Construction method of RNP-mediated ICAM-1 gene knockout HEK293 cell strain

Abstract

The invention discloses a construction method of an RNP-mediated ICAM-1 gene knockout HEK293 cell strain, and belongs to the technical field of gene engineering. The method comprises the following steps: S1, cell transfection: culturing HEK293 cells to prepare transfection, adding a transfection compound into the HEK293 cells for transfection, and continuing to culture; s2, cell genome extraction: performing genome extraction on the transfected HEK293 cells; s3, PCR identification: designing a primer according to a gene sequence of ICAM-1, and carrying out PCR reaction on the genome extracted in S2 by using the primer; and S4, gene level verification: sequencing a PCR product, comparing a sequencing result with a wild type sequence, and determining to obtain a mutant cell strain. The transfection compound is composed of an RNP (Ribonucleic Acid) compound and a CRISPRMAX (Clustered Regularly Interspaced Short Palindromic Repeats) reagent system, and the RNP compound contains sgRNA (Ribonucleic Acid). The monoclonal clone11 is successfully obtained finally, which indicates that RNP can mediate ICAM-1 gene knockout of the HEK293 cell strain, the knockout method is enriched, the off-target risk is reduced, and the editing efficiency is improved.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line. Background Art

[0002] HEK293 cells (human embryonic kidney cell line) have become an indispensable tool in recombinant protein expression, viral vector production, and gene therapy research due to their excellent transfection efficiency, rapid growth characteristics, and ability to adapt to serum-free suspension culture. In recent years, HEK293 cells have demonstrated enormous application potential and value in cutting-edge biomedical fields such as CAR-T therapy, vaccine development, and antibody production. However, despite the many advantages of HEK293 cells, their gene editing process still faces a series of challenges. Low gene knockout efficiency leads to unsatisfactory editing results; long monoclonal screening cycles increase research time and costs; and high apoptosis sensitivity further exacerbates the difficulty and risk of gene editing. These problems severely restrict the application and development of HEK293 cells in the field of gene editing.

[0003] ICAM-1 (intercellular adhesion molecule-1) is a key immunomodulatory molecule that plays a crucial role in multiple physiological and pathological processes, including inflammatory responses, immune cell migration, and viral infections. Studies have shown that overexpression of ICAM-1 in certain disease models may exacerbate tumor metastasis or inflammatory responses, thereby adversely affecting the body's health. Therefore, constructing an ICAM-1 gene knockout HEK293 cell line is particularly important for in-depth research into the biological functions of ICAM-1 and exploring its mechanisms of action in disease development and progression. This gene knockout cell line not only provides a powerful tool for studying ICAM-1 function but also helps optimize existing cell culture systems. By reducing potential interference with ICAM-1, it may further increase the yield of recombinant proteins, contributing new impetus to the development of the biomedical field.

[0004] Currently, gene editing technology in HEK293 cells primarily relies on the CRISPR-Cas9 system, which provides a powerful tool for gene function research and cell model construction. However, traditional gene editing methods, especially plasmid transfection, have revealed some significant limitations in practical applications. During plasmid transfection, the random integration of plasmid DNA into the cell and the long-term expression of Cas9 protein can easily lead to off-target effects, where genes at non-target sites are incorrectly cut, potentially causing gene dysfunction. Furthermore, the transfection efficiency of plasmid transfection is often unstable and affected by various factors, such as cell state and transfection conditions, which increases the uncertainty and reproducibility of experiments.

[0005] In contrast, RNP (CRISPR-Cas9 ribonucleoprotein complex) delivery technology exhibits significant advantages. First, RNPs degrade rapidly within cells, greatly reducing the risk of non-specific cleavage due to prolonged Cas9 expression, thus effectively lowering the probability of off-target effects. Second, RNP delivery technology avoids random integration problems that may occur during plasmid transfection by directly delivering the Cas9 protein and sgRNA complex. This direct delivery method not only improves the precision of gene editing but also significantly enhances editing efficiency, making the gene editing process more efficient and reliable.

