Asian migratory locust MRPL13 gene and application thereof

Through the RNA interference technology of the Asian macaque MRPL13 gene, dsRNA is used to interfere with the Asian macaque MRPL13 gene, the environmental pollution and drug resistance problems of chemical pesticide prevention and control methods are solved, and the efficient and green prevention and control effect is achieved.

CN120485199AActive Publication Date: 2025-08-15CHINA AGRI UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510984512.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-17
Publication Date
2025-08-15
Estimated Expiration
2045-07-17

AI Technical Summary

Technical Problem

In the prior art, chemical pesticides are used to prevent and control Asian interludes by serious environmental pollution and pests, and lack green and efficient prevention and control methods.

Method used

The RNA interference technology of the Asian macaque MRPL13 gene was used to specifically interfere with the Asian macaque MRPL13 gene, resulting in a knockdown of its transcriptional level and leading to larvae death.

Benefits of technology

The green prevention and control of Asian locusts has been achieved, the pest mortality rate has been improved, and environmental pollution and drug resistance have been avoided.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485199A_ABST
    Figure CN120485199A_ABST
Patent Text Reader

Abstract

The invention discloses an Asian migratory locust MRPL13 gene and application thereof. Wherein the Asian migratory locust MRPL13 gene has a nucleotide sequence as shown in SEQ ID NO: 1. The nucleotide sequence of the RNA interference fragment of the Asian migratory locust MRPL13 gene is as shown in SEQ ID NO: 2. The invention also provides dsRNA synthesized by the RNA interference fragment of the Asian migratory locust MRPL13 gene. According to the application of dsRNA in prevention and control of the Asian migratory locust, RNA interference is performed on the Asian migratory locust, the MRPL13 transcriptional level is knocked down, death of Asian migratory locust larvae is caused, and therefore green prevention and control of the Asian migratory locust are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an Asian migratory locust MRPL13 gene and an application thereof. Background Art

[0002] The Asian migratory locust (Locusta migratoria) is a major agricultural pest in my country, characterized by its strong migratory and explosive nature. Its large-scale migration and aggregation pose serious risks to crops. The risk of locust migration and infestation is increasing, particularly amidst ecological and environmental changes and climate change. Traditional locust control methods primarily rely on chemical pesticides, but long-term use not only pollutes the environment but can also lead to the development of pesticide resistance in locusts and negatively impact non-target organisms and ecosystems.

[0003] In recent years, with the advancement of molecular biotechnology, RNA interference (RNAi), a gene silencing technique, has been increasingly used in pest control research. RNAi, mediated by double-stranded RNA (dsRNA), specifically degrades target mRNA within insect cells, thereby inhibiting target gene expression. This technology offers the advantages of high efficiency, high specificity, and environmental friendliness, making it a highly promising green pest control tool.

[0004] Therefore, there is an urgent need in the existing technology for a method for controlling Asian migratory locusts based on double-stranded RNA interference technology, which uses double-stranded RNA to specifically interfere with the expression of Asian migratory locust-related genes to increase the mortality rate of Asian migratory locusts, thereby achieving green control of Asian migratory locusts. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and to provide an Asian migratory locust MRPL13 gene, an RNA interference fragment of the Asian migratory locust MRPL13 gene, a dsRNA synthesized from the RNA interference fragment of the Asian migratory locust MRPL13 gene, and the use of the dsRNA in the control of Asian migratory locust.

[0006] The purpose of the present invention is achieved through the following technical solutions: The present invention provides an Asian migratory locust MRPL13 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0007] The RNA interference fragment of the Asian migratory locust MRPL13 gene is characterized by a nucleotide sequence as shown in SEQ ID NO: 2. The nucleotide sequence of the primer used to synthesize the RNA interference fragment is as follows: 7MRPL13 T7+F: taatacgactcactatagggGCTACATGGCAGAACCCATT (SEQ ID NO: 3); 7MRPL13 T7+R: taatacgactcactatagggTTGGAACTGGCCTTATCTGC (SEQ ID NO: 4).

[0008] The present invention also provides dsRNA synthesized from the RNA interference fragment of the Asian migratory locust MRPL13 gene.

[0009] The application of dsRNA in the control of Asian migratory locusts is to interfere with the larvae of Asian migratory locusts through RNA interference, resulting in their death.

