Application of GmROH1 gene in improving soybean mosaic virus resistance

By overexpressing the GmROH1 gene in soybeans and using Agrobacterium mediating technology to transform recombinant vectors, the problem of insufficient resistance to soybean mosaic virus is solved, the disease resistance of soybeans is improved and new breeding resources are provided.

CN120485259APending Publication Date: 2025-08-15ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510690740.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the resistance of soybeans to mosaic viruses, and long-term planting of the same disease-resistant variety is likely to cause mutation of the virus strain, resulting in a decrease in disease resistance. It is difficult for detection technology to ensure that the seeds are non-toxic, and the poisonous seeds flow into the market and cause the spread of diseases.

Method used

By overexpressing the GmROH1 gene, the recombinant expression vector was transferred into soybeans using Agrobacterium mediating technology to obtain soybean plants that overexpress the GmROH1 gene were improved to improve their resistance to mosaic viruses.

Benefits of technology

The soybean plants have achieved the ability to resist mosaic viruses, provided new breeding resources, improved the disease resistance of soybeans, avoided the spread of diseases and reduced variety resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485259A_ABST
    Figure CN120485259A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to application of a GmROH1 gene in improvement of soybean mosaic virus resistance, and the GmROH1 gene has the accession number of 100806977 in an NCBI library. A key gene GmROH1 related to mosaic virus resistance is screened, it is found that overexpression of the GmROH1 gene in soybeans can improve the mosaic virus resistance of the soybeans, the disease index of soybean plants with the overexpressed GmROH1 gene is moderate resistance, and a new resource is provided for soybean breeding work.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and particularly relates to the application of the GmROH1 gene in improving soybean mosaic virus resistance. Background Art

[0002] Currently, prevention and control measures for soybean mosaic virus disease primarily include comprehensive measures such as selecting virus-free seeds and breeding resistant varieties. However, existing technologies have numerous limitations. For example, despite increased seed testing, soybeans are susceptible to viruses, making it difficult to fully ensure seed is virus-free. This results in infected seeds entering the market and spreading the disease. Regarding breeding resistant varieties, while some resistant varieties, such as Jiyu 86, Heike 60, and New Soybean No. 13, have been developed, long-term cultivation of the same resistant variety can easily lead to mutations in the virus strain, reducing or even eliminating the variety's resistance. Furthermore, most local varieties are highly sensitive to mosaic virus, with some varieties experiencing as much as 100% seed infection. The resistance of newly developed improved varieties still needs to be further improved. Summary of the Invention

[0003] In response to the demand for breeding soybean varieties resistant to mosaic virus in the prior art, the present invention provides an application of the GmROH1 gene in improving soybean mosaic virus resistance. The specific technical solution is as follows:

[0004] In a first aspect, the present invention provides an application of the GmROH1 gene in improving resistance to soybean mosaic virus. The accession number of the GmROH1 gene in the NCBI database is 100806977.

[0005] Furthermore, the application approach is to improve the resistance of soybean to mosaic virus by overexpressing the GmROH1 gene.

[0006] In a second aspect, the present invention provides a use of GmROH1 protein in improving resistance to soybean mosaic virus. The accession number of the GmROH1 protein in the NCBI database is XP_003519985.1.

[0007] In a third aspect, the present invention provides an application of a recombinant vector in improving resistance to soybean mosaic virus, wherein the recombinant vector comprises the GmROH1 gene, and the accession number of the GmROH1 gene in the NCBI database is 100806977.

[0008] In a fourth aspect, the present invention provides use of a genetically engineered bacterium in improving resistance to soybean mosaic virus, wherein the genetically engineered bacterium comprises the GmROH1 gene, and the accession number of the GmROH1 gene in the NCBI database is 100806977.

[0009] In a fifth aspect, the present invention provides a method for enhancing soybean resistance to mosaic virus, comprising:

[0010] Improve soybean mosaic virus resistance by overexpressing the GmROH1 gene;

[0011] The accession number of the GmROH1 gene in the NCBI database is 100806977.

[0012] Furthermore, the overexpression method is:

[0013] (1) Constructing a plant expression vector based on the cDNA of the GmROH1 gene;

[0014] (2) Using Agrobacterium-mediated technology to transfer the recombinant expression vector into soybean recipient materials, and obtaining transgenic soybean T0 generation plants through screening and cultivation;

[0015] (3) Transgenic soybean T0 generation plants were self-pollinated to obtain T1 generation seeds;

[0016] (4) T1 generation seeds are cultivated and screened to obtain transgenic soybean T1 generation plants;

[0017] (5) Transgenic soybean T1 generation plants were self-pollinated to obtain T2 generation seeds;

[0018] (6) T2 generation seeds were cultivated to obtain plants overexpressing the GmROH1 gene.