[0006] Although studies have reported on BAX gene knockout 293F cell lines (enhancing cell anti-apoptosis ability) or GS-deficient HEK293 cells (optimizing recombinant protein expression), there has been no systematic research on RNP-mediated knockout methods for the ICAM-1 gene. Summary of the Invention

[0007] The purpose of this invention is to provide an RNP-mediated ICAM-1 gene knockout HEK293 cell line and its construction method, in order to solve the problem that there is no systematic research on RNP-mediated knockout methods for the ICAM-1 gene in the background art.

[0008] The purpose of the present invention can be achieved through the following technical solutions:

[0009] This invention provides a method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line, comprising the following steps:

[0010] S1. Cell transfection: HEK293 cells are cultured in preparation for transfection. The transfection complex is added to the HEK293 cells for transfection, and the cells are cultured again.

[0011] S2. Cell genome extraction: Genome extraction was performed on transfected HEK293 cells;

[0012] S3, PCR identification: Primers were designed based on the ICAM-1 gene sequence, and PCR reaction was performed on the genome extracted in S2 using the primers;

[0013] S4. Gene-level verification: Sequencing the PCR products and comparing the sequencing results with the wild-type sequence to determine the mutant cell line;

[0014] The transfection complex consists of an RNP complex and a CRISPRMAX reagent system, with the RNP complex containing sgRNA.

[0015] Further, in step S1, the specific steps for culturing HEK293 cells are as follows: HEK293 cells are passaged into the wells of a 24-well plate one day before transfection, with 0.4 x 10 cells per well. 5 -1.2x10 5 On the day of transfection, the confluence of cells is 30-70%.

[0016] Further, in step S1, the transfection complex is prepared as follows:

[0017] A1. Target Design: Based on the ICAM-1 gene sequence found on NCBI, target design was performed on exon 2 using the CRISPR sgRNA design website: http: / / chopchop.cbt.tib.no / #. The designed ICAM-1 gene knockout target sites include gRNA1, gRNA2, and gRNA3; the sequences are shown as SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively.

[0018] The target site is the precise location in the CRISPR-Cas9 system where the Cas9 protein, guided by sgRNA, cuts DNA. Target selection is crucial in gene editing, directly determining its efficiency and specificity. Typically, the target site is located in the exon region of the target gene to achieve gene knockout, or in the gene's regulatory region to regulate gene expression. Notably, a specific PAM sequence, such as the common NGG sequence, is located immediately adjacent to the 3' end of the target sequence. The PAM sequence is a key element for Cas9 protein recognition and binding to DNA, ensuring that the Cas9 protein accurately locates and cuts the target DNA sequence. Therefore, the target site and its adjacent PAM sequence together constitute the core region of gene editing and are crucial for achieving precise gene editing.

[0019] A2. sgRNA synthesis: After designing the target site, sgRNA is synthesized. The sgRNA includes sgRNA1, sgRNA2, and sgRNA3, with sequences as shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively.

[0020] sgRNA (single guide RNA) is a key RNA molecule in the CRISPR / Cas9 system, playing a crucial role in precise navigation during gene editing. By pairing its bases complementaryly with the target DNA sequence, sgRNA specifically binds to the target DNA, precisely guiding the Cas9 nuclease to the designated DNA site. Once the Cas9 enzyme reaches the site, it cleaves the DNA double strand, creating a double-strand break. This break activates the cell's DNA repair mechanisms, leading to gene knockout or insertion mutations, thus achieving precise editing of the target gene. This guiding role of sgRNA is fundamental to the efficient and specific gene editing capabilities of the CRISPR / Cas9 system, and its design and optimization are essential for improving the success rate and accuracy of gene editing.

[0021] A3. Preparation of transfection complex: On the day of transfection, DMEM, Cas9 Ntclease, sgRNA, and Cas9 Pltssolution are mixed to obtain the RNP complex; CRISPRMAX reagent is added to DMEM medium and incubated at room temperature for 5 minutes to obtain the CRISPRMAX reagent system; the RNP complex is added to the CRISPRMAX reagent system to obtain the transfection complex.