[0010] The present invention has the beneficial effects of: the present invention relates to the Asian migratory locust MRPL13 gene and its RNA interference fragment, and provides the use of dsRNA synthesized from the RNA interference fragment in the control of Asian migratory locust. Through RNA interference, the Asian migratory locust larvae die, thereby achieving green control of the Asian migratory locust. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 is a bar graph of RNA interference efficiency (the vertical axis represents the relative expression level of the MRPL13 gene, and the horizontal axis represents the control group and dsMRPL13 represents the experimental group); Figure 2 This is a bar graph of nymph mortality 24 hours after RNA interference with the fourth-instar larvae (the vertical axis represents the mortality rate of Asian migratory locust larvae, the horizontal axis represents the number of recording days, Control represents the control group, and dsMRPL13 represents the experimental group). DETAILED DESCRIPTION

[0012] The present invention is described in detail below with reference to the accompanying drawings.

[0013] Example

[0014] 1. Extraction of Asian migratory locust genomic RNA: 1) Place the Asian migratory locust sample in a 1.5 mL centrifuge tube, add 200 μL TRIzol, grind the tissue evenly with a tissue grinder, then add 800 μL TRIzol, mix thoroughly, and let stand at room temperature for 5 minutes to obtain a lysate. 2) Add 200 μL of chloroform to the above lysate, shake vigorously for 15 seconds, and let it stand at room temperature for 10 minutes; 3) Centrifuge at 4°C (12,000 rpm for 15 min) and transfer the upper aqueous phase to a new 1.5 mL centrifuge tube. 4) Add 500 μL of isopropanol, gently invert upside down to mix, and let stand at room temperature for 10 minutes; 5) Centrifuge at 4°C (12,000 rpm for 10 min). The RNA will precipitate at the bottom of the tube and remove the supernatant. 6) Add 1 mL of 75% ethanol (prepared with RNase-free water), flick the pellet with your finger, and gently invert it to wash the pellet; centrifuge at 4°C (12,000 rpm for 5 minutes) and discard the supernatant; 7) Repeat step 6) once; 8) Allow to air dry at room temperature for 5-10 minutes. Dissolve the precipitate in 20-40 μL of RNase-free water. Gently pipette to dissolve the precipitate. Once the precipitate is completely dissolved, store the resulting RNA solution at -80°C for subsequent experiments.

[0015] 2. Reverse transcription of RNA: Add 1 μl of the above RNA solution to a 200 μl RNase-free centrifuge tube and follow the instructions of the TAKARA 1ststrand cDNA Synthesis Kit (6110A) to obtain the first-strand cDNA, which was then stored at -20°C until use.

[0016] 3. Amplification and purification of the target fragment of the Asian migratory locust MRPL13 gene: PCR amplification was performed using the above cDNA template, and the reaction system is shown in Table 1.

[0017]

[0018] Among them, the upstream primer and downstream primer are: 7MRPL13 T7+F: taatacgactcactatagggGCTACATGGCAGAACCCATT (SEQ ID NO: 3); 7MRPL13 T7+R: taatacgactcactatagggTTGGAACTGGCCTTATCTGC (SEQ ID NO: 4).

[0019] The PCR reaction program is shown in Table 2.

[0020]

[0021] The PCR product was examined on a 1% agarose gel (220 V, 25 min electrophoresis), revealing a single bright band, indicating a viable PCR product. The PCR product was purified using a PCR cleanup kit and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The nucleotide sequence is shown in SEQ ID NO: 2.

[0022] 4. Synthesis and purification of dsRNA of the Asian migratory locust MRPL13 gene: 1) Mix the reagents according to the system in Table 3, flick to mix, centrifuge briefly, and place in a 37°C metal bath for 4 hours.

[0023] 2) Add DEPC H2O to the material to be purified to a volume of 200 μL; 3) Add half equal volume (100 μL) of water-saturated phenol reagent and half equal volume of chloroform (100 μL).

