EnvZ gene mutant and application thereof

Through the PCR detection method of envZ gene mutant, the rapid detection of Klebsiella pneumoniae resistance to cefdir was solved, and rapid and accurate drug resistance analysis was achieved to guide rational drug use.

CN120485218APending Publication Date: 2025-08-15PEOPLES HOSPITAL PEKING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510419877.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately detect the drug resistance of Klebsiella pneumoniae to cefdier, which increases the difficulty of clinical use.

Method used

EnvZ gene mutants are provided, and whether Klebsiella pneumoniae has mutations such as 433T>G or deletion of 321, 322, and 323 are detected by PCR amplification and sequencing. High-fidelity PCR reaction is carried out in combination with specific primers to analyze whether the envZ gene mutants are present.

Benefits of technology

It has achieved rapid, accurate and economical detection of the resistance of Klebsiella pneumoniae to cefdier, guided rational use of drugs, and analyzed its resistance mechanism.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005344921670000041
    Figure BDA0005344921670000041
  • Figure BDA0005344921670000051
    Figure BDA0005344921670000051
  • Figure BDA0005344921670000062
    Figure BDA0005344921670000062
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology and gene detection, in particular to an envZ gene mutant and application thereof, and the envZ gene mutant has at least one of the following mutations relative to a wild envZ gene of klebsiella pneumoniae: T at the 433rd site is mutated into G, and 321, 322 and 323 sites are deleted. By detecting whether the klebsiella pneumoniae has the mutation, the drug resistance of the klebsiella pneumoniae to the cefdil can be rapidly, accurately and economically detected.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and gene detection technology, specifically to an envZ gene mutant and its applications. Background Technology

[0002] Klebsiella pneumoniae, a significant pathogen causing hospital-acquired infections, can lead to various diseases including pneumonia, urinary tract infections, sepsis, and meningitis. This bacterium hydrolyzes β-lactam antibiotics by producing class A ESBLs (such as CTX-M-15) and class B metallo-β-lactamases (such as NDM-1), while simultaneously losing the Loop3 domain of the outer membrane porin OmpK36, creating a multidrug resistance barrier against carbapenems. This multidrug resistance increases the difficulty of its prevention and control. Due to its widespread pathogenicity, multidrug resistance, and the risk of nosocomial transmission, Klebsiella pneumoniae has become a key target for clinical infection control.

[0003] Cefiderocol (CFDC) is a newly developed catechol-substituted siderophore cephalosporin. First, the catechol side chain forms a high-affinity chelate with Fe3+, mimicking the structure of bacterial siderophores (such as enterobacillusin). It specifically binds to outer membrane siderophore receptors and is transported to the bacterial periplasmic space via a TonB-ExbB-ExbD-dependent active transport system. It then inhibits peptidoglycan synthase by binding to penicillin-binding protein 3 (PBP3), ultimately leading to osmotic imbalance and bacterial lysis. Cefiderocol is stable against various β-lactams, thus exhibiting antibacterial activity against multidrug-resistant Klebsiella pneumoniae (e.g., carbapenem-resistant Klebsiella pneumoniae).

[0004] However, since CFDC received approval from the U.S. Food and Drug Administration (FDA), an increasing number of resistant strains of cefdinir have emerged in recent years, including Klebsiella pneumoniae. Those skilled in the art desire to develop new detection methods to determine whether Klebsiella pneumoniae exhibits resistance to cefdinir. Summary of the Invention

[0005] The purpose of this invention is to provide an envZ gene mutant and its application. This envZ gene mutant can be used to detect whether Klebsiella pneumoniae is resistant to cefdil, and it has the advantages of being easy to operate, rapid and efficient.

[0006] Therefore, in a first aspect, the present invention provides an envZ gene mutant that has at least one of the following mutations relative to the wild-type envZ gene of Klebsiella pneumoniae:

[0007] (i) The T at position 433 mutates to G (abbreviated as 433T>G);

[0008] (ii) The 321st, 322nd, and 323rd bits are missing (abbreviated as 321△3bp).

[0009] Furthermore, the nucleotide sequence of the wild-type envZ gene of Klebsiella pneumoniae is shown in SEQ ID NO: 1.

[0010] Furthermore, the nucleotide sequence of the envZ gene mutant is SEQ ID NO:2 or SEQ ID NO:3.

