Application of OsT5H gene in enhancing low temperature stress resistance of rice seedling stage

Abstract

The present application relates to rice OsT5H The application of the gene in enhancing the low-temperature stress resistance of rice seedlings. Specifically, the present application clones a rice OsT5H gene involved in positively regulating low-temperature stress resistance in rice, so that the rice OsT5H gene overexpression, compared with wild type plants, the rice OsT5H gene overexpression plants show low temperature characteristics, the survival rate is significantly increased, the ion leakage rate is significantly reduced. The rice OsT5H OsT5H The discovery of the new function of the gene provides an important gene resource for breeding rice varieties resistant to low-temperature stress.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, in particular to OsT5H Application of genes in enhancing resistance to low temperature stress in rice seedlings. Background Art

[0002] As one of the most important staple crops, rice is extremely sensitive to cold stress. Low temperatures can adversely affect seed growth and development, leading to significant yield losses. Therefore, improving the cold resistance of rice seedlings is crucial for reducing chilling damage and promoting direct seeding.

[0003] As an important food crop in the world, rice seedlings are particularly sensitive to low temperature stress, which seriously affects the growth and development of seeds and the final yield. To meet this challenge, researchers have explored strategies to improve the cold resistance of rice seedlings from multiple aspects. On the one hand, introducing cold-resistant genes into rice varieties through biotechnology has become a key way to reduce the damage caused by low temperatures and ensure yields. For example, studies have shown that OsCTB4a 、 OsMAPK3 、 OsCBL7 and OsSAPK6 Genes such as phosphatase play a crucial role in rice cold adaptation and cold resistance by regulating the phosphorylation of cold-induced target genes (Zhang et al., 2017; Li et al., 2022; Jia et al., 2022; Guo et al., 2022; Lou et al., 2022). Improving seed vigor is also an important means of enhancing seedling cold resistance. Treating seeds with chemicals such as melatonin before sowing (Li et al., 2021) can effectively mitigate the negative effects of cold stress and promote seed germination and seedling growth. Furthermore, spraying specifically formulated liquid chemicals offers another solution for improving rice seedlings' cold adaptation (Sun et al., 2020; Back, 2021), although its high cost limits its widespread application. However, the regulatory mechanisms of rice cold resistance remain incompletely understood. Although several genes associated with cold resistance have been identified, the number of cold resistance genes cloned and functionally characterized in rice remains limited. As a complex quantitative trait, plant cold resistance is regulated by multiple genes (Chen et al., 2018; Zu et al., 2023; Ding et al., 2023). Therefore, identifying new cold resistance-related genes and elucidating their mechanisms of action are crucial for improving cold resistance breeding strategies.

[0004] OsT5HThe gene encodes the CYP71P1 protein of the cytochrome P450 monooxygenase family. OsT5H catalyzes the conversion of tryptamine to 5-hydroxytryptamine, which can induce the expression of defense genes and cell death, enhancing resistance to rice blast infection, and thus playing an important role in rice innate immunity. At the same time, the expression of defense genes induced by 5-hydroxytryptamine is mediated by the RacGTPase pathway and the a subunit of the G protein heterotrimer (Fujiwara et al. 2010). In rice mutants with inactivated CYP71A1 genes, 5-hydroxytryptamine is not produced, salicylic acid levels are higher, and the plants are more insect-resistant. Adding serotonin to resistant rice mutants and other brown planthopper-resistant genotypes results in a loss of insect resistance (Lu et al. 2018). Abscisic acid (ABA) inhibits OsT5H The expression of the gene promotes the synthesis of suberin in rice roots; on the contrary, overexpression OsT5H Genetic manipulation or exogenous 5-HT supplementation can inhibit root suberization and reduce tolerance to salt stress (Lu et al. 2022). However, no studies have been reported on the effect of OsT5H on low temperature stress. Summary of the Invention

[0005] Based on the prior art, the present invention found that overexpression in rice plants OsT5H The gene can improve the low temperature stress resistance of rice plants at the seedling stage. Therefore, in one aspect of the present invention, a rice OsT5H On the other hand, the present invention also provides a method for improving the resistance of rice to low temperature stress at the seedling stage, which comprises: overexpressing the rice OsT5H Furthermore, the present invention also provides a rice OsT5H Application of genes in genetic breeding to improve resistance to low temperature stress in rice seedlings.

