometry: Cells were fixed with 70% ethanol overnight at 4°C. The cells were centrifuged and the cell pellet was resuspended in PBS containing propidium iodide (Sigma, P4170). Cell cycle distribution was analyzed using a CytoFLEX flow cytometer (Beckman, USA).
[0051] EdU assay: Cells were labeled with 10 μM 5-ethynyl-2'-deoxyuridine (EdU) and incubated at 37°C for 2 hours. Cells were then fixed with 3.7% paraformaldehyde for 15 minutes and permeabilized with 0.5% Triton-X-100 for 20 minutes before staining with ClickiT-EdU Alexa Fluor 488 (ThermoFisher, #C10637). Images were acquired using an Olympus confocal microscope (FV1000, Olympus) to analyze the proportion of EdU-positive cells.
[0052] Animal experiment: Four 5-week-old female BALB / c nude mice were purchased from Guangdong Medical Laboratory Animal Center. The mice were randomly divided into three groups, with 5 mice in each group. Control or USP30-AS1 knockout cells (1×10 6 ) was injected subcutaneously into the abdomen. Tumor size was measured every other day for four weeks using a digital caliper. After four weeks, the mice were euthanized, and tumor tissue was harvested and prepared into tissue sections for immunohistochemistry (IHC) and hematoxylin and eosin (HE) staining by Wuhan Savill Biotechnology Co., Ltd. The experiment was approved by the Bioethics Committee of Tsinghua University Shenzhen International Graduate School (Ethics Issue No. (2022)94).
[0053] Example 1 Verification of high expression of USP30-AS1 in breast cancer cells and tissues
[0054] Analysis of TCGA breast cancer RNA sequencing data revealed that the expression of USP30-AS1 in cancer tissues (sample number = 1104) was significantly higher than that in normal adjacent tissues (sample number = 113). Analysis of the GSE61304 dataset of the GEO database revealed that the expression of USP30-AS1 in breast cancer patient tissues (sample number = 58) was significantly higher than that in adjacent tissues (sample number = 4). Figure 1 As shown in (a).
[0055] qRT-PCR was used to analyze the expression levels of USP30-AS1 in normal breast epithelial cell line MCF10A, breast cancer cell lines MCF-7 and MDA-MB-231, and it was demonstrated that USP30-AS1 was significantly overexpressed in breast cancer tissues and cell lines (MDA-MB-231 and MCF-7). Figure 1 As shown in (b).
[0056] In situ hybridization was used to analyze the expression of USP30-AS1 in 84 adjacent paracancerous tissues and 176 breast cancer tissues. Figure 1 As shown in (c), it can be seen that USP30-AS1 is significantly overexpressed in clinical breast cancer tissue chips.
[0057] Example 2 Functional verification of small nucleic acid molecules
[0058] 1. Knockdown efficiency
[0059] (1) 100,000 to 150,000 cells were seeded in a 6-well plate. After culturing for 24 hours to allow adherence, siRNA (final concentration per well: 10 to 50 nM) was transfected into the cells using jetPRIME transfection reagent.
[0060] (2) 48 h after transfection, cells were collected and mixed by adding Trizol solution. RNA in the aqueous phase was extracted with chloroform. An equal volume of pre-cooled isopropanol solution was added and centrifuged for 10 min. The white precipitate was washed with 75% ethanol and dissolved in an appropriate amount of DEPC water to determine the RNA concentration.
[0061] (3) RNA was reverse transcribed using the TransScript All-in-One-First-Strand cDNA Synthesis SuperMix reverse transcription kit to obtain a cDNA template.
[0062] Amplification was performed by real-time quantitative PCR, and the primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The USP30-AS1 upstream primer sequence (5'-3') was CCAGAGTGGAAATAGGTCGCA (SEQ ID NO: 10), and the downstream primer sequence (5'-3') was GGCACCCAAGTAAACAATAAGT (SEQ ID NO: 11).
[0063] like Figure 2 As shown, both siRNAs can reduce the expression of target gene USP30-AS1 by more than 70% ( Figure 2 (a)); Stable knockdown cell lines were constructed using lentiviral stable transfection technology, and qRT-PCR demonstrated that the two shRNAs could significantly inhibit the expression of endogenous target genes, with a knockdown efficiency of more than 50% ( Figure 2 (b)).
[0064] 2. Inhibit tumor cell proliferation
[0065] After USP30-AS1 was knocked down in MDA-MB-231 cells, the cell proliferation ability was detected by CCK8 assay, and the cell clone formation ability was detected by clone formation assay.
[0066] (1) CCK-8 experiment: 2×10 3 Treated cells (containing 100 μL culture medium) were plated in a 96-well plate, with 5 replicate wells set up for each group, and a total of 5 parallel 96-well plates were set up for cell culture. One 96-well plate was taken out at different time periods (0, 24, 48, 72, and 96 h), and the culture medium was replaced with fresh culture medium containing CCK8 solution (10 μL CCK-8 solution and 90 μL complete culture medium). The cells were incubated in a 37°C incubator for 1 h, and the OD450 nm of each well was measured after gently shaking to mix.