[0011] A second aspect of the present invention provides the application of the envZ gene mutant described in the first aspect of the present invention in detecting whether Klebsiella pneumoniae is resistant to cefdil.

[0012] Furthermore, the presence of the envZ gene mutant in Klebsiella pneumoniae is detected. If the envZ gene mutant is present, then Klebsiella pneumoniae is resistant to cefidil.

[0013] Furthermore, the drug resistance refers to the fact that the tested Klebsiella pneumoniae is less sensitive to cefdil compared to wild-type Klebsiella pneumoniae, or that the minimum inhibitory concentration of cefdil against the tested Klebsiella pneumoniae is higher than the minimum inhibitory concentration of cefdil against wild-type Klebsiella pneumoniae.

[0014] A third aspect of the present invention provides a method for detecting the resistance of Klebsiella pneumoniae to cefdil, comprising detecting whether Klebsiella pneumoniae has the envZ gene mutant; if it has the envZ gene mutant, then Klebsiella pneumoniae is resistant to cefdil.

[0015] Furthermore, the detection method includes: amplifying Klebsiella pneumoniae with high-fidelity PCR products to obtain PCR products; sequencing the PCR products to obtain sequencing results; and comparing the sequencing results with the nucleotide sequence of the wild-type envZ gene to analyze whether Klebsiella pneumoniae has the envZ gene mutant.

[0016] The primers used for amplification include:

[0017] First primer: gcaggaagaggcggttatc (SEQ ID NO: 14),

[0018] Second primer: tctgaatacgaataaacagccagg (SEQ ID NO: 15).

[0019] Furthermore, the amplification reaction system includes: 12.5 μL of high-fidelity PCR polymerase, 8.5 μL of ddH2O, 1 μL of the first primer, 1 μL of the second primer, and 2 μL of DNA template.

[0020] Furthermore, the conditions for the amplification reaction include: pre-denaturation at 95°C for 15 min, denaturation at 95°C for 30 s, annealing at 57°C for 60 s, extension at 72°C for 30 s, a total of 30 cycles of denaturation-annealing-extension, and then extension at 72°C for 5 min.

[0021] A fourth aspect of the present invention provides a detection reagent comprising primers for PCR amplification of an envZ gene fragment of Klebsiella pneumoniae; said envZ gene fragment is adapted to be compared with a wild-type envZ gene by sequencing to analyze whether it has at least one of the following mutations:

[0022] (i) The T at position 433 mutates to G (abbreviated as 433T>G);

[0023] (ii) The 321st, 322nd, and 323rd bits are missing (abbreviated as 321△3bp).

[0024] Furthermore, the detection reagent includes:

[0025] First primer: gcaggaagaggcggttatc (SEQ ID NO: 14),

[0026] Second primer: tctgaatacgaataaacagccagg (SEQ ID NO: 15).

[0027] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0028] This invention provides an envZ gene mutant, and studies have found that Klebsiella pneumoniae with this mutation is resistant to cefdil. This invention also provides a method and reagents for detecting cefdil resistance in Klebsiella pneumoniae. Therefore, the technical solution of this invention allows for the rapid, accurate, and economical detection of cefdil resistance in Klebsiella pneumoniae, which is beneficial for guiding rational drug use and also helps in analyzing the mechanisms of cefdil resistance in Enterobacteriaceae. Detailed Implementation

[0029] Exemplary embodiments of this disclosure will now be described in more detail. It should be understood that this disclosure may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of this disclosure to those skilled in the art.

[0030] the term

[0031] As used in this article, "Klebsiella pneumoniae" is a Gram-negative bacillus belonging to the genus Klebsiella of the family Enterobacteriaceae.

[0032] As used in this article, "wildtype" refers to the original genotype of a species in nature that has not been modified. Wildtype genes encode proteins with basic biological functions. Wildtype genes are often used as a benchmark control in gene function studies to assess the impact of mutations.

[0033] As used herein, "envZ gene mutant" refers to a mutation of 433T>G and / or 321Δ3bp relative to the wild-type envZ gene. The 433 and 321 site numbers are determined based on the wild-type envZ gene, and more specifically, based on the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments of the invention, the nucleotide sequence of the envZ gene mutant is SEQ ID NO: 2 or SEQ ID NO: 3.

[0034] As used in this article, "Cefiderocol" (CFDC) is a siderophore cephalosporin antibiotic developed by Shionogi Co., Ltd. of Japan, and marketed under the name Fetroja.

