Antiviral artificial microRNA target sequence and screening method and application thereof
By designing the amiRNAs target sequence for the viral RNA silencing repressor VSR gene, the expression vector is constructed and co-expressed with GFP, effective amiRNAs are screened out, which solves the time-consuming and labor-consuming problem in the prior art, and achieves efficient screening and significant inhibition of tomato squid virus.
Patent Information
- Application Number
- CN202510985582.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-08-15
- Estimated Expiration
- 2045-07-17
AI Technical Summary
The prior art is difficult to efficiently screen out effective antiviral artificial microRNA target sequences, especially for tomato-spotted viruses, which leads to time-consuming and labor-intensive transgenicity.
AmiRNAs target sequence targeting the viral RNA silencing repressor VSR gene was designed, constructed onto the amiRNAs expression vector, and transiently co-expressed with the GFP gene and VSR gene expression vector in 16c Ben's smoke. AmiRNAs with antiviral function were screened out by observing the GFP expression intensity.
Visual screening of antiviral artificial microRNA target sequences is realized, and effective amiRNAs are screened out easily and efficiently, significantly inhibiting viral invasion and improving tomato resistance to plaque-waste viruses.
Smart Images

Figure CN120485275A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and in particular to an antiviral artificial microRNA target sequence and a screening method and application thereof. Background Art
[0002] RNAi-mediated antiviral immunity (abbreviated as antiviral RNAi) is a broad-spectrum, innate antiviral immune system ubiquitous in eukaryotes. Plants lack the adaptive immune systems, such as interferons and antibodies, that play a major role in animal antiviral defense. Therefore, antiviral RNAi has become a major defense mechanism for plants against viruses. When a virus infects a plant, DCLs recognize and cleave double-stranded viral replication intermediates, producing primary viral siRNAs (vsiRNAs) of 21-24 nt. These vsiRNAs form an RNA-induced silencing complex (RISC) with AGOs, mediating the degradation of complementary viral RNA or inhibiting viral translation. Furthermore, endogenous plant RDR1 and RDR6 can use defective viruses as templates to synthesize complementary viral strands, regenerating dsRNAs. These secondary vsiRNAs are recognized and cleaved by DCLs, generating secondary vsiRNAs. These secondary vsiRNAs are then bound by AGOs to form the RISC, further enhancing the antiviral effects mediated by siRNAs. At the same time, viruses have evolved viral RNA silencing suppressors (VSRs) during their long-term interactions with their hosts to counteract RNAi-mediated antiviral immunity. It has been discovered that almost all pathogenic viruses encode VSRs, and some viruses contain multiple VSRs simultaneously. These VSRs suppress host antiviral RNAi immunity through different mechanisms, thereby successfully infecting host plants.
[0003] RNAi technology has been widely used to combat plant viruses. Early RNAi approaches, such as virus-induced gene silencing and hairpin-based silencing, triggered RNAi-mediated antiviral immunity by expressing double-stranded RNA or hairpin RNA precursors containing target viral sequences in plants. Despite their widespread use, these approaches lacked high specificity, as the large population of small RNAs produced from these precursors could easily inadvertently target complementary cellular transcripts. The emergence of artificial microRNAs (amiRNAs) addressed this issue. amiRNA technology utilizes an endogenous plant pre-miRNA as a backbone, replacing the miRNA / miRNA* sequence within its stem-loop structure with an artificially designed amiRNA / amiRNA* target sequence. While retaining the original stem-loop secondary structure, pre-amiRNAs are generated within the plant through the endogenous miRNA synthesis machinery, silencing the target gene and inhibiting its expression. This technology can effectively avoid off-target effects and the production of recombinant viruses, and has the characteristics of high resistance level, strong stability and high safety. Therefore, this technology has been widely used in plant antiviral immunity.
[0004] Tomato spotted wilt virus (TSWV) is a plant virus with a wide host range and severe damage. It belongs to the genus Tomato spotted wilt virus in the family Bunyaviridae. Screening amiRNAs target sequences that can alleviate TSWV infection also has significant significance and application value.
