Application of ospldrp1 protein or its coding gene in improving rice broad-spectrum disease resistance and regulating agronomic traits

Abstract

The application belongs to the field of molecular biology, and particularly relates to application of OsPLDRP1 protein or its coding gene in improving broad-spectrum disease resistance and regulating agronomic traits of rice. The application constructs OsPLDRP1 knockout mutants and overexpression transgenic lines in a susceptible rice background, and through inoculation of various pathogenic bacteria (including rice blast fungus, sheath blight fungus and bacterial leaf blight fungus), resistance phenotype analysis is carried out, and it is confirmed that OsPLDRP1 is involved in regulating the immune response pathway of rice to fungal diseases (rice blast and sheath blight) and bacterial diseases (bacterial leaf blight). Meanwhile, it is found that the mutant material of OsPLDRP1 is shorter than the wild type in panicle length, and after being driven by a strong promoter ubi, the overexpression material of OsPLDRP1 is looser than the wild type in plant type, the plant is taller, and the early heading phenotype is obtained, and OsPLDRP1 affects the normal growth and development of rice while triggering the immune response of the plant. The application provides important gene resources and molecular theoretical basis for developing new varieties of broad-spectrum disease-resistant rice.

Description

Technical Field

[0001] This application belongs to the field of molecular biology, specifically relating to the application of OsPLDRP1 protein or its encoding gene in improving broad-spectrum disease resistance in rice and regulating agronomic traits. Background Technology

[0002] Rice ( Oryza sativa Rice is a staple food crop for over 50% of the world's population, and its consumption is rapidly increasing in many parts of the world. However, stable rice production is constrained by various biological stresses, including those caused by rice blast fungus (…). Magnaporthe oryzae , M. oryzae Fungal blast disease caused by Rhizoctonia solani ( ) Rhizoctonia solani Sheath blight and Aspergillus niger caused by ) Ustilaginoidea virens ) caused by *Fusarium moniliforme*, *Fusarium moniliforme* ( Fusarium fujikuroi Bakanae disease caused by Xanthomonas oryzae (…) Xanthomonas oryzae pv. oryzae , Xoo Bacterial leaf blight caused by ) and its pathogenic species in rice ( Xanthomonas oryzae pv. oryzicola , Xoc Bacterial leaf streak and other diseases caused by pathogens such as bacterial leaf streak are prevalent in rice. Rice blast disease, rice bacterial leaf blight, and rice sheath blight are recognized as the three major diseases affecting rice. These diseases prevent rice from growing and producing grains normally, ultimately severely impacting rice yield and posing a persistent threat to global food security. Therefore, identifying important broad-spectrum disease resistance genes and analyzing their mediated immune signaling pathways can provide a theoretical basis and reference for the artificial design breeding of rice.

[0003] Phospholipase D (PLD) and its cleavage product phosphatidic acid (PA) play crucial roles in plant stress signal transduction. Although some targets of PLD and PA have been identified, the signaling pathways remain a mystery. The rice PLD family comprises 12 members, divided into Ca²⁺-dependent (α / β / γ) and Ca²⁺-independent (δ / ε / ζ) subtypes, each with different C2 or PX / PH domains. The study of some target genes of the PLD family in rice remains unclear. Known PLD regulatory proteins play a role in abiotic stress responses in the model plant Arabidopsis thaliana, but there are no reports on whether these proteins are involved in resistance to multiple diseases in gramineous crops, i.e., whether the disease resistance function mediated by PLD regulatory proteins is broad-spectrum.

[0004] Different pathogens (such as Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae) have evolved highly specific pathogenic strategies to destroy the immune system of rice in order to successfully infect rice. Therefore, it is particularly important to mine rice disease resistance genes, breed and plant rice disease-resistant crop varieties to control these diseases and ensure global food security. SUMMARY

[0005] In view of the above problems, the present application constructs OsPLDRP1 knockout mutants and overexpression transgenic lines in a susceptible rice background. Through inoculation of multiple pathogens (including Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae), it is found that OsPLDRP1 significantly affects the resistance of rice to three major diseases, and it is also found that OsPLDRP1 it affects the normal growth and development of rice while triggering the immune response of the plant. The present application provides important genetic resources and molecular theoretical basis for the development of broad-spectrum disease-resistant new rice varieties.