[0035] As used herein, "drug resistance" refers to the phenomenon where a pathogen's sensitivity to a drug is significantly reduced or completely ineffective. In embodiments of this invention, it specifically refers to the fact that the detected Klebsiella pneumoniae is less sensitive to cefdil compared to wild-type Klebsiella pneumoniae; or, in other words, the minimum inhibitory concentration (MIC) of cefdil against the detected Klebsiella pneumoniae is higher than the MIC of cefdil against wild-type Klebsiella pneumoniae.

[0036] The following description provides examples of the invention, thereby making the advantages and various effects of the invention more clearly apparent. Those skilled in the art will understand that these examples are illustrative and not intended to limit the invention.

[0037] Example 1

[0038] This embodiment selected several wild-type Klebsiella pneumoniae monoclonal strains, numbered each monoclonal strain (specific numbers are shown in Table 3), and prepared competent cells. Based on this, a Klebsiella pneumoniae strain with the 433T>G mutation in the envZ gene was constructed. The resulting mutant strain retained the wild-type strain number; for example, the wild-type strain numbered C6536 was named C6536_envZ433T>G. Specific steps included:

[0039] Step 1: The nucleotide sequence of the envZ gene with the 433T>G mutation is SEQ ID NO: 2. Spacers and primers were designed based on the target mutation site, as shown in Table 1.

[0040] Table 1

[0041]

[0042] Using the wild-type envZ gene as a template, the above primers were used to perform PCR amplification and homologous arm fusion of the upper, middle and lower homologous arms to obtain the 433T>G mutant sequence homologous arm of the envZ gene.

[0043] Step 2: The spacer and homologous arms were cloned into the pSGKP-apr plasmid using an enzyme digestion and ligation method (the initial plasmid was pSGKP-spe, purchased from Addgene, catalog number #117234; the resistance gene was later replaced with an apramycin resistance gene, thus obtaining pSGKP-apr). This mainly included: digesting the pSGKP-apr plasmid with BsaI-HFv2, ligating the spacer with T4 ligase, selecting correct single clones on plates, extracting the plasmid, then double-digesting the plasmid with BamHI and XbaI, and ligating the homologous arms with T4 ligase; verifying successful homologous arm ligation by gel electrophoresis, and purifying the linear plasmid using a gel extraction and purification kit, naming it the recombinant plasmid pSGKP, for later use.

[0044] Step 3: The plasmid pCasKP-hph (purchased from Addgene, #117232) was cloned into wild-type Klebsiella pneumoniae competent cells by electroporation. Correct monoclonal strains were screened by plate culture and set aside for later use.

[0045] Step 4: The recombinant plasmid pSGKP is cloned into the single clone strain obtained in Step 3 by electroporation. The correct single clone is obtained by plate screening and sequencing verification. Then, pCasKP and pSGKP plasmids are eliminated to obtain the strain with the 433T>G mutation in the envZ gene.

[0046] Example 2

[0047] This embodiment constructed a Klebsiella pneumoniae strain with a 321Δ3bp mutation in the envZ gene. Except for the use of the homologous arms in this embodiment (specifically shown below), the strain with the 321Δ3bp mutation in the envZ gene was cloned using the same method as in Example 1. Its numbering method is the same as in Example 1, using the same numbering as the wild-type strain. For example, the wild-type strain numbered C6536 is named C6536_envZ321Δ3bp as its corresponding mutant strain.

[0048] The nucleotide sequence of the envZ gene with the 321Δ3bp mutation is SEQ ID NO: 3. Spacers and primers were designed based on the target mutation site. The spacer sequence is the same as in Example 1, and the primer sequences are shown in Table 2.

[0049] Table 2

[0050]

[0051]

[0052] Using the wild-type envZ gene as a template, the above primers were used to perform PCR amplification and homologous arm fusion of two homologous arms to obtain the 321Δ3bp mutant sequence homologous arm of the envZ gene.

[0053] Example 3

[0054] This embodiment tested the cefidil resistance of the mutant strains prepared in Examples 1 and 2, using wild-type Klebsiella pneumoniae as a control. Based primarily on the Clinical and Laboratory Standards Institute (CLSI) guidelines, an elevated cefidil MIC (≥16 μg / mL) indicates acquired resistance to the drug. The antibiotic susceptibility of the strains was determined using the iron-deficient microbroth dilution method, and the minimum drug concentration (MIC) capable of inhibiting bacterial growth was determined through a series of concentration gradients.