[0022] The formation of the RNP complex is a crucial step in gene editing because it ensures stable binding between Cas9 and sgRNA, enabling efficient cleavage of the target DNA in subsequent steps. CRISPRMAX reagent is added to DMEM medium and incubated at room temperature for 5 minutes to fully dissolve and form a homogeneous transfection system. This step aims to activate the transfection reagent, preparing it to bind to the RNP complex. The RNP complex is then mixed with the CRISPRMAX reagent system to form the final transfection complex. The CRISPRMAX reagent encapsulates the RNP complex, forming stable nanoparticles that can be efficiently taken up by cells. Through efficient transfection, the RNP complex enters the cell and cleaves the target DNA, thus achieving precise gene editing.

[0023] Furthermore, in step A3, the ratio of DMEM, Cas9 Ntclease, sgRNA, and Cas9 Plts solution is 25 μL: 100-1000 ng: 50-500 ng: 1-2 μL.

[0024] Furthermore, in step A3, the volume ratio of CRISPRMAX reagent to DMEM culture medium is (0.5-5):25.

[0025] Furthermore, in step A3, the volume ratio of the RNP complex to the CRISPRMAX reagent system is 1:1.

[0026] Furthermore, in step S1, the specific steps for continuing the cultivation are as follows:

[0027] B1: Add the transfection complex to HEK293 cells in a 24-well plate, shake the culture dish, and then incubate the cells in an incubator for 48 hours;

[0028] B2: Observe the state of the cells obtained in step B1, digest the HEK293 cells, count them, take about 200 cells from each cell and seed them into 96-well plates, seeding a total of 3 96-well plates. Then place the 96-well plates in an incubator and culture them. Observe them under a microscope the next day, select the wells with single cells and label them.

[0029] B3: After the cells marked as monoclonal have grown well, prepare the plates to obtain the desired cells.

[0030] Furthermore, in step B1, the incubation conditions are: an incubator at 37°C containing 5% CO2.

[0031] Furthermore, in step B2, the incubation conditions are: an incubator at 37°C containing 5% CO2.

[0032] Further, in step S3, the primers are ICAM-1-FP and ICAM-1-RP, and the sequences of the primers are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

[0033] The beneficial effects of this invention are:

[0034] This invention provides an efficient and convenient method for successfully cultivating a single clone, clone11, and verifying the effectiveness of RNP in mediating ICAM-1 gene knockout in HEK293 cell lines. Currently, gene editing in HEK293 cells mainly relies on the CRISPR-Cas9 system. However, traditional gene editing methods, such as plasmid transfection and viral infection, suffer from significant problems such as off-target effects and unstable transfection efficiency. In contrast, RNP (CRISPR-Cas9 ribonucleoprotein complex) delivery technology exhibits clear advantages. First, RNP can be rapidly degraded within cells, thereby reducing the risk of non-specific cleavage caused by long-term Cas9 expression and effectively reducing off-target effects. Second, RNP delivery technology, by directly delivering Cas9 protein and sgRNA, avoids the random integration problem that may occur during plasmid transfection, significantly improving the efficiency and accuracy of gene editing. In summary, RNP delivery technology provides a more precise and efficient method for gene editing in HEK293 cells, and is expected to replace traditional gene editing technologies, becoming an important development direction in the future field of gene editing. Attached Figure Description

[0035] The present invention will be further described below with reference to the accompanying drawings.

[0036] Figure 1 This is a sequence alignment diagram of the sequencing results of the single clone clone11 obtained after gene knockout in this invention with the wild-type sequence. DETAILED DESCRIPTION

[0037] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0038] Example 1

[0039] 1. Target design and sgRNA synthesis

[0040] (1) Based on the ICAM-1 gene sequence (gene ID: 3383) found on NCBI, target sites were designed in exon 2 using the CRISPR sgRNA design website: http: / / chopchop.cbt.tib.no / #. The designed ICAM-1 gene knockout target sites are as follows:

[0041] gRNA1:TACACCTTCCGGTTGTTCCAGG (SEQ ID NO: 1);

[0042] gRNA2: TCAAAGTCATCCTGCCCCGGGG (SEQ ID NO: 2);

[0043] gRNA3: AGAGACCCCGTTGCCTAAAAAGG (SEQ ID NO: 3).