[0006] In this regard, the present invention includes but is not limited to the following:

[0007] In one aspect, the present invention provides rice OsT5H The application of the gene in improving the resistance of rice seedlings to low temperature stress and / or rice variety improvement and breeding is characterized in that the rice OsT5H Gene, the rice OsT5H The gene encodes the amino acid sequence shown in SEQ ID NO: 3.

[0008] In another aspect, the present invention provides a method comprising OsT5H Application of a recombinant vector of a gene in improving the resistance of rice seedlings to low temperature stress and / or rice variety improvement breeding, characterized in that the rice OsT5H Gene, the rice OsT5HThe gene encodes the amino acid sequence shown in SEQ ID NO: 3.

[0009] In one aspect, the recombinant vector of the present invention comprises the overexpression promoter Ubi.

[0010] Preferably, the recombinant vector of the present invention is a recombinant pCAMBIA1301 vector comprising the overexpression promoter Ubi.

[0011] In one aspect, the present invention provides an application of a genetically engineered bacterium in improving the resistance of rice seedlings to low temperature stress and / or in genetic breeding for rice variety improvement, characterized in that the genetically engineered bacterium contains rice OsT5H Recombinant vector of the gene, overexpressing the rice OsT5H Gene, the rice OsT5H The gene encodes the amino acid sequence shown in SEQ ID NO: 3. Preferably, the genetically engineered bacteria of the present invention are genetically engineered Escherichia coli or Agrobacterium.

[0012] In one aspect, the genetically engineered bacteria of the present invention are genetically engineered Agrobacterium.

[0013] In one aspect, the genetically engineered bacteria of the present invention is genetically engineered Agrobacterium GV3101.

[0014] In another aspect, the present invention provides a method for improving the resistance of rice to low temperature stress at the seedling stage and / or improving rice varieties through genetic breeding, characterized in that the method comprises: overexpressing rice OsT5H Gene, the rice OsT5H The gene encodes the amino acid sequence shown in SEQ ID NO: 3.

[0015] In one aspect, the rice variety improvement of the present invention is to improve the resistance of rice to low temperature stress at the seedling stage.

[0016] In another aspect, the present invention provides a method for obtaining rice plants with improved traits, characterized in that it comprises the following steps:

[0017] (1) using genetically engineered bacteria to infect rice callus; and

[0018] (2) Cultivating the infected rice callus into rice plants;

[0019] The genetically engineered bacteria contain rice OsT5H Recombinant vector of the gene, overexpressing the rice OsT5H Gene, the rice OsT5H The gene encodes the amino acid sequence shown in SEQ ID NO: 3.

[0020] In another aspect, the present application provides application of the rice OsT5H protein in improving the low temperature stress resistance of rice seedlings and / or genetic breeding of rice varieties, wherein the amino acid sequence of the rice OsT5H protein is shown as SEQ ID NO: 3.

[0021] In one aspect, the improved trait of the present application is improved low temperature stress resistance of rice seedlings.

[0022] In one aspect, the present application provides a method / step for constructing a gene overexpression OsT5H In one aspect, the present application provides a method / step for constructing a gene overexpression OsT5H In one aspect, the present application provides a method / step for constructing a gene overexpression

[0023] OsT5H -OE-F: 5'-TCTAGAGTTCATACCAACACATCTCCATTGC-3' (SEQ ID NO: 4)

[0024] OsT5H -OE-R: 5'-TCATGACCTCACTAAGCTCCTCTCCCTTAAAC-3' (SEQ ID NO: 5).