[0005] Current research has found that the antiviral effects mediated by amiRNAs target sequences designed for different viral genes and different gene segments vary. The antiviral effects mediated by amiRNAs target sequences require the amiRNAs expression vector to be transferred into plants to determine their effects. Genetic modification is time-consuming and labor-intensive, so there is an urgent need to establish a simple and efficient system to determine whether the target sequences of amiRNAs are effective. Summary of the Invention
[0006] The purpose of the present invention is to provide an artificial microRNA target sequence with antiviral effect and a screening method thereof.
[0007] In order to achieve the above-mentioned object, the present invention provides a method for efficiently screening antiviral amiRNAs target sequences, comprising: designing amiRNAs target sequences targeting viral RNA silencing suppressor VSR genes, constructing the obtained amiRNAs target sequences into amiRNAs expression vectors, and GFPThe gene and VSR gene expression vector were transiently co-expressed in 16c Nicotiana benthamiana, and amiRNAs with antiviral function were screened based on the GFP expression intensity.
[0008] The present invention also provides a method for efficiently screening target sequences of amiRNAs against tomato spotted wilt virus, specifically for designing a silencing suppressor against tomato spotted wilt virus TSWV. NSs The 21 nt nucleotide sequence of the gene was used as the amiRNAs target sequence, and the obtained amiRNAs target sequence was constructed into the amiRNAs expression vector. GFP Genes and NSs The gene expression vector was transiently co-expressed in 16c Nicotiana benthamiana, and amiRNAs with anti-tomato spotted wilt virus function were screened based on the GFP expression intensity; NSs The gene, whose nucleotide sequence is shown in SEQ ID NO.1.
[0009] Preferably, in the above screening method, the amiRNAs expression vector is selected from p1300.
[0010] Preferably, in the above-mentioned method for screening amiRNAs target sequences against tomato spotted wilt virus, the nucleotide sequence of the amiRNAs target sequence is any one of SEQ ID NOs. 2-5.
[0011] Preferably, in the above-mentioned method for screening target sequences of amiRNAs against tomato spotted wilt virus, NSs The gene expression vector was selected from pCAMBIA3301-2×Flag vector.
[0012] Preferably, in the above-mentioned method for screening target sequences of amiRNAs against tomato spotted wilt virus, GFP The gene expression vector was selected from pGD-GFP.
[0013] According to the above screening method, the present invention also provides an artificial microRNA target sequence for resistance to tomato spotted wilt virus. The nucleotide sequence of the artificial microRNA target sequence is shown in SEQ ID NO.4 or SEQ ID NO.15.
[0014] The artificial microRNA target sequence provided by the present invention can be applied in the field of tomato cultivation, and can be particularly used to create a transgenic strain resistant to tomato spotted wilt virus.
[0015] The present invention has the following advantages: This invention enables visualization of antiviral artificial microRNA target sequence screening, providing a key technology for large-scale, intuitive, and efficient screening of antiviral artificial microRNA target sequences. In the future, this technology is expected to be expanded to screen antiviral artificial microRNA target sequences for various plant viruses.
[0016] The present invention screened an artificial microRNA target sequence with anti-TSWV, and transformed it into a gene that can express the TSWV-targeting gene through Agrobacterium transformation. NSs The positive and negative strands of the artificial microRNA vectors were introduced into tomatoes to obtain stable expression of amiR-675. (+) and amiR-675 (-) The transgenic plants can significantly inhibit the disease caused by TSWV. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 It is a screening system for antiviral artificial microRNA target sequences; A is a schematic diagram of the construction of the p1300-pre-amiRNAs vector, HygR (Hygromycin) is the hygromycin resistance gene, 35Sp is the cauliflower mosaic virus 35S promoter, and Nost is the Nos termination site; B is a screening system for efficient silencing NSs The results of amiRNAs of the gene; C is the Northern blotting detection of the transient expression of amiRNAs in 16c Nicotiana benthamiana, the amiRNAs are 21 nt in size, and U6 is a small RNA hybridized with the tomato U6 probe as a loading control; D is the Western blotting detection of the transient expression of NSs protein in 16c Nicotiana benthamiana, the fusion protein is about 65 kDa in size, and Ponceau is the Rubisco large subunit stained with Ponceau red as a loading control.