[0006] In the first aspect, the present application provides an application of a product, the product being 1) OsPLDRP1 protein or its coding gene, or 2) an inhibitor of OsPLDRP1 protein activity or its coding gene expression amount, the application being any one of the following,

[0007] a) OsPLDRP1 protein or its coding gene as a target, application in regulating the resistance of plants to Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae, or application in screening substances capable of regulating the resistance of plants to Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae;

[0008] b) OsPLDRP1 protein or its coding gene as a target, application in regulating the ability of plant basal defense response, or application in screening substances capable of regulating the plant basal defense response;

[0009] c) an inhibitor of OsPLDRP1 protein activity or its coding gene expression amount, application in regulating the resistance of plants to Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae;

[0010] d) an inhibitor of OsPLDRP1 protein activity or its coding gene expression amount, application in regulating the ability of plant basal defense response.

[0011] In the present application, "OsPLDRP1 protein" refers to a phospholipase D regulated protein OsPLDRP1 (Phospholipase D REGULATED PROTEIN 1) of rice. The PLD family of rice contains 12 members (such as OsPLDα1-3 , OsPLDβ1-2 , OsPLDδThe phospholipase D family is divided into Ca2+ dependent (α / β / γ) and non-Ca2+ dependent (δ / ε / ζ) two types, and each subtype has different C2 domains or PX / PH domains. Rice phospholipase D regulatory protein is a kind of protein related to phospholipase D (PLD) structure but lacking catalytic activity. In recent years, its function in rice (Oryza sativa) and other plants has been gradually revealed, and it is involved in various physiological processes in cells. OsPLDRP1 also contains nuclear localization and membrane localization signals, which enable it to localize in the nucleus and on the cell membrane, thereby enabling it to regulate the expression of downstream genes and transmit signals to the inside of the cell.

[0012] In some embodiments, in the application a) or c), the activity of the OsPLDRP1 protein or the expression amount of the gene encoding it is down-regulated, thereby up-regulating the resistance of the plant to Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae; the activity of the OsPLDRP1 protein or the expression amount of the gene encoding it is up-regulated, thereby down-regulating the resistance of the plant to Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae.

[0013] In this application, rice blast resistance refers to the defense ability of rice to the infection of the pathogenic fungus Magnaporthe oryzae. Magnaporthe oryzae This disease has a whole growth period of infection characteristics, which can damage leaf, stem and ear organs and tissues. The typical symptoms are: central gray and edge brown fusiform lesions appear on the leaves; ear infection causes grain development to be hindered, and in severe cases, it causes absolute yield. This disease usually causes 10%-30% yield loss, and in extreme cases, it can reach 40%-50%. Some rice varieties carry disease genes such as ROD1, which can inhibit immune response; and disease-resistant varieties are not easily infected due to the lack of corresponding disease genes.

[0014] In this application, sheath blight resistance refers to the resistance of rice to the pathogenic action of the pathogenic fungus Rhizoctonia solani. Rhizoctonia solani The disease begins to appear in the tillering stage of rice, and the typical symptoms are: dark green water stain-like small spots are formed on the near-water leaf sheath at the early stage, and the disease develops and expands into an oval cloud pattern, with characteristic performance of edge brown, central light brown to gray white. Severe infection forms irregular large lesions, which can extend to leaves and stems, leading to leaf senescence, plant lodging, and ultimately causing yield loss such as reduced seed setting rate and decreased grain fullness.

[0015] In this application, white leaf blast resistance refers to the resistance of rice to the pathogenic action of the pathogenic fungus Xanthomonas oryzae. Xanthomonas oryzae pv. oryzae,Xoo) pathogenicity defense mechanism. The white leaf blight of rice caused by the gram-negative bacteria is a very destructive bacterial disease. Its resistance genetic characteristics are controlled by single gene or a few major genes, such as the Xa23 gene of rice, which is a typical major gene of white leaf blight resistance. White leaf blight can occur at all stages of rice growth, and the main occurrence site is on the rice leaf and leaf sheath. At first, a semi-transparent yellow small spot will appear on the edge of the rice leaf, and then the yellow-green or gray-green disease spot will expand along the midrib to become a wavy shape, and the boundary between the diseased part and the healthy part will become more and more obvious. After a few days, the disease spot will turn gray and curl inward, and it can be quickly spread in the air through wind, rain, insects or other means, and then infect the whole rice field, which looks like a withered color from a distance, so it is called white leaf blight.

[0016] In some embodiments, in the application b) or d), the activity of the OsPLDRP1 protein or the expression amount of the encoding gene thereof is down-regulated, so as to enhance the ability of the plant basal defense response; the activity of the OsPLDRP1 protein or the expression amount of the encoding gene thereof is up-regulated, so as to weaken the ability of the plant basal defense response.