[0019] Furthermore, the soybean variety is Tianlong No. 1.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention screened out a key gene GmROH1 related to mosaic virus resistance, and found that overexpressing the GmROH1 gene in soybeans can improve the soybean's ability to resist mosaic virus. The disease index of soybean plants overexpressing the GmROH1 gene showed moderate resistance. This application provides a new resource for soybean breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of the GmROH1 gene structure.

[0023] Figure 2 Schematic diagram of the functional domains of GmROH1 protein.

[0024] Figure 3 Schematic diagram of the phylogenetic tree of the GmROH1 gene.

[0025] Figure 4 This is the subcellular localization map of the GmROH1 gene.

[0026] Figure 5 Figure 3 shows the prediction of tissue expression pattern of GmROH1 gene (A) and specific expression analysis (B). Values marked with different letters (ad) indicate significant differences at the P < 0.05 level under the Duncan test.

[0027] Figure 6 Statistical graph of the relative expression levels of the GmROH1 gene in different overexpression soybean lines; values marked with different letters (ab) indicate significant differences at the P < 0.05 level under the Duncan's test.

[0028] Figure 7 The phenotypic results of NT and overexpression lines 21 days after inoculation with SMV; A is a leaf photo, and B is a plant photo.

[0029] Figure 8 Statistical graph of disease index of NT and overexpression strains 21 days after mosaic virus inoculation. Values marked with different letters (ab) indicate significant differences at the P<0.05 level under Duncan's test. DETAILED DESCRIPTION

[0030] In order to make those skilled in the art better understand the present invention, the technical solution of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed description is exemplary and is only a part of the embodiments of the present invention, rather than all embodiments.

[0031] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.

[0033] Example 1 Acquisition and bioinformatics analysis of the GmROH1 gene

[0034] The GmROH1 gene ID 100806977 was searched in NCBI (https: / / www.ncbi.nlm.nih.gov / ) to obtain the sequence information of the gene. The gene is located on soybean chromosome 2 and the sequence is derived from the cultivated soybean variety Williams 82. The gene sequence is 2120 bp long, the coding region sequence is 1137 bp long, and it encodes 378 amino acids. The encoded protein is ID XP_003519985.1 in the NCBI database. The gene structure was analyzed using GSDS2.0. The gene has one intron and 5' and 3' non-coding regions (such as Figure 1 shown).

[0035] InterPro and Smart online software analysis revealed no conserved domains in the GmROH1 protein and its function remains unknown. Smart Blast analysis revealed that the protein was highly similar to Arabidopsis ROH1, putative protein (DUF793) and BPS1-like protein (DUF793). Figure 2 Both proteins belong to the BPS1 family and contain the DUF793 domain. The BPS1 family includes several plant proteins, including BYPASS1, and is essential for normal root and stem development. Protein functional domain analysis using the NCBI Conserved Domain Database (CDD) revealed that the ROH1 protein belongs to the DUF677 family of proteins of unknown function. It contains conserved domains of ROH1-like proteins within the DUF677 superfamily and may have similar functions. Further searches and comparisons revealed that ROH1-like proteins are related to BYPASS1 and likely function through mechanisms similar to those of BPS1 and ROH1-like family proteins.

[0036] The amino acid sequence of GmROH1 protein was compared with the amino acid sequences of ROH1 genes of Medicago truncatula (XP_013457254.1), Vigna angularis (XP_017435299.1), Vigna umbellata (XP_047168525), Arabidopsis thaliana (NP_176576.1), Arachis duranensis (XP_015942538.1), Pisum sativum (XP_050894900.1), and Arachis stenosperma (XP_057762185.1) in NCBI, and a phylogenetic tree was constructed (e.g. Figure 3As shown in Figure 3 ), it was found that GmROH1 was closely related to Arachis duranensis (XP_015942538.1).

[0037] Example 2 Subcellular localization and tissue-specific expression

[0038] Subcellular localization of GmROH1 gene was performed, and the results were as follows Figure 4 As shown, it can be seen that the GmROH1 gene is located in the cell membrane, cytoplasm and nucleus.

[0039] The tissue-specific expression of GmROH1 gene was performed. Figure 5 As shown in A and B, the GmROH1 gene mainly plays a role in roots and pods, with the highest expression level in pods, followed by roots, lower expression levels in leaves, stems and seeds, and the lowest expression level in flowers, where the expression level in pods is about 16 times that in flowers.