[0018] Figure 2 amiR-675 (-) and amiR-675 (+) Phenotype and expression analysis of transgenic tomatoes; A represents miR159a, amiR-675 (-) and amiR-675 (+) Growth and development of tomato leaves, flowers, fruits and plants after overexpression; B is Northern blotting detection of transgenic amiR-675 (-) and amiR-675 (+) amiR-675 in T3 plants (-) and amiR-675 (+) Expression of small RNAs. U6 is a small RNA hybridized with tomato U6 probe as a loading control.
[0019] Figure 3 amiR-675 (-) and amiR-675 (+) The accumulation of TSWV in susceptible tomatoes after high expression; Figure 3 A shows the symptoms of MT tomatoes of different genotypes 21 days after TSWV inoculation, where MOCK is the healthy control of MT tomatoes treated with phosphate buffer; B shows the symptoms of MT tomatoes treated with amiR-675 treated with TSWV inoculation. (-) and amiR-675 (+) Infection efficiency of highly expressed MT tomato. Error bars represent the standard deviation of three biological replicates. Asterisks indicate statistically significant differences (**<0.01). C and D are Northern blotting analyses of amiR-675. (-) and amiR-675 (+) Figure 3. TSWV viral accumulation in MT plants after high expression. MOCK represents protein extracted from leaves infiltrated with buffer only. 25S rRNA is stained with methylene blue as a loading control. U6 is a small RNA hybridized with a tomato U6 probe as a loading control. The viral large RNA and small RNA (vsiRNAs) content values are the grayscale ratios to 25S rRNA and U6, respectively. C and D are the results of two repeated biological experiments. DETAILED DESCRIPTION
[0020] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0021] Note: Unless otherwise noted, the experimental methods in the following examples are conventional methods, performed according to the techniques and conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples, unless otherwise noted, are commercially available. Example 1
[0022] This embodiment provides a method for efficiently screening artificial microRNA target sequences for resistance to tomato spotted wilt virus. The principle is that antiviral RNAi immunity is one of the main ways for plants to resist viruses. In order to fight RNAi, viruses evolve VSRs. These VSRs inhibit the host's antiviral RNAi immunity through different mechanisms of action, thereby successfully infecting the host plant. Therefore, the present invention selects the VSR gene encoded by TSWV, namely NSs Genes are targeted by artificial microRNAs to silence NSs , blocking NSs The inhibition of antiviral RNAi allows the antiviral RNAi immune pathway to function normally and eliminate the TSWV virus that invades the plant body. The details are as follows: (1) Silencing suppressor encoded by tomato spotted wilt tospovirus (TSWV) NSs The positive strand of the gene is used to design amiRNAs targets. NSs The gene sequence is shown in SEQ ID NO.1. Based on the RNAi principle, NSs Starting from 251, 391, 675, and 1331 of the gene positive chain sequence, a total of 21 nt sequences were selected as targets and named amiR-251. (+) 、amiR-391 (+) 、amiR-675 (+) and amiR-1331 (+) , the specific sequences are shown in SEQ ID NO.2-5 respectively;
[0023] NSs Gene sequence (SEQ ID NO.1):
[0024] amiR-251 (+) (SEQ ID NO.2): ATATTGATTTTAGCATCAATA amiR-391 (+) (SEQ ID NO.3): ATGAACAGATCTGATATTACA amiR-675 (+) (SEQ ID NO.4): AGAAAACAACATCATGCCTAA amiR-1331 (+) (SEQ ID NO.5): TAAAGCTTGATTTAAGCGGGA