[0025] In one aspect, the present application also provides a method / step for constructing a genetically engineered bacterium overexpressing OsT5H In one aspect, the present application provides a method / step for constructing a gene overexpression OsT5H In one aspect, the present application provides a method / step for constructing a gene overexpression

[0026] In one aspect, the present application also provides a method / step for obtaining a rice plant overexpressing OsT5H In one aspect, the present application provides a method / step for constructing a gene overexpression OsT5H In one aspect, the present application provides a method / step for constructing a gene overexpression

[0027] In one aspect, the present application provides a rice plant overexpressing OsT5H In one aspect, the present application provides a rice plant overexpressing

[0028] In one aspect, the present application provides a rice plant overexpressing OsT5H In one aspect, the present application provides a rice plant overexpressing

[0029] In one aspect, the rice variety of the present application is selected from the rice japonica variety Zhonghua 11 (Oryza sativa L. spp. Oryza.Sativa L.spp. Japanese , var. Zhonghua11 ), the rice japonica variety Xidao No. 1 (Oryza sativa L. spp. Oryza.Sativa L.spp. Japanese , var. Hidao #1 ) or Jiazhe B.

[0030] Preferably, the improved resistance to low temperature stress of rice according to the present invention is manifested as follows: compared with the control ordinary rice plants, OsT5H The survival rate of gene-overexpressing rice was significantly higher after low temperature treatment at the seedling stage.

[0031] In one aspect, the low temperature of the present invention is 12°C or less. In one aspect, the low temperature of the present invention is 11°C or less, 10°C or less, 9°C or less, 8°C or less, 7°C or less, 6°C or less, 5°C or less, or 4°C or less. In one aspect, the low temperature of the present invention is 4°C.

[0032] The present invention will OsT5H The gene was introduced as the target gene into the japonica rice variety Xidao No. 1 ( Oryza.Sativa L.spp. Japanese , var. Hidao #1 ) OsT5H The T0 generation overexpression plants of the gene were self-pollinated continuously to obtain the homozygous high expression T2 generation strains, which were named XD-OE .

[0033] The present invention utilizes CRISPR / Cas9 gene editing technology to modify the flower 11 ( Oryza.Sativa L.spp. Japanese , var. Zhonghua11 )、Xindao No.1( Oryza.Sativa L. spp. Japanese , var. Hidao #1 ) OsT5H Gene, prepared OsT5H gene knockout plants ost5h-1 (ZH11 background), XD-KO (Xidao No. 1 background).

[0034] In the present invention, OsT5H The nucleotide sequence of the protein coding region of the gene is shown in SEQ ID NO.1, OsT5H The full-length sequence of the gene is shown in SEQ ID NO.2. OsT5H The protein encoded by the gene consists of 484 amino acids, and its amino acid sequence is shown in SEQ ID NO.3, specifically:

[0035]

[0036]

[0037] SEQ ID NO.3: *.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] (1) The present invention overexpresses the protein in common rice Zhonghua 11 plants. OsT5H The gene was found to have a new use in enhancing the resistance of rice to low temperature stress at the seedling stage, providing an important genetic resource for breeding rice varieties resistant to low temperature stress.

[0040] (2) The present invention provides a method for breeding rice germplasm resistant to low temperature stress by using transgenic technology, and obtains OsT5H Gene overexpression homozygous plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] tú1 The rice (1) overexpression homozygous strain in Example 3 XD-OE 、 OsT5H gene knockout plants XD-KO and its control XD-WT, (2) OsT5H gene knockout plants ost5h-1 and its control ZH11, (3) OsT5H Plant survival rate of the gene knockout material (JZ-LM) and its control Jiazhe B (JZ-WT) after 14 days of low temperature stress.

[0042] tú2 The rice (1) overexpression homozygous strain in Example 3 XD-OE 、 OsT5H gene knockout plants XD-KO and its control XD-WT, (2) OsT5H gene knockout plants ost5h-1 and its control ZH11, (3) OsT5H Ion leakage rate of 14-day-old plants of the gene knockout material (JZ-LM) and its control Jiazhe B (JZ-WT) after low temperature stress.