[0040] Example 3: Acquisition of GmROH1 gene overexpression strain and mosaic virus inoculation test

[0041] (1) Obtaining plants overexpressing the GmROH1 gene

[0042] According to the cDNA sequence of the GmROH1 gene, the overexpression vector pLM-B001-GmROH1 was constructed, and the overexpression vector was transferred into the recipient soybean Tianlong No. 1 using Agrobacterium-mediated genetic transformation. A total of multiple T0 generation strains were obtained, and four of them were independent positive transgenic strains GmROH1-02, GmROH1-11, GmROH1-26 and GmROH1-28 after glufosinate smear detection, bar protein test strip detection and PCR verification. The four independent positive transformed strains were self-pollinated and propagated to the T2 generation for gene function verification. The qRT-PCR specific primers are ROH1CX-F: ATGCGTACTACAGCAGAATTTCAAG and ROH1CX-R: CCGGCAACAGGATTCAATCT. These primers were used to detect the expression levels of GmROH1 in the four overexpression strains. The relative expression levels of the GmROH1 gene in different transgenic lines are shown in Figure 2. Figure 6 shown.

[0043] (2) Mosaic virus inoculation test

[0044] The transgenic soybean lines obtained in (1) were inoculated with mosaic virus. 21 days after inoculation, photos were taken and the results were observed. Figure 7As shown in Figures A and B, the four GmROH1 overexpressing soybean lines showed normal plant growth, with large, expanded leaves and no obvious wrinkling or mottling. In contrast, the NT (wild-type) plants were shorter, with smaller leaves and obvious mosaic symptoms, such as wrinkling and curling.

[0045] Mosaic virus symptoms in individual soybean plants were categorized on a five-point scale, ranging from 0 to 4, with 0 indicating a normal plant with no symptoms; 1 indicating a normal plant with flat leaves and mild mosaic or yellowing of the leaves (without vein blight); 2 indicating a generally normal plant with mosaic, mottled, or curled leaves; 3 indicating a slightly dwarfed plant with wrinkled mosaic; and 4 indicating a dwarfed plant with deformed, wrinkled leaves, systemic vein blight, or blight. Disease index (DI) was calculated for each line based on the mosaic virus grading. The disease index (DI) = (∑(number of plants at each disease grade × corresponding grade) / total number of plants surveyed × highest grade) × 100. A DI of 0 ≤ DI ≤ 20 indicates high resistance, 20 < DI ≤ 35 indicates resistance, 35 < DI ≤ 50 indicates moderate resistance, 50 < DI ≤ 70 indicates susceptible, and 70 < DI ≤ 100 indicates high susceptible. A total of 21 plants from each transgenic and wild-type soybean line were surveyed for disease index calculation. Disease index analysis showed that the disease index of NT was 58, indicating susceptible (S), while the disease indexes of the four GmROH1 overexpressing transgenic lines ranged from 25 to 37, indicating moderate resistance (MR) ( Figure 8 ).

Claims

1. Application of the GmROH1 gene in improving soybean mosaic virus resistance, characterized in that: The accession number of the GmROH1 gene in the NCBI database is 100806977.

2. The use according to claim 1, characterized in that The application approach is to improve the resistance of soybean to mosaic virus by overexpressing the GmROH1 gene.

3. Application of GmROH1 protein in improving resistance to soybean mosaic virus, characterized in that: The accession number of the GmROH1 protein in the NCBI database is XP_003519985.

1.

4. Use of a recombinant vector in improving resistance to soybean mosaic virus, characterized in that: The recombinant vector contains the GmROH1 gene, and the accession number of the GmROH1 gene in the NCBI library is 100806977.

5. The use of genetically engineered bacteria in improving resistance to soybean mosaic virus, characterized in that: The genetically engineered bacteria contains the GmROH1 gene, and the accession number of the GmROH1 gene in the NCBI database is 100806977.

6. A method for enhancing soybean resistance to mosaic virus, characterized in that: include: Improve soybean mosaic virus resistance by overexpressing the GmROH1 gene; The accession number of the GmROH1 gene in the NCBI database is 100806977.

7. The method according to claim 6, characterized in that The overexpression method is: (1) Constructing a plant expression vector based on the cDNA of the GmROH1 gene; (2) Using Agrobacterium-mediated technology to transfer the recombinant expression vector into soybean recipient materials, and obtaining transgenic soybean T0 generation plants through screening and cultivation; (3) Transgenic soybean T0 generation plants were self-pollinated to obtain T1 generation seeds; (4) T1 generation seeds are cultivated and screened to obtain transgenic soybean T1 generation plants; (5) Transgenic soybean T1 generation plants were self-pollinated to obtain T2 generation seeds; (6) T2 generation seeds were cultivated to obtain plants overexpressing the GmROH1 gene.

8. The method according to any one of claims 6 to 7, characterized in that The soybean variety is Tianlong No. 1.