[0025] (2) Primers were designed for PCR amplification, using the pre-miR159a sequence as a template (its nucleotide sequence is shown in SEQ ID NO.6), wherein pre-amiR-251 was amplified by primers pre-amiR-251-F and pre-amiR-251-R. (+) , pre-amiR-391-F and pre-amiR-391-R amplify pre-amiR-391 (+) , pre-amiR-675-F and pre-amiR-675-R amplify pre-amiR-675 (+) , pre-amiR-1331-F and pre-amiR-1331-R amplify pre-amiR-1331 (+) The primer sequences are as SEQ ID NO.7-14 respectively; the amplified products of each primer set were constructed into the expression vector p1300-pre-miR159a by enzyme digestion and enzyme ligation to obtain p1300-pre-amiR-251 (+) 、p1300-pre-amiR-391 (+) 、p1300-pre-amiR-675 (+) and p1300-pre-amiR-1331 (+) The expression vectors of the four amiRNAs were constructed by first constructing the pre-miR159a sequence into the p1300 vector to obtain p1300-pre-miR159a. Then, using this plasmid as a template, the 21nt sequence of miR159a was replaced with the four amiRNAs sequences designed above through the designed primers. The schematic diagram of the construction of the recombinant plasmid is shown in the figure. Figure 1 As shown in A; pre-miR159a (SEQ ID NO. 6) tgacgatggaagtagagctccttaaagttcaacatgagttgagcagggtaaagaaagctgctaagctatggatcccataagccctaatccttgtaaagtaaaaaggatttggttatatggattgcatatctc pre-amiR-251-F(SEQ ID NO.7): tcccCCCGGGtgacgatggaagATATTGATTTTAGCATCAATAcatgagttgagcagggta; pre-amiR-251-R(SEQ ID NO.8): tgcGAGCTCatgATATTGATTTTAGCATCAATAgaagagtaaaagcca; pre-amiR-391-F(SEQ ID NO.9): tcccCCCGGGtgacgatggaagATGAACAGATCTGATATTACAcatgagttgagcagggta; pre-amiR-391-R(SEQ ID NO.10): tgcGAGCTCatgATGAACAGATCTGATATTACAgaagagtaaaagcca; pre-amiR-675-F(SEQ ID NO.11): tcccCCCGGGtgacgatggaagAGAAAACAACATCATGCCTAAcatgagttgagcagggta; pre-amiR-675-R(SEQ ID NO.12): tgcGAGCTCatgAGAAAACAACATCATGCCTAAgaagagtaaaagcca; pre-amiR-1331-F(SEQ ID NO.13): tcccCCCGGGtgacgatggaagTAAAGCTTGATTTAAGCGGGAcatgagttgagcagggta; pre-amiR-1331-R (SEQ ID NO.14): tgcGAGCTCatgTAAAGCTTGATTTAAGCGGGAgaagagtaaaagcca.
[0026] (3) The obtained p1300-pre-amiR-251 (+) 、p1300-pre-amiR-391 (+) 、p1300-pre-amiR-675 (+) and p1300-pre-amiR-1331 (+) The four recombinant plasmids were transformed into Agrobacterium GV3101 by heat shock method, and the bacterial solution was spread on the resistance culture medium to obtain p1300-pre-amiR-251 (+) 、p1300-pre-amiR-391 (+) 、p1300-pre-amiR-675 (+) and p1300-pre-amiR-1331 (+) Monoclonal Agrobacterium of recombinant plasmids;
[0027] (4) The correct monoclonal Agrobacterium obtained by screening was transferred into YEP liquid medium containing antibiotics and cultured overnight at 28°C and 220 rpm until the OD 600 The bacterial solution was centrifuged and the OD was adjusted to 0.6-1.0 using suspension buffer. 600 Adjust to 0.6 and inject into 16c Nicotiana benthamiana leaves; pGD-GFP (GFP) and p1300-pre-miR159a (miR159a) Agrobacterium were co-infiltrated into the upper left corner of the back of the 16c leaf. GFP and miR159a can express NSs The Agrobacterium containing the gene (2×Flag-NSs Agrobacterium) was co-infiltrated into the lower right corner of the back of the 16c leaf. The three Agrobacteriums of GFP, 2×Flag-NSs (NSs) and miR159a were mixed in equal amounts and co-infiltrated into the lower left corner of the back of the 16c leaf as a control. GFP and NSs were co-infiltrated with p1300-pre-amiR-251 (+) (amiR-251 (+) )、p1300-pre-amiR-391 (+) (amiR-391 (+) )、p1300-pre-amiR-675 (+) (amiR-675 (+) ) and p1300-pre-amiR-1331 (+) (amiR-1331 (+)) Agrobacterium was mixed in equal amounts and infiltrated into the upper right corner of the back of 16c leaves as the experimental group; Among them, silencing suppressors NSs The gene expression vector was selected from pCAMBIA3301-2×Flag vector, denoted as 2×Flag-NSs expression vector.