[0043] tú3 For the overexpression in Example 3 OsT5H Gene or knockout OsT5H Genetically modified rice plants after 14 days of low temperature stress OsCBF1 , OsCBF2 and OsCBF3 Among them, (1) Figure A, Figure D and Figure G respectively show OsT5H The knockout plant ost5h-1 and its control plant ZH11 after 14 days of low temperature stress OsCBF1 , OsCBF2 and OsCBF3 Gene expression levels; (2) Panels B, E, and H show OsT5H 14-day low temperature stress in the knockout rice plant JZ-LM and its control Jiazhe B rice plant JZ-WT OsCBF1 , OsCBF2 and OsCBF3 Gene expression levels; (3) Figures C, F, and I are shown in OsT5H Gene overexpression homozygous strain XD-OE, OsT5H The knockout plant XD-KO and its control Xidao No. 1 plant XD-WT after 14 days of low temperature stress OsCBF1 , OsCBF2 and OsCBF3 Gene expression levels. DETAILED DESCRIPTION

[0044] In order to make those skilled in the art better understand the present invention, the technical solution of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed description is exemplary and is only a part of the embodiments of the present invention, rather than all embodiments.

[0045] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.

[0046] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.

[0047] Example 1 Rice OsT5H Gene cloning, construction of gene overexpression engineered bacteria and gene editing engineered bacteria

[0048] 1. Extraction of total RNA from rice

[0049] Total RNA from young rice leaves was extracted using the Tiangen Plant total RNA extraction kit. The extracted RNA was reverse transcribed using a Thermo Fisher reverse transcription kit according to the manufacturer's instructions to obtain cDNA (SEQ ID NO: 1), which was then stored at -20°C for future use.

[0050] 2. OsT5H Construction of gene overexpression engineered bacteria A

[0051] Design Rice OsT5H Specific amplification primers for gene coding region sequences, the primer sequences are as follows:

[0052] OsT5H -OE-F: 5'-TCTAGAGTTCATACCAACACATCTCCATTGC-3'; (SEQ ID NO: 4)

[0053] OsT5H -OE-R:5'-TCATGACCTCACTAAGCTCCTCTCCCTTAAAC-3'; (SEQ ID NO: 5)

[0054] The cDNA (Complementary DNA) obtained by reverse transcription of total RNA from leaves of common rice Zhonghua 11 plants was used as a template to amplify the OsT5H The nucleotide sequence of the gene exon was ligated to the vector pCAMBIA1301 containing the overexpression promoter Ubi, and transformed into competent DH5α Escherichia coli by heat shock at 42°C and then plated.

[0055] The successfully transformed monoclonal DH5α E. coli colony was selected and the bacterial solution after shaking was sent to a sequencing company for sequencing. The sequencing results showed that the vector contained OsT5H The nucleotide sequence of the gene exon was obtained by using the plasmid extraction kit of Quanshijin Company to extract the plasmid, and the plasmid was electroporated into GV3101 Agrobacterium competent cells. After culturing at 28℃ for two days, the plaque was picked and PCR verification was performed to obtain the overexpression vector pCAMBIA1301- OsT5H Agrobacterium engineered bacteria A.

[0056] 3. OsT5H Construction of gene-edited engineered bacteria B

[0057] Based on the genomic sequence (SEQ ID NO: 1), a specific target sequence was searched online (http: / / crispr.hzau.edu.cn / CRISPR / ). The target sequences "CGTACGTGTTGGTCGCGTTGAGG" (ZH11) and "TGGTCGCGTTGAGGAGGAGC" (XD) were selected. Complementary primers were synthesized based on this target sequence and fused in a PCR instrument to generate a fusion fragment containing the target sequence. The pHun4c12 vector was digested with the BsaI restriction endonuclease, and the linearized vector was recovered by gel extraction. Subsequently, the above fusion fragment was ligated into the linearized pHun4c12 vector (Jiang et al., 2019, Mutation of Inositol 1,3,4-trisphosphate 5 / 6-kinase6 Impairs Plant Growth and Phytic Acid Synthesis in Rice. Plants 8(5): 114), and the correct vector was obtained by enzyme digestion identification. Further sequencing confirmed that the target sequence had been introduced into the vector. The correct vector was named pHun4c12- OsT5H At the same time, the heat shock transformation method was used to introduce pHun4c12-OsT5H into the Agrobacterium strain EHA105, thus obtaining the gene editing vector pHun4c12- OsT5H Agrobacterium engineering bacteria B are used for subsequent genetic transformation.