[0017] In some embodiments, the plant basal defense response includes the production of plant phenols, the production of reactive oxygen species (ROS), the activation of defense enzymes, the expression of pathogenesis-related genes, and systemic acquired resistance, etc.

[0018] In some embodiments, the amino acid sequence of the OsPLDRP1 protein is as shown in any one of (1)-(3) below:

[0019] (1) a protein consisting of the amino acid shown in SEQ ID NO. 1;

[0020] (2) a protein derived from (1) by substitution and / or deletion and / or addition of one or more amino acid residues and having the same function;

[0021] (3) a protein or its derivative derived from other varieties of rice or other species, having at least 95% sequence identity and having the same function as (1).

[0022] In some embodiments, the nucleotide sequence of the encoding gene of the OsPLDRP1 protein is as shown in any one of (4)-(6) below:

[0023] (4) a DNA molecule whose coding region is the sequence shown in SEQ ID NO. 2;

[0024] (5) a DNA molecule hybridizing to the DNA sequence defined in (4) under stringent conditions and encoding a protein having the same function;

[0025] (6) a DNA molecule having at least 95% sequence identity to the DNA sequence defined in (4) and encoding a protein having the same function.

[0026] In some embodiments, the inhibitor of the OsPLDRP1 protein activity or the expression amount of its encoding gene is one or more of sgRNA, dsRNA or siRNA.

[0027] In some embodiments, the inhibitor is sgRNA, the sequence of which is shown in SEQ ID NO. 7.

[0028] In another aspect, the present application also provides a composition comprising 1) the OsPLDRP1 protein or its encoding gene, or 2) a nucleic acid construct containing the OsPLDRP1 protein or its encoding gene, for use as a plant growth promoter in regulating plant agronomic traits.

[0029] In some embodiments, the regulation is up-regulating the OsPLDRP1 protein activity or the expression amount of its encoding gene, increasing plant height, making the plant type more loose and making the plant heading early; down-regulating the OsPLDRP1 protein activity or the expression amount of its encoding gene, reducing plant height, making the plant type more compact and making the plant heading normally.

[0030] In some embodiments, the OsPLDRP1 protein amino acid sequence is as described above, and the nucleotide sequence of the OsPLDRP1 protein encoding gene is as described above.

[0031] In another aspect, the present application also provides a method for up-regulating the resistance of a plant to Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae, or enhancing the ability of the plant to defend against pathogens, the method comprising the step of contacting a composition as described above with the plant.

[0032] In the present application, the plant can be a plant of the family Poaceae, such as rice.

[0033] Compared with the prior art, the present application constructs OsPLDRP1 knockout mutants and overexpression transgenic lines in a susceptible rice background, and finds that OsPLDRP1 significantly affects the resistance of rice to three major diseases. The experiment uses a field inoculation method to systematically compare the differences in disease resistance of the transgenic materials, and confirms that OsPLDRP1 participates in regulating the immune response pathway of rice to fungal diseases (rice blast and sheath blight) and bacterial diseases (white leaf blight). At the same time, the present application also finds that OsPLDRP1 the mutant material has a shorter panicle length than the wild type, and after being driven by a strong promoter ubi,OsPLDRP1 The overexpression material had a looser plant structure, taller plants, and an earlier heading phenotype compared to the wild type. OsPLDRP1 This study demonstrates how the disease can stimulate a plant's immune response while simultaneously affecting the normal growth and development of rice. It provides important genetic resources and a molecular theoretical basis for the development of new broad-spectrum disease-resistant rice varieties. Attached Figure Description

[0034] Figure 1 For overexpressing genes OsPLDRP1 The structural diagram of the recombinant plasmid; where A is the plasmid pUN1301- OsPLDRP1 - Flag Image; B represents plasmid pUN1301- OsPLDRP1 - GFP Atlas.

[0035] Figure 2 for OsPLDRP1 Genotyping results of knockout materials and OsPLDRP1 The results of protein level identification of the overexpression material.

[0036] Figure 3 Fluorescence images showing OsPLDRP1 localization in the rice cell membrane and nucleus; A represents transient transformation of rice protoplasts revealing that OsPLDRP1 has cell membrane and nuclear localization, and is a previously reported nuclear marker gene. OsNLS As an indicator, the scale bar is 10 μm; B represents transient infection of tobacco cells, revealing that OsPLDRP1 has cell membrane and nuclear localization, and is a previously reported nuclear marker gene. tdT As an indication, the scale is 10 μm.