[0024] 4) Mix gently and centrifuge at 4°C (12,000 rpm, 4°C) for 15 min. 5) Take the upper phase, add an equal volume of chloroform (200 μL), mix gently, and centrifuge at 4°C (12,000 rpm, 4°C) for 15 min; 6) Take the upper phase, add 1 / 10 volume (20 μL) of 3 M sodium acetate (pH 5.2) and 2.5 volumes (500 μL) of 100% ethanol (stored at -20°C), mix gently, and place at -20°C for half an hour; 7) Centrifuge at 12,000 rpm at 4°C for 30 min. 8) At this point, there is a white precipitate at the bottom of the centrifuge tube. Discard the supernatant and add 80% ethanol (stored at -20°C) and mix gently to wash the precipitate. 9) Centrifuge at 7500 rpm at 4°C for 5 min. 10) Slowly aspirate the ethanol and the supernatant near the precipitate with a 10 μL pipette. To prevent the precipitate from being aspirated with it, open the centrifuge tube with a small amount of residual ethanol and place it in a 37°C incubator for about 10 minutes to allow all the ethanol to evaporate. 11) Add 20 μL of enzyme-free H2O and gently tap the bottom of the tube to dissolve the precipitate. Store the resulting dsRNA (one strand of the dsRNA has the same sequence as the target fragment SEQ ID NO: 2, and the other strand is the reverse complement of SEQ ID NO: 2) at -80°C.

[0025] 5. RNA interference (injection interference) of Asian migratory locust MRPL13 According to Table 4, larvae from the third to fifth instars of the Asian migratory locust were injected once per instar, within the first two days of each instar. The control group was injected with dsGFP, while the experimental group was injected with dsMRPL13. Four replicates were set up for each control and experimental group, with 40 larvae per replicate. Insects from each replicate were placed in the same insectary jar (16 cm × 12.5 cm × 12.5 cm) with sufficient young wheatgrass and maintained in an incubator as normal.

[0026]

[0027] 6. RNA interference efficiency detection and mortality statistics of the Asian migratory locust MRPL13 gene Samples were collected 24 hours after the fifth-instar larvae were injected with the interference agent. Three replicates (3 larvae / replicate) were collected for RNA extraction and subsequent fluorescence quantitative PCR detection of MRPL13 gene expression. The primer sequences for real-time fluorescence quantitative PCR of MRPL13 gene and internal reference gene actin were as follows: qMRPL13-F2: ACAAGGACCCGACAATGGTAATGC (SEQ ID NO: 5); qMRPL13-R2: GCCTTATCTGCCTGATCTGGTTGG (SEQ ID NO: 6); actinF-F:CGAAGCACAGTCAAAGAGAGGTA (SEQ ID NO: 7); actinF-R:GCTTCAGTCAAGAGAACAGGATG (SEQ ID NO: 8).

[0028] Real-time fluorescence quantitative results showed that after RNAi interference, the expression level of the MRPL13 gene in Asian migratory locust was significantly downregulated compared with the control group (injected with dsGFP) (P<0.05), indicating that RNAi interference was successful (see Figure 1 ). The number of locust deaths was counted starting 24 hours after the injection of the 4th instar larvae and lasted for 11 days. Compared with the control group, the mortality rate of the treated group began to increase on the second day and reached 89% on the 11th day (see Figure 2 This indicates that knocking down the transcriptional level of MRPL13 leads to the death of Asian migratory locust larvae. Pest control research primarily uses injection and feeding methods, both of which have similar mechanisms and effects. This study used the injection method.

[0029] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. An Asian migratory locust MRPL13 gene, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

1.

2. The RNA interference fragment of the Asian migratory locust MRPL13 gene according to claim 1, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

2.

3. dsRNA synthesized from the RNA interference fragment of the Asian migratory locust MRPL13 gene according to claim 2.

4. Use of the dsRNA according to claim 3 in the control of Asian migratory locust, to perform RNA interference on Asian migratory locust larvae, thereby causing their death.

Citation Information

Patent Citations

  • Dsrna as insect control agent

    CA2633576A1

  • Application of migratory locust Rab11A gene and dsRNA thereof in migratory locust prevention and treatment

    CN112662689A

  • Locusta migratoria ester acyl coenzyme A reductase gene LmFAR13 and dsRNA and application thereof

    CN117821479A

  • Locusta migratoria calmodulin gene segment and dsRNA and application thereof

    CN119506293A

  • DsRNA (double-stranded ribonucleic acid) of locusta migratoria ribosome large subunit protein genes RPL7 and RPL44 and application of dsRNA

    CN120366321A