[0028] (5) After 7 days of Agrobacterium infiltration, observe and take pictures under UV light. Figure 1 As shown in B, it can be seen that there is no green fluorescence in the co-infiltration area of GFP and miR159a Agrobacterium in the upper left corner of the leaf, indicating that GFP is silenced in 16c Nicotiana benthamiana plants and miR159a does not affect GFP silencing; the co-infiltration area of GFP and NSs Agrobacterium in the lower right corner emits strong green fluorescence, indicating that the silencing of GFP in 16c Nicotiana benthamiana plants is inhibited by the suppressor NSs; the co-infiltration area of GFP, NSs and miR159a Agrobacterium in the lower left corner still emits strong green fluorescence, indicating that miR159a Agrobacterium does not affect NSs VSR function of genes; GFP+NSs+amiR-251 is infiltrated in the upper right corner (+) 、GFP+NSs+amiR-391 (+) and GFP+NSs+amiR-1331 (+) The area in the lower left corner, which was infiltrated with GFP+NSs+miR159a, and the area in the lower right corner, which was infiltrated with GFP+NSs, still emitted strong green fluorescence, indicating that amiR-251 (+) 、amiR-391 (+) and amiR-1331 (+) Ineffective silence NSs gene; however, GFP+NSs+amiR-675 (+) The green fluorescence of the infiltrated area faded, which was basically the same as the negative control area in the upper left corner, indicating that amiR-675 (+) Efficient silence NSs gene, inhibiting its VSR function, thereby restoring the immune response of 16c Nicotiana benthamiana to GFP gene silencing, amiR-675 (+) It can be used as an effective target sequence for amiRNAs against TSWV. Figure 1 In B, GFP+miR159a in the upper left corner of the leaf represents the control injected with pGD-GFP and co-infiltrated with p1300-pre-miR159a, GFP+NSs+miR159a in the lower left corner represents the control injected with pGD-GFP, 2×Flag-NSs, and p1300-pre-miR159a, and GFP+NSs+amiR-X in the upper right corner represents the control injected with pGD-GFP, 2×Flag-NSs, and p1300-pre-miR-251(+) / 391 (+) / 675 (+) / 1331 (+) In the experimental group of any one of the four co-infiltrations, the GFP+NSs in the lower right corner represents the control group of co-infiltration of pGD-GFP and 2×Flag-NSs. (+) Indicates that the upper right corner is infiltrated with pGD-GFP, 2×Flag-NSs, and p1300-pre-miR-251 (+) , leaf amiR-391 (+) Indicates the injection of pGD-GFP, 2×Flag-NSs and p1300-pre-miR-391 in the upper right corner (+) , blade amiR-675 (+) Indicates that the upper right corner is infiltrated with pGD-GFP, 2×Flag-NSs, and p1300-pre-miR-675 (+) , leaf amiR-1331 (+) Indicates that the upper right corner is infiltrated with pGD-GFP, 2×Flag-NSs, and p1300-pre-miR-1331 (+) .
[0029] (6) Extract small RNA from leaves 7 days after Agrobacterium infiltration and perform Northern blotting analysis. Figure 1 As shown in C, except amiR-251 (+) In addition, amiR-391 (+) ,amiR-675 (+) ,amiR-1331 (+) A large number of 21 nt amiRNAs were detected in the leaves of the co-infiltration area, indicating that amiR-391 (+) 、amiR-675 (+) 、amiR-1331 (+) Both can be expressed in large quantities in plants, and amiR-251 (+) Can not be expressed in large quantities, so amiR-251 (+) It cannot be used as an artificial microRNA target sequence against TSWV. Figure 1 In C, MOCK represents small RNA extracted from leaves infiltrated with buffer only, GFP+miR159a represents small RNA extracted from leaves co-infiltrated with pGD-GFP and p1300-pre-miR159a, GFP+NSs+miR159a represents small RNA extracted from leaves co-infiltrated with pGD-GFP, 2×Flag-NSs, and p1300-pre-miR159a, GFP+NSs+amiR-251 (+)pGD-GFP, 2×Flag-NSs, and p1300-pre-amiR-251 (+) Small RNA extracted from co-infiltrated leaves, GFP+NSs+amiR-391 (+) pGD-GFP, 2×Flag-NSs, and p1300-pre-amiR-391 (+) Small RNA extracted from co-infiltrated leaves, GFP+NSs+amiR-675 (+) pGD-GFP, 2×Flag-NSs, and p1300-pre-amiR-675 (+) Small RNA extracted from co-infiltrated leaves, GFP+NSs+amiR-1331 (+) pGD-GFP, 2×Flag-NSs, and p1300-pre-amiR-1331 (+) Small RNA was extracted from co-infiltrated leaves.