[0037] Figure 4 for OsPLDRP1 The results of negative regulation of rice resistance to rice blast fungus are shown in the figure. A represents... OsPLDRP1 Negative regulation of rice resistance to rice blast fungus. Through the study of... OsPLDRP1 Knockout lines, overexpression lines, and wild-type TP309 were inoculated with rice blast fungus in vitro. Disease incidence was assessed 7-10 days after inoculation. B involved extracting DNA from diseased rice leaf tissue and using qPCR to detect fungal biomass, thus assessing disease incidence in each rice plant. C measured the length of lesion expansion to reflect disease incidence. All data were presented using scatter plots, and a two-tailed t-test was used for data analysis. An asterisk (**P<0.01, *P<0.05) indicates significant differences.

[0038] Figure 5 for OsPLDRP1 Figure showing the results of negative regulation of rice resistance to sheath blight pathogen; where A represents... OsPLDRP1 Negative regulation of rice resistance to sheath blight pathogen. OsPLDRP1Knockout strains and wild-type TP309 were inoculated with *Rhizoctonia solani*, and disease incidence was assessed seven days after inoculation. B represents the disease incidence as reflected by measuring the length of lesion expansion. All measured data are presented using scatter plots, and data analysis employed a two-tailed t-test. An asterisk indicates significant differences (**P<0.01, *P<0.05).

[0039] Figure 6 for OsPLDRP1 Figure showing the results of negative regulation of rice resistance to bacterial blight pathogen; where A represents... OsPLDRP1 Negative regulation of rice resistance to bacterial blight, by... OsPLDRP1 Knockout lines, overexpression lines, and wild-type TP309 were inoculated with bacterial blight pathogen race PXO99A. Disease incidence was assessed 14 days later. Representative photographs were taken of diseased leaves with a length near the average. B represents the statistical analysis of bacterial blight incidence. The length of lesions extending downwards from the incision site was measured as a characteristic of disease incidence. All measurements were represented by points. Data analysis used a two-tailed t-test, with asterisks indicating significant differences (**P<0.01, *P<0.05).

[0040] Figure 7 for OsPLDRP1 Positively regulates yield traits such as plant height and grain shape in rice. Among them, A represents wild-type TP309 grown in the field and... OsPLDRP1 A is a photograph of the plant morphology, scale bar 50 cm; B is a photograph of the rice panicles, scale bar 1 cm. Detailed Implementation

[0041] The present application will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that: unless otherwise specified in the following embodiments, the conditions are carried out according to conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following embodiments can be obtained from commercially available sources.

[0042] Experimental materials

[0043] Rice Japonica rice ( Oryza sativa Japonica Group ) Variety TP309 wild type (TP309), rice blast fungus ( M. oryzae TH12, Rhizoctonia solani ( Rhizoctonia solani Kühn ): Highly pathogenic strain RH-9, bacterial blight pathogen ( Xanthomonas oryzae pv. Oryzae,Xoo ): PXO99A.

[0044] Example 1 Construction OsPLDRP1 Gene knockout plasmids / overexpression plasmids

[0045] 1. OsPLDRP1 Gene and protein structure composition

[0046] riceOsPLDRP1 Gene NCBI Accession No: LOC4340577, the full length of transcription sequence is 2903 bp, in which the full length of CDS coding region is 1146 bp, and the CDS sequence is shown as SEQ ID NO. 2. The gene encodes 381 amino acids, and the OsPLDRP1 protein sequence NCBI No. XP_015643710.1, the amino acid sequence is shown as SEQ ID NO. 1.

[0047] 2. Oryza sativa L. OsPLDRP1 Construction of gene knockout plasmid

[0048] The knockout target of the gene was designed according to the genomic DNA sequence of Oryza sativa L. OsPLDRP1 , and acgacttcgacgagtacgac (SEQ ID NO. 3) was selected as the target target. The double-stranded DNA sequence was chemically synthesized by using primers OsPLDRP1-KO-F: 5'-GGCGgtcgtactcgtcgaagtcgt-3' (SEQ ID NO. 4) and OsPLDRP1-KO-R: 5'-AAACacgacttcgacgagtacgac-3' (SEQ ID NO. 5), and the target was connected to OsU3 promoter (SEQ ID NO. 6) by enzyme digestion and ligation, and the SgRNA sequence was designed as shown in SEQ ID NO. 7. Then the expression cassette containing OsU3, target sequence and SgRNA was cloned by PCR, and the expression cassette was assembled into binary vector pYLCRISPR / Cas9 -MTmono , and the Oryza sativa L. OsPLDRP1 Gene knockout recombinant plasmid pYLCRISPR / Cas9 -OsPLDRP1 was used to transform TP309 plants to obtain knockout OsPLDRP1 materials.