[0055] The specific steps are as follows:

[0056] (1) Preparation of cation-regulated Mueller-Hinton culture medium for iron deficiency;

[0057] (2) Prepare 50 μL of a mixture of cefidil culture medium with a 2-fold concentration gradient in a 96-well plate;

[0058] (3) Take an equal volume of bacteria (5 × 10⁻⁶) from step (2). 5 CFU / mL) was inoculated into culture media containing different concentrations of cefdil. Iron-deficient MH culture medium was used to dilute the bacteria here.

[0059] (4) Place the above mixture in a 37°C incubator and incubate for 16-18 hours.

[0060] (5) Interpret the MIC value. Observe with the naked eye whether there is bacterial growth in each well, judge the bacterial growth under different drug concentrations, and finally obtain the drug concentration that inhibits bacterial growth the least.

[0061] The results are shown in Table 3.

[0062] Table 3

[0063]

[0064] The results above show that when the envZ gene in Klebsiella pneumoniae has a 433T>G mutation or a 321Δ3bp mutation, the MIC value of cefidil increases, indicating that the strain's drug resistance is enhanced (i.e., drug sensitivity is reduced).

[0065] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. An envZ gene mutant, characterized in that: It has at least one of the following mutations relative to the wild-type envZ gene of Klebsiella pneumoniae: (i) T at position 433 mutated to G; (ii) Positions 321, 322, and 323 are missing.

2. The envZ gene mutant according to claim 1, wherein The nucleotide sequence of the wild-type envZ gene of Klebsiella pneumoniae is shown in SEQ ID NO:

1.

3. The envZ gene mutant according to claim 1 or 2, wherein The nucleotide sequence of the envZ gene mutant is SEQ ID NO: 2 or SEQ ID NO:

3.

4. Use of the envZ gene mutant according to any one of claims 1 to 3 in detecting whether Klebsiella pneumoniae is resistant to cefiderocol.

5. The use according to claim 4, characterized in that Detecting whether Klebsiella pneumoniae has the envZ gene mutant; if the Klebsiella pneumoniae has the envZ gene mutant, the Klebsiella pneumoniae is resistant to cefiderocol.

6. A method for detecting the resistance of Klebsiella pneumonia to cefiderocol, characterized in that: The method comprises detecting whether Klebsiella pneumoniae has the envZ gene mutant according to any one of claims 1 to 3; if the Klebsiella pneumoniae has the envZ gene mutant, the Klebsiella pneumoniae is resistant to cefiderocol.

7. The detection method according to claim 6, wherein The detection method comprises: performing high-fidelity PCR product amplification on Klebsiella pneumoniae to obtain a PCR product; sequencing the PCR product to obtain a sequencing result; and comparing the sequencing result with the nucleotide sequence of the wild-type envZ gene to analyze whether the Klebsiella pneumoniae has the envZ gene mutant; Wherein, the primers used in the amplification include: The first primer has a nucleotide sequence as shown in SEQ ID NO: 14, The nucleotide sequence of the second primer is shown in SEQ ID NO:

15.

8. The detection method according to claim 7, wherein The amplification reaction system includes: 12.5 μL of high-fidelity PCR polymerase, 8.5 μL of ddH2O, 1 μL of the first primer, 1 μL of the second primer, and 2 μL of DNA template; Preferably, the amplification reaction conditions include: pre-denaturation at 95°C for 15 min, denaturation at 95°C for 30 s, annealing at 57°C for 60 s, extension at 72°C for 30 s, 30 cycles of denaturation-annealing-extension, and further extension at 72°C for 5 min.

9. A detection reagent, characterized in that The invention also includes primers for PCR amplification of an envZ gene fragment of Klebsiella pneumoniae; the envZ gene fragment is suitable for comparison with the wild-type envZ gene by sequencing to analyze whether it has at least one of the following mutations: (i) T at position 433 mutated to G; (ii) Positions 321, 322, and 323 are missing.

10. The detection reagent according to claim 9, characterized in that The detection reagent includes: The first primer has a nucleotide sequence as shown in SEQ ID NO: 14, The nucleotide sequence of the second primer is shown in SEQ ID NO: 15.