[0058] Example 2 Rice OsT5H Obtaining homozygous plants for gene overexpression and homozygous plants for gene function loss

[0059] 1. Agrobacterium-mediated genetic transformation of rice

[0060] Using pCAMBIA1301- OsT5H Agrobacterium engineering strain A containing overexpression vector and pHun4c12- OsT5HThe gene-edited Agrobacterium engineering bacteria B infected rice callus tissue and after screening with differentiation medium and rooting medium, the corresponding genetically transformed plants were obtained.

[0061] 2. Obtaining homozygous overexpression lines

[0062] A small amount of leaf and root material from the T0 generation overexpression seedlings was used to extract total RNA from the plant material (roots and leaves) using the RNeasy Plant RNA Mini Kit (Qiagen, Hilden, Germany). Reverse transcription of cDNA was performed using 1 μg of total RNA, oligo-dT18 primers, and the GoScript™ Reverse Transcription System (Promega). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using SYBR Green GoTaqqPCR Master Mix (Promega, WI, USA). OsACTIN The gene was used as an internal control and 2 -ΔΔCt Calculation OsT5H Relative expression levels.

[0063] Table 1 Quantitative real-time polymerase chain reaction (qRT-PCR) primers

[0064]

[0065] The T0 generation transgenic overexpressing plants were self-pollinated to obtain T1 generation seeds. 6-9 positive plants were taken from each T0 generation overexpressing plant to produce T2 generation and separated and analyzed. If all T2 generation seedlings produced by T1 generation positive plants were positive after testing, the T1 generation plants were homozygous for overexpression. OsT5H The transgenic lines with overexpressed genes are named XD-OE ; Otherwise, it is a heterozygous strain.

[0066] 3. Obtaining homozygous plants for gene function loss

[0067] The T0 generation transgenic rice was grown to the 3-4 leaf stage and young leaves were selected. Genomic DNA was extracted by CTAB method and the endogenous gene of transgenic rice was amplified using pHun4c12-OsT5H specific primers. OsT5H Gene, sequencing verified PCR products, obtained OsT5H Loss-of-function transgenic lines.

[0068] Example 3 OsT5H Experiment on resistance of gene overexpression rice to low temperature stress

[0069] The rice obtained in Example 2 OsT5H Gene overexpression T2 generation homozygous strain, OsT5HTransgenic pure lines with gene function loss and their control ordinary rice plants were treated with low temperature stress.

[0070] 1. Low temperature stress of rice

[0071] To assess the cold tolerance of rice plants, 14 days after seed soaking, rice seedlings were transferred to either 4°C (experimental) or 30°C (control) for 7 days, followed by 7 days of recovery at 30°C. Survival was then analyzed. All treatments included three biological replicates, each consisting of 30 to 40 plants, for survival determination. All tests were conducted in an artificial chamber under the following conditions (relative humidity: 65-75%; 16 h light / 8 h dark).

[0072] 2. Determination of plant survival rate, ion leakage rate, and expression levels of related cold stress response genes

[0073] A small amount of rice leaves was taken from the above-mentioned rice plants, and total RNA was extracted from the plant material using the RNeasy Plant RNA Mini Kit (Qiagen, Hilden, Germany). 1 μg of total RNA was used, oligo-dT18 primers were used, and the GoScriptTM Reverse Transcription System (Promega) was used to reverse transcribe cDNA. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using SYBR Green GoTaq qPCR Master Mix (Promega, WI, USA). OsACTIN The gene was used as an internal control and 2 -ΔΔCt The relative expression levels of related genes were calculated.