[0030] (7) Protein was extracted from leaves 7 days after infiltration with Agrobacterium and further verified by Western blotting. Figure 1 As shown in D, GFP and NSs and their interactions with miR159a and amiR-251 (+) 、amiR-1331 (+) NSs protein was detected in all samples from the Agrobacterium co-infiltration area, and the expression levels showed no significant difference; amiR-391 (+) The expression level of NSs protein in the samples of Agrobacterium co-infiltration area was low; while amiR-675 (+) However, no NSs protein was detected in the samples from the Agrobacterium co-infiltration area, indicating that amiR-391 (+) It can also inhibit the expression of NSs protein to a certain extent, while amiR-675 (+) The expression of NSs protein was strongly inhibited and the VSR function was lost. The above Western blotting results explained the Figure 1 The result of B. Figure 1 D in the figure, MOCK represents the protein extracted from leaves infiltrated with buffer only, GFP+miR159a represents the protein extracted from leaves co-infiltrated with pGD-GFP and p1300-pre-miR159a, GFP+NSs+miR159a represents the protein extracted from leaves co-infiltrated with pGD-GFP, 2×Flag-NSs and p1300-pre-miR159a, GFP+NSs+amiR-251 (+) pGD-GFP, 2×Flag-NSs, and p1300-pre-amiR-251(+) Protein extracted from co-infiltrated leaves, GFP+NSs+amiR-391 (+) pGD-GFP, 2×Flag-NSs, and p1300-pre-amiR-391 (+) Protein extracted from co-infiltrated leaves, GFP+NSs+amiR-675 (+) pGD-GFP, 2×Flag-NSs, and p1300-pre-amiR-675 (+) Protein extracted from co-infiltrated leaves, GFP+NSs+amiR-1331 (+) pGD-GFP, 2×Flag-NSs, and p1300-pre-amiR-1331 (+) Proteins extracted from co-infiltrated leaves.
[0031] (8) Based on the results of transient expression, design a target NSs Target sequence of the negative strand of the gene: amiR-675 (-) The specific sequence is shown in SEQ ID NO.15; primers were designed for PCR amplification, and the primers were pre-amiR-675 (-) -F and pre-amiR-675 (-) -R, the sequence is shown in SEQ ID NO.16-17; and the amplified product was constructed into the expression vector p1300 by enzyme digestion and enzyme ligation to obtain p1300-pre-amiR-675 (-) expression vector; Target sequence amiR-675 (-) (SEQ ID NO.15): TTAGGCATGATGTTGTTTTCT; Primer pre-amiR-675 (-) -F (SEQ ID NO.16): tcccCCCGGGtgacgatggaagTTAGGCATGATGTTGTTTTCTcatgagttgagcagggta; Primer pre-amiR-675 (-) -R (SEQ ID NO.17): tgcGAGCTCatgTTAGGCATGATGTTGTTTTCTgaagagtaaaagcca.