[0049] 3. Oryza sativa L. OsPLDRP1 Construction of gene expression vector

[0050] 3.1 Amplification of target sequence

[0051] The genomic cDNA was used as a template, and the target fragment was amplified by using high-fidelity DNA polymerase KOD FX (TOYOBO, Cat#KFX-101) OsPLDRP1 , and the PCR system is shown in Table 1.

[0052] Table 1 PCR system for amplifying target fragment OsPLDRP1

[0053]

[0054] ​PCR reaction procedure: 95 ℃ pre-denaturation 3 min; 95 ℃ denaturation; 30 s, 58 ℃ annealing 30 s, 68 ℃ extension 1 kb / min, about 35 cycles; 68 ℃ extension 10 min; 16 ℃, 1 min. The primers used in PCR reaction are shown in Table 2. After agarose gel purification, the PCR product was obtained for subsequent preparation of expression vector.

[0055] Table 2 Primer sequences used for amplifying target fragments

[0056]

[0057] 3.2 Enzymatic digestion and ligation

[0058] pUN1301- GFP and pUN1301- Flag The plasmid digestion system is shown in Table 3.

[0059] Table 3 Plasmid digestion system

[0060]

[0061] Gently mix and centrifuge briefly, then incubate in a 37 ℃ water bath for 30-60 min.

[0062] Next, recover the digested fragments and determine the concentration, and perform recombination reaction according to the ClonExpress® II One Step Cloning Kit (Vazyme, Cat#C112-02) instructions (20 μL system as shown in Table 4, 37 ℃ water bath constant temperature for 30 min.

[0063] Table 4 Plasmid recombination reaction system

[0064]

[0065] The map of the recombinant plasmid pUN1301- OsPLDRP1-Flag is shown in Fig. A of Figure 1 , and the map of the recombinant plasmid pUN1301- OsPLDRP1-GFP is shown in Fig. B of Figure 1 .

[0066] Example 2 Obtaining gene edited / overexpressed rice lines

[0067] 1. Induction of mature embryo callus of rice

[0068] 1) Shell the rice seeds with a thresher, and manually screen and discard moldy and deformed seeds.

[0069] 2) Add a small amount of 75% ethanol, shake by hand for about 30 s, and rinse with sterile water once.

[0070] 3) Add 25-30 % (v / v) of the antifol solution, shake 200 rpm for 30 min.

[0071] 4) Rinse with sterile water for 5-6 times, 5-10 min each time.

[0072] 5) Place the seeds on sterilized filter paper to dry the surface water of the seeds, and use sterilized tweezers to sow the seeds on the NBD medium to induce callus;

[0073] NBD rice screening medium (1L): NB Basal Medium (PhytoTech) 4.1 g, sucrose 30 g, glutamine 0.5 g, proline 0.5 g, hydrolyzed casein 0.5 g, 1 mL 2,4-D solution (1 mg / mL), pH 5.8, and add 4.5 g / L plant gel for solidification.

[0074] 6) Incubate in the dark for about 14 days, remove the endosperm, germ and radicle, and the obtained callus can be used for transgenic and subculture, subculture every two weeks, and the number of subcultures depends on the state of the callus.

[0075] 2. Preparation of Agrobacterium transformation solution

[0076] 1) The constructed plasmid (recombinant plasmid pYLCRISPR / Cas9- OsPLDRP1 , recombinant plasmid pUN1301 - OsPLDRP1-Flag , recombinant plasmid pUN1301- OsPLDRP1-GFP ) is transformed into EHA105 competent cells by chemical method, and cultured at 28°C for two days.

[0077] 2) Pick single colonies and place them in 5 mL of LB liquid medium containing the corresponding antibiotics and culture at 28°C for 48 h.

[0078] 3) Take 1 mL of the overnight culture and transfer it into 15 mL of AB (20 mg / L Rif + 50 mg / L Kan + 100 mg / L AS) liquid medium, and culture at 28°C until OD600=0.5 (about 4 h). AB liquid medium (1L): KH2PO4 3 g, NaH2PO4 1 g, NH4Cl 1 g, MgSO4·7H2O 300 mg, KCl 150 mg, CaCl2 10 mg, FeSO4·7H2O 2.5 mg, glucose 5 g.