[0074] By overexpressing homozygous strain XD-OE, OsT5H Gene knockout plant XD-KO and its control XD-WT, (2) OsT5H gene knockout plants ost5h-1 and its control ZH11, (3) OsT5H Fourteen-day-old plants of the knockout material (JZ-LM) and its control Jiazhe B (JZ-WT) (Lu et al., 2018) were cold-treated for 7 days and then cultured under normal conditions for 7 days. The plant survival rate, ion leakage rate, and related cold stress response genes ( OsCBF1 , OsCBF2 and OsCBF3) expression levels. The ion leakage assay was performed as follows: ion leakage was quantified according to Ding et al. (Ding, Y., Li, H., Zhang, X., Xie,Q., Gong, Z., Yang, S. (2015). OST1 kinase modulates freezing tolerance by enhancing ICE1 stability in Arabidopsis. Dev. Cell 32: 278–289). Approximately 0.1 g of leaf tissue from cryopreserved seedlings was placed in a 15 mL tube and 5 mL of deionized water was added. The sample was gently shaken at 200 rpm for 1 hour at room temperature, and the initial conductivity (A1) was recorded. The sample was then heated in boiling water for 20 minutes and incubated again at room temperature for 1 hour, and the final conductivity (A2) was measured. The deionized water conductivity (A0) was used as the baseline. Ion leakage was calculated as: Ion leakage (%) = (A1 − A0) / (A2 − A0).

[0075] turn out, OsT5H Survival rate and cold stress response genes of gene overexpression rice after low temperature treatment ( OsCBF1 , OsCBF2 and OsCBF3 ) expression was significantly higher than that of the control (see tú1 and tú3 ), while the ion leakage rate was significantly lower than that of the control (see tú2 );and OsT5H Survival rate of gene knockout rice plants after low temperature treatment and expression of cold stress response genes ( OsCBF1 , OsCBF2 and OsCBF3 ) expression was significantly lower than that of the control (see tú3 ), while the ion leakage rate was significantly higher than that of the control (see tú2 ).

[0076] The above experiments show that overexpression OsT5H Genes can improve rice's resistance to cold stress, gene editing OsT5H The gene reduces the resistance of rice to low temperature stress, indicating that OsT5H Genes have very important application value in plant resistance to low temperature stress genetic engineering.

Claims

1. Rice 5T The application of the gene in improving the resistance of rice to low temperature stress at the seedling stage is characterized in that: Overexpressing the rice 5T Gene, the rice 5T The gene encodes the amino acid sequence shown in SEQ ID NO:

3.

2. Contains rice 5T The application of a recombinant vector of a gene in improving the resistance of rice to low temperature stress at the seedling stage is characterized in that: Overexpressing the rice 5T Gene, the rice 5T The gene encodes the amino acid sequence shown in SEQ ID NO:

3.

3. A method for improving the resistance of rice to low temperature stress at the seedling stage using a genetically engineered bacterium, characterized in that: The genetically engineered bacteria contain rice 5T Recombinant vector of gene, overexpressing the rice HS5 Gene, the rice HS5 The gene encodes the amino acid sequence shown in SEQ ID NO:

3.

4. The use according to any one of claims 1 to 3, characterized in that The rice HS5 The nucleotide sequence of the gene coding region is shown in SEQ ID NO:

1.

5. A method for improving the resistance of rice to low temperature stress at the seedling stage, characterized in that: The method comprises: overexpressing rice HS5 Gene, the rice HS5 The gene encodes the amino acid sequence shown in SEQ ID NO:

3.

6. A method for obtaining rice plants with improved traits, characterized in that: The following processing steps are included: (1) using genetically engineered bacteria to infect rice callus; and (2) Cultivating the infected rice callus into rice plants; The genetically engineered bacteria contain rice HS5 Recombinant vector of gene, overexpressing the rice HS5 Gene, the rice HS5 The gene encodes an amino acid sequence as shown in SEQ ID NO: 3, and the improved trait is improved resistance to low temperature stress in rice seedlings.

7. The method according to claim 5 or 6, characterized in that The rice HS5 The nucleotide sequence of the gene coding region is shown in SEQ ID NO:

1.

8. Use of rice OsT5H protein in improving resistance to low temperature stress in rice seedlings, wherein the amino acid sequence of the rice OsT5H protein is shown in SEQ ID NO: 3.

Images