[0032] (9) The obtained p1300-pre-amiR-675 (-)The recombinant plasmid was transformed into Agrobacterium GV3101 by heat shock method, and the bacterial solution was spread on the resistance culture medium to obtain the p1300-pre-amiR-675 (-) Monoclonal Agrobacterium of recombinant plasmids;
[0033] (10) will have p1300-pre-amiR-675 (-) and p1300-pre-amiR-675 (+) After the monoclonal Agrobacterium of the recombinant plasmid and the p1300-pre-miR159a empty vector was expanded, the OD 600 Adjust the concentration to 0.6, resuspend for 3 hours and then use it to infect the cotyledons and leaves of sterile cultured MT tomatoes. For details, refer to the article (Zhao L, Chen Y, Xiao X, et al. AGO2a but not AGO2b mediates antiviral defense against infection ofwild-type cucumber mosaic virus in tomato. Hortic Res. 2023;10(5):uhad043.Published 2023 Mar 13. doi:10.1093 / hr / uhad043). Callus tissue was obtained by co-culture, and then buds were induced to form seedlings through differentiation culture. Finally, 14 lines (respectively designated as MT-mi159-1, MT-mi159-2, MT-mi159-3, MT-mi159-4, MT-675) were obtained through rooting culture. (-) -1.MT-675 (-) -2, MT-675 (-) -3, MT-675 (-) -4, MT-675 (-) -5、MT-675 (+) -1.MT-675 (+) -2, MT-675 (+) -3, MT-675 (+) -4 and MT-675 (+) -5) The tissue culture seedlings were transferred to the greenhouse for further cultivation;
[0034] (11) After the tissue culture seedlings grew stably, the CTAB method was used to extract the DNA of the tissue culture seedlings. The p1300-9447-F and p1300-10183-R primer pairs (the nucleotide sequences of the primers are shown in SEQ ID NO. 18-19) were used to perform PCR amplification and identification of the extracted DNA. It was confirmed that p1300-pre-miR159a, p1300-pre-amiR-675 and p1300-pre-miR-159a were transferred into the tissue culture seedlings.(-) and p1300-pre-amiR-675 (+) The recombinant plasmid was used to observe the growth and development phenotypes of leaves, flowers, fruits, etc. It was found that the growth and development phenotypes of the T1 generation of these 14 lines were consistent with those of the wild type. The phenotypes of some strains were Figure 2 As shown in A; p1300-9447-F (SEQ ID NO.18):ACTATCCTTCGCAAGACCCTTCC p1300-10183-R (SEQ ID NO.19): TGTTGTGTGGAATTGTGAGCGG
[0035] (12) The tissue culture seedlings of the above 14 lines were further cultured and harvested individually. The segregation ratio of the T2 generation was statistically analyzed, and it was found that MT-mi159-2, MT-mi159-40, MT-mi159-53, MT-675 (-) -185、MT-675 (-) -188、MT-675 (-) -189、MT-675 (-) -243、MT-675 (+) -92、MT-675 (+) -137、MT-675 (+) -166 and MT-675 (+) -207, all of which met the 3:1 segregation ratio; six T3 plants of the amiR-675 transgenic line (respectively denoted as MT-675 (-) -185、MT-675 (-) -189、MT-675 (-) -243、MT-675 (+) -92、MT-675 (+) -166 and MT-675 (+) -207 See details Figure 2 Northern blotting was performed and a large amount of amiR-675 expression was detected. The results are shown in Figure 2 As shown in B, it shows that amiR-675 is in MT-675 (-) -185、MT-675 (-) -189、MT-675 (-) -243、MT-675 (+) -92、MT-675 (+) -166 and MT-675 (+)-207 transgenic tomatoes are expressed normally; the detection probe is probe-amiR-675 (-) and probe-amiR-675 (+) Mixed probes, the probe sequences are shown in SEQ ID NO.19-20 respectively; Probe probe-amiR-675 (-) (SEQ ID NO. 15): TTAGGCATGATGTTGTTTTCT Probe probe-amiR-675 (+) (SEQ ID NO. 4): AGAAAACAACATCATGCCTAA (13) These 11 lines were kept for seed, and individual lines were harvested for inoculation with TSWV. Symptoms were observed and the amount of virus accumulation was analyzed using Northern blotting. Figure 3 A in the figure shows that TSWV infects MT-WT, MT-mi159-53, and MT-675 (-) -243、MT-675 (+) -207 showed varying degrees of plant dwarfism, severe leaf shrinkage, obvious necrotic spots, chlorosis of leaves, necrosis from the stem tip downwards until the whole plant died. Figure 3 As shown in A, TSWV symptoms were more severe in MT-WT and MT-mi159-53 plants, but more severe in MT-675. (-) -243 and MT-675 (+) -207 plants caused mild symptoms. Figure 3 As shown in Figure B, three biological replicates were performed. The statistical data of the three replicates showed that the efficiency of TSWV infecting MT-WT was 56.7% (34 strains / 60 strains), MT-mi159-53 was 55.0% (33 strains / 60 strains), and MT-675 was 10. (-) -243 was 25.0% (15 / 60 plants), infecting MT-675 (+) -207 was 26.7% (16 / 60 plants), indicating that amiR-675 transgenic plants significantly inhibited the infection efficiency of TSWV. Figure 3 As shown in Figures C and D, it can be seen that the accumulation of TSWV large RNA in WT and mi159-53 plants was significantly higher than that in 675 (-) -243 and 675 (+)-207; similarly, the accumulation of TSWV-derived vsiRNAs in WT and mi159-53 plants was significantly higher than that in 675 (-) -243 and 675 (+) -207, where large RNA refers to the part of total RNA after removing small RNAs (vsiRNAs), including both plant mRNA and viral RNA; the above results indicate that amiR-675 can significantly improve the resistance of tomatoes to TSWV.