[0067] (2) Clone formation assay: 1,000 cells were seeded per well of a 6-well plate, with three replicates per group. Cell clones were formed after 10-14 days of culture. After the experiment, the cell culture medium was removed and the cells were gently rinsed twice with PBS. 1 mL of 4% paraformaldehyde was added to each well for 15 min, followed by two rinses with PBS. 1 mL of 4% crystal violet solution was added for staining for 15 min, and the excess crystal violet solution was washed away with PBS. Finally, images were captured with a camera, and the number of colonies was counted using Image J software.
[0068] The results showed that silencing the expression of USP30-AS1 by siRNA or shRNA would reduce the proliferation ability of MDA-MB-231 cells ( Figure 3(a)). The results of the clone formation experiment showed that the number of monoclonal clones formed by MDA-MB-231 cells was significantly reduced after knocking down USP30-AS1, indicating that inhibiting the expression of USP30-AS1 can significantly weaken the cell clone formation ability ( Figure 3 (b)).
[0069] 3. Arrest of cell cycle
[0070] The effect of USP30-AS1 small nucleic acid on breast cancer cell cycle was detected by flow cytometry. MDA-MB-231 cells were transiently transfected with siRNA for 48-72 hours, and then the cells were collected and stained with propidium iodide (PI). The results showed that both siRNAs could significantly increase the ratio of cells in the G0 / G1 phase ( Figure 4 (a)). The proportion of cells in the S phase was accurately analyzed using an EdU immunofluorescence kit. The results showed that siRNA inhibited DNA replication and significantly reduced the number of cells in the S phase ( Figure 4 (b)).
[0071] 4. Tumor-bearing mouse experiments:
[0072] An MDA-MB-231 cell line xenograft tumor model was established (experimental groups: shNC negative control group, shUSP30-AS1#1 knockdown group, and shUSP30-AS1#2 knockdown group). Starting from the 7th day after transplantation, the tumor volume was measured with a vernier caliper every two days, and the weight change trend was recorded simultaneously. The results showed that the tumor growth rate in the shRNA knockdown group was significantly lower than that in the negative control group, but there was no effect on the animal body weight ( Figure 5 (a)-(b)). At the end of the experiment, the tumor was completely removed and morphological photos were taken. The tumor tissue was stained with hematoxylin-eosin (HE) to observe the tumor cell density and pathological characteristics. Results: The tumors in the shRNA knockdown group were smaller and accompanied by extensive cell death areas ( Figure 5 (c)-(d)).
[0073] While various embodiments of the present invention have been described above, the above description is intended to be illustrative, not exhaustive, and not limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments.
Claims
1. A small nucleic acid molecule targeting lncRNA USP30-AS1, characterized in that: The small nucleic acid molecule is siRNA, shRNA or antisense oligonucleotide; The siRNA comprises a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is any one of SEQ ID NOs: 1 to 2, or is a nucleotide sequence obtained by chemically modifying the nucleotide sequence of any one of SEQ ID NOs: 1 to 2; The nucleotide sequence of the shRNA is shown in any one of SEQ ID NOs: 3 to 4.
2. The small nucleic acid molecule targeting lncRNA USP30-AS1 according to claim 1, characterized in that The nucleotide sequence of the siRNA molecule is: Sense strand: 5′-GCGACUUUGGAAACUCCAUdTdT-3′; Antisense strand: 5′-AUGGAGUUUCCAAAGUCGCdTdT-3′; Or: Sense strand: 5′-GGCCCAUCUCUGACGAUAUdTdT-3′; Antisense strand: 5′-AUAUCGUCAGAGAUGGGCCdTdT-3′.
3. The small nucleic acid molecule targeting lncRNA USP30-AS1 according to claim 1 or 2, characterized in that The chemical modification is at least one of the following modifications: (1) Modification of the phosphodiester bonds connecting nucleotides in the siRNA nucleotide sequence; (2) modification of the 2'-OH group of ribose in the nucleotide sequence of the siRNA; (3) Modification of bases in the nucleotide sequence of the siRNA.
4. A recombinant vector, characterized in that The recombinant vector comprises the shRNA according to any one of claims 1 to 3.
5. The recombinant vector according to claim 4, characterized in that The vector is selected from a lentiviral vector, an adeno-associated viral vector or a plasmid.
6. A pharmaceutical composition, characterized in that The pharmaceutical composition contains the small nucleic acid molecule according to any one of claims 1 to 3 or the recombinant vector according to claim 4 or 5, and a pharmaceutically acceptable delivery system.
7. The pharmaceutical composition according to claim 6, characterized in that The delivery system is selected from lipid nanoparticles, cationic polymers or exosomes.
8. A conjugate comprising the small nucleic acid molecule according to any one of claims 1 to 3 and a conjugated group conjugated to the small nucleic acid molecule.
9. A kit, characterized in that The kit contains the small nucleic acid molecule according to any one of claims 1 to 3, the recombinant vector according to claim 4 or 5, the pharmaceutical composition according to claim 6 or 7, or the conjugate according to claim 8.
10. At least one of the following uses of the small nucleic acid molecule according to any one of claims 1 to 3 or the recombinant vector according to claim 5: (1) preparing drugs for treating breast cancer; (2) Preparation of breast cancer cell proliferation inhibitors; (3) Preparation of breast cancer cell cycle inhibitors.