[0079] 3. Co-culture of rice callus and Agrobacterium solution

[0080] 1) Centrifuge the bacterial solution at 4000 rpm for 10 min, discard the supernatant.

[0081] 2) Resuspend the bacterial pellet to an OD600 of 0.4-0.6 with AAM containing 100 mg / L AS.

[0082] 3) Co-culture the bacterial solution with the rice callus for 20 min, with occasional shaking.

[0083] 4. Selection

[0084] Dry the callus with sterile filter paper and transfer to selection medium containing hygromycin and carbenicillin to select for resistant callus. Replace the medium every two weeks.

[0085] Selection medium: S1: 100 mg / L carbenicillin + 30 mg / L hygromycin, S2: 100 mg / L carbenicillin + 40 mg / L hygromycin, S3: 100 mg / L carbenicillin + 50 mg / L hygromycin.

[0086] 5. Differentiation

[0087] Transfer the selected rice callus to rice differentiation medium and culture under light. Replace the medium every two weeks until the callus differentiates into shoots.

[0088] MS rice differentiation medium (1 L): M&SBASAL MEDIUM w / VITAMINS (PhytoTech) 4.43 g, sucrose 30 g, 6-BA 3 mg / L, NAA 0.5 mg / L, pH 6.3, add 4.5 g / L plant gel for solid medium.

[0089] 6. Rooting

[0090] Transfer the shoots on differentiation medium to rooting medium and grow for about 2 weeks. Remove the seedlings from the agar medium and culture in water for 7 days before transplanting to soil.

[0091] 1 / 2MS rice rooting medium (1 L): M&SBASAL MEDIUM w / VITAMINS (PhytoTech) 2.165 g, sucrose 20 g, pH 6.3, add 4.5 g / L plant gel for solid medium.

[0092] 7. PCR identification

[0093] Extract genomic DNA from leaves of the regenerated plants and perform PCR amplification using the primers in Table 5. Sequence the amplification products.

[0094] Table 5 Primers for identifying regenerated rice plants

[0095]

[0096] Through the above identification, two mutant plants were screened from the obtained regenerated plants, and were named as plant CR-Ospldrp1#1 and plant CR-Ospldrp1#2 . The coding region of sgRNA pair OsPLDRP1 was designed to be targeted for knockout, and the target point was selected on the first exon. Through sequencing identification, compared with the genomic DNA of TP309 wild type, as shown in Figure A of Figure 2 , plant CR-Ospldrp1#1 inserted 1 base A (caused a frameshift mutation and premature termination) in the gene encoding OsPLDRP1 protein, and plant CR-Ospldrp1#1 inserted 1 base T (caused a frameshift mutation and premature termination) in the gene encoding OsPLDRP1 protein. At the same time, overexpression materials of OsPLDRP1 driven by strong promoter Ubiquitin were obtained, Ubi : OsPLDRP1#1-#6 as shown in Figure B of Figure 2 , WB identification Ubi : OsPLDRP1#1-#6 has high expression.

[0097] Example 3 OsPLDRP1 is located in the cell membrane and nucleus of rice

[0098] 1) After the rice seeds were peeled and sterilized, they were sowed in 1 / 2MS and grown at 28°C for 9-11 days.

[0099] 2) The rice seedlings were taken out, and the roots and leaves were cut off, and the leaf sheath tissue (about 5-6g) was reserved.

[0100] 3) The leaf sheath tissue was cut into 0.5-1 mm small pieces with a single-blade knife, and the cut leaf sheath was transferred to a conical flask and washed with 5ml 0.6M D-Mannitol solution in the culture dish, and placed in the dark.

[0101] 4) Enzyme Solution 15ml was prepared and added to the cut leaf sheath tissue; the conical flask containing the leaf sheath tissue was covered with tin foil paper, and the enzyme hydrolysis was carried out in the dark for 3-4h.

[0102] 5) The protoplasts were filtered with a 40μm filter, carefully transferred to a 50ml round-bottom centrifuge tube, and the rice tissue was re-washed and filtered several times with W5 solution, and then the filtrate was combined, mixed gently, centrifuged at 60g for 5min.

[0103] 6) Remove supernatant, resuspend with 10 ml W5 solution, centrifuge 60 g, 5 min.

[0104] 7) Remove supernatant, resuspend with 5 ml W5 solution, put on ice, avoid light, natural sedimentation 30 min.