[0036] In summary, the present invention discloses a new method and new use for efficiently screening antiviral artificial microRNA target sequences. Specifically, a screening system using green fluorescent protein to indicate the antiviral efficiency of amiRNAs is constructed. This technical system is simple, efficient and intuitive, and provides a powerful tool for large-scale and efficient screening of antiviral amiRNAs. At the same time, the present invention also provides the application of antiviral amiRNAs in resisting tomato spotted wilt virus, an important tomato virus. The prepared transgenic strain has significant application value in the field of tomato cultivation. The two artificial microRNA target sequences provided by the present invention can be used to create tomato spotted wilt virus-resistant strains, which can effectively improve the resistance of tomatoes to spotted wilt virus, improve the yield and quality of tomatoes, and reduce the use of pesticides and reduce pesticide residues, which has significant application value and practical significance.
[0037] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A method for efficiently screening antiviral amiRNAs target sequences, characterized in that: The screening method comprises: designing an amiRNAs target sequence for the viral RNA silencing suppressor VSR gene, constructing the amiRNAs target sequence into an amiRNAs expression vector, and GFP The gene and VSR gene expression vector were transiently co-expressed in 16c Nicotiana benthamiana, and amiRNAs with antiviral function were screened based on the GFP expression intensity.
2. A method for efficiently screening target sequences of amiRNAs against tomato spotted wilt virus, characterized in that: The method comprises: designing a silencing suppressor for the tomato spotted wilt virus TSWV encoding NSs The 21 nt nucleotide sequence of the gene was used as the amiRNAs target sequence, the amiRNAs target sequence was constructed into the amiRNAs expression vector, and the amiRNAs expression vector was combined with GFP Gene expression vectors and NSs The gene expression vector was transiently co-expressed in 16c Nicotiana benthamiana, and amiRNAs with anti-tomato spotted wilt virus function were screened according to the GFP expression intensity; wherein, NSs The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
3. The screening method according to claim 2, characterized in that The amiRNAs expression vector is selected from p1300.
4. The screening method according to claim 2, wherein The nucleotide sequence of the amiRNAs target sequence is any one of SEQ ID NO. 2-5.
5. The screening method according to claim 2, characterized in that described NSs The gene expression vector was selected from pCAMBIA3301-2×Flag vector.
6. The screening method according to claim 2, wherein described GFP The gene expression vector was selected from pGD-GFP.
7. The artificial microRNA target sequence for resistance to tomato spotted wilt virus screened by the screening method according to any one of claims 2 to 6, characterized in that: The nucleotide sequence of the artificial microRNA target sequence is shown as SEQ ID NO.4 or SEQ ID NO.
15.
8. Use of the artificial microRNA target sequence according to claim 7 in the field of tomato cultivation.
9. The use according to claim 8, characterized in that Creation of transgenic lines resistant to tomato spotted wilt virus.
Citation Information
Patent Citations
Method for screening disease-resistant genes by aid of tomato spotted wilt virus NSm (new smoking materials) genes
CN107254477A
amiRNA capable of improving PSTVd resistance of potatoes and application thereof
CN110684766A
Application of amiRNA-nib2 vector in resisting wheat yellow mosaic disease
CN113355327A
Suppression of target gene expression through genome editing of native mirnas
CN113490741A
Construction method of transgenic plant capable of resisting soybean mosaic virus
CN113881670A