[0105] 8) Centrifuge 60 g, 5 min, collect protoplast, remove supernatant as much as possible.

[0106] 9) Add appropriate amount of MMG solution (100 μl / tube), resuspend gently, microscope.

[0107] 10) Add 10 μl plasmid DNA (1 μg / μl) to 2 ml round-bottom centrifuge tube, then add 100 μl protoplast, mix gently, finally add 110 μl PEG-Ca 2+ transformation solution, flick with fingers, mix, transformation time 15 min.

[0108] 11) After transformation, add 440 μl W5 solution, mix by inverting, terminate reaction, 100 g centrifuge, 2 min.

[0109] 12) Remove supernatant, resuspend with 1 ml W5 solution, 25°C flat culture, overnight.

[0110] 13) Next day 100 g centrifuge 2 min, leave 100 μl W5 solution to suspend protoplast, Confocal observation of fluorescence.

[0111] As Figure 3 shown, OsPLDRP1 is localized in the cell membrane and nucleus of rice. Wherein, A is transiently transformed rice protoplast reveals that OsPLDRP1 has cell membrane and nuclear localization. OsPLDRP1 The complete open reading frame is fused with GFP tag at C terminal, transiently transformed rice protoplast, observe fluorescence distribution after 16h, the reported nuclear marker gene OsNLS as an indication, scale 10 μm; B is transiently infected tobacco cells reveal that OsPLDRP1 has cell membrane and nuclear localization. OsPLDRP1 The complete open reading frame is fused with GFP tag at C terminal, Agrobacterium infected tobacco, observe fluorescence distribution after 48h transient expression, the reported nuclear marker gene tdT as an indication, scale 10 μm.

[0112] Example 4 OsPLDRP1 Negative regulation of rice resistance to Magnaporthe grisea

[0113] 1) Field harvested seeds were oven dried at 42°C for 4-7 days and sun dried for a week, then soaked in water at room temperature for 24 h, the soaking water was discarded and the seeds were washed with clean water for three times, then the seeds were placed on wet paper towel and kept at room temperature for 2 days for germination. When the seedlings were about 0.5 cm in length, they were transplanted into greenhouse soil or water culture boxes. The rice culture box was kept at 28°C with 12 h light and 12 h dark.

[0114] 2) Pyricularia grisea race TH12 was activated with CM medium. Filter paper pieces containing P. grisea spores were placed in the center of CM solid medium. The medium was incubated at 28°C for 7-10 days for sporulation (12 h light / 12 h dark). When the CM medium was covered with mycelium, the spores were washed off with pure water containing 0.02% Tween 20, filtered with double layers of gauze, and prepared into a spore suspension. The spore concentration for inoculation was 5 x 10 5 spores per ml, and there were 30-50 spores per field under 10 x 10 microscope.

[0115] 3) Knockout lines and overexpression lines of OsPLDRP1 and wild type TP309 were inoculated with P. grisea in vitro. The disease incidence was investigated 7-10 days after inoculation, and the length of disease spots was measured to calculate the fungal growth amount on the leaves of each rice plant.

[0116] The results are shown in Figure 4 The length of P. grisea spots on the leaves of CR-Ospldrp1#1 and CR-Ospldrp1#2 was significantly reduced compared to wild type TP309, and the fungal growth amount was also lower. The length of P. grisea spots on the leaves of Ubi : OsPLDRP1# 1-#2 was significantly increased compared to wild type TP309, and the fungal growth amount was also higher. Therefore, it was proved that OsPLDRP1 negatively regulates the resistance of rice to P. grisea.

[0117] Example 5 OsPLDRP1 Negative regulation of the resistance of rice to X. oryzae

[0118] 1) The sclerotia of X. oryzae preserved in the laboratory were placed on PDA solid medium and grown at 28°C. PDA medium (1 L): potato 200 g (cut into small pieces and boiled with water until the potato pieces were soft and pulpy, filtered with four layers of gauze), glucose 20 g, and 15 g / L agar powder was added to the solid medium.

[0119] 2) When new mycelium grew out of the sclerotia, the leading end of the mycelium was cut off with a sterile blade and placed on a new PDA medium for culture.

[0120] 3) Repeat step 2 until no other contaminant bacteria on the medium, continue to culture for 2-3 days until sclerotia are produced.

[0121] 4) Cut the toothpicks into small pieces of about 2 cm, sterilize.

[0122] 5) Take the sclerotia on PDA medium, after 1-2 days of culture, spread the sterilized toothpicks, continue to grow for 2-3 days, when the mycelium crawls over the toothpicks, it can be used to inoculate the sheath blight fungus.

[0123] 6) Rice can be inoculated with sheath blight fungus when it is about 2 months old before the booting stage. When inoculating, use tweezers to take the toothpicks and insert them into the second and third leaf sheaths of rice.

[0124] 7) The incidence of sheath blight fungus can be observed 7 days after inoculation.

[0125] The results are shown in Figure 5 , the lesion length on the leaf sheath of the knockout line CR-Ospldrp1#1 and the plant CR-Ospldrp1#2 is significantly reduced compared with the wild type TP309, proving that it negatively regulates the resistance of rice to the fungus sheath blight fungus. OsPLDRP1

[0126] Example 6 OsPLDRP1 Negative regulation of the resistance of rice to Xoo

[0127] 1) Take the Xoo strain preserved in the laboratory, activate it on PSA plates for 2-3 times, and incubate at 28°C for 48-72h.

[0128] 2) After the single colonies grow, they can be picked and cultured in PSA liquid medium for 1-2 days.

[0129] 3) Take 100 μl of bacterial solution and evenly spread it on PSA plates with a clean spreader, invert and incubate at 28°C for 48-72h. The Xoo that grows can be used for rice inoculation.

[0130] 4) Scrape the Xoo that grows on the PSA medium with sterilized water, and dilute it to an OD value of 1.0.

[0131] 5) Dip the scissors in the bacterial solution and cut the rice leaf tip 1-2 cm obliquely.

[0132] 6) After 12-14 days of inoculation, measure the length of the leaf lesion.

[0133] The results are shown in Figure 6 , the lesion length on the leaf of the knockout line CR-Ospldrp1#1 and the plant CR-Ospldrp1#2 is significantly reduced compared with the wild type TP309, while the overexpression line Ubi : OsPLDRP1#1-2 ​The length of lesions on the leaves was significantly increased compared to the wild type TP309, thus proving that... OsPLDRP1 It negatively regulates the resistance of rice to the bacterial disease Bacillus thuringiensis.

[0134] Example 7 OsPLDRP1 Positive regulation of agronomic traits such as rice plant height and early heading

[0135] observe OsPLDRP1 The effects on rice agronomic traits were found, such as Figure 7 As shown, OsPLDRP1 Overexpressing the gene resulted in looser plant architecture, taller rice, and earlier heading agronomical traits compared to wild-type rice; while OsPLDRP1 The knockout mutant plants had smaller spike lengths than the wild type, which indicates that... OsPLDRP1 It can stimulate the plant's immune response while affecting the normal growth and development of rice.

[0136] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. Application of OsPLDRP1 protein or its encoding gene as a target point in regulating the resistance of rice to Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae, characterized in that, The regulation is down-regulating the activity of the OsPLDRP1 protein or the expression amount of the gene coding the OsPLDRP1 protein, thereby up-regulating the resistance of the rice to Magnaporthe oryzae, Rhizoctonia solani and Xanthomonas oryzae pv. oryzae; The down-regulation is reducing the expression amount of the OsPLDRP1 protein or the gene coding the OsPLDRP1 protein by an inhibitor of the activity of the OsPLDRP1 protein or the expression amount of the gene coding the OsPLDRP1 protein, and the inhibitor is sgRNA or dsRNA. The amino acid sequence of the OsPLDRP1 protein is shown as SEQ ID NO. 1, and the nucleotide sequence of the gene coding the OsPLDRP1 protein is a DNA molecule with the coding region shown as the sequence of SEQ ID NO.

2.

2. Use according to claim 1, characterized in that, The inhibitor is siRNA.

3. Use according to claim 1, characterized in that, The inhibitor is sgRNA, and the sequence of the sgRNA is shown as SEQ ID NO.

7.

4. The use of a composition containing the OsPLDRP1 protein or its encoding gene as a rice growth promoter in regulating rice agronomic traits, characterized in that, The regulation is increasing the content of the OsPLDRP1 protein or up-regulating the expression amount of the gene coding the OsPLDRP1 protein, increasing the height of the rice, making the plant type of the rice more loose, and making the rice heading earlier; the amino acid sequence of the OsPLDRP1 protein is shown as SEQ ID NO. 1, and the nucleotide sequence of the gene coding the OsPLDRP1 protein is a DNA molecule with the coding region shown as the sequence of SEQ ID NO. 2.

Images