[0044] (2) After designing the target site, sgRNA was synthesized at General Biotech (Anhui) Co., Ltd. The synthesized sgRNA sequence is as follows:

[0045] sgRNA1: uacaccuuccgguuguucccguuuuagagcuagaaauagcaaguuuaaaauaagg cuaguccguuaucaacuugaaaaaguggcaccgagucggugc (SEQ ID NO: 4);

[0046] sgRNA2:ucaaaagucauccugccccgguuuuagagcuagaaauagcaaguuuaaaauaagg cuaguccguuaucaacuugaaaaaguggcaccgagucggugc (SEQ ID NO: 5);

[0047] sgRNA3:agagaccccguugccuaaaaguuuuagagcuagaaauagcaaguuuaaaauaagg cuaguccguuaucaacuugaaaaaguggcaccgagucggugc (SEQ ID NO: 6);

[0048] It should be noted that, in this invention, the character “u” appearing in the three sequences SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 corresponds to “t” in the corresponding sequence list.

[0049] 2. Construction of gene knockout cell lines

[0050] (1) Cell transfection:

[0051] ① HEK293 cell culture: One day before transfection, HEK293 cells were passaged into the wells of a 24-well plate, with 1 x 10 cells per well. 5 The cell confluence was 60% by the day of transfection.

[0052] ② On the day of transfection, first prepare the RNP complex. The preparation system is shown in Table 1:

[0053] reagent name Added amount DMEM 25 μL Cas9Ntclease 500ng sgRNA2 150ng Cas9Pltssolttion 1μL

[0054] Add 2 μL of CRISPRMAX reagent to 25 μL of DMEM medium and incubate at room temperature for 5 minutes to obtain the CRISPRMAX reagent system; add 25 μL of RNP complex to 25 μL of CRISPRMAX reagent system to obtain the transfection complex.

[0055] ③ Add 50 μL of the transfection complex to HEK293 cells in a 24-well plate, shake the culture dish, and then incubate the cells at 37°C with 5% CO2 for 48 h. After 48 h of culture, the cells were observed to be in good condition. The HEK293 cells were digested, counted, and about 200 cells were taken from each well and seeded into 96-well plates. Three 96-well plates were seeded and then incubated at 37°C with 5% CO2. The next day, the cells were observed under a microscope, and wells with single cells were selected and labeled.

[0056] (2) Cell genome extraction:

[0057] After the cells labeled as monoclonal have grown well, prepare the plate, take out a portion of the cells and process them into a cell suspension, centrifuge at 2000 rpm for 5 minutes, discard the supernatant, and use the Kangwei Century Universal Column Genome Extraction Kit to extract the cell genome according to the kit instructions.

[0058] (3) PCR identification:

[0059] PCR primers were designed based on the ICAM-1 genome sequence, as shown in Table 2. The PCR amplification system is shown in Table 3, and the PCR reaction procedure is shown in Table 4.

[0060] Table 2

[0061] Primer name Primer sequence Serial Number ICAM-1-FP gaacttatttcccttttctccg SEQ ID NO:7 ICAM-1-RP agcccctccttgacccta SEQ ID NO:8

[0062] Table 3

[0063] reagents Added amount PCRmastermix 25 μL ICAM-1-FP(10tM) 1μL ICAM-1-RP(10tM) 1μL <![CDATA[ddH2O]]> 21μL template 2μL Total volume 50μL

[0064] Table 4

[0065]

[0066]

[0067] The PCR products whose amplified fragment size met the expectations were recovered, purified, and sequenced.

[0068] (4) Gene-level verification: The PCR products were sequenced, and the sequencing results were compared with the wild-type sequence to finally identify a mutant, which was named monoclonal clone11. The comparison results are as follows: Figure 1 As shown, from Figure 1 As can be seen, the single clone clone11 knocked out ctgcc bases in exon 2, a total of 5 bases. The number of knocked-out bases is not a multiple of 3, which causes frameshift mutations in subsequent transcription and translation, thus achieving successful knockout. This demonstrates that the present invention provides an efficient and convenient method to successfully cultivate the single clone clone11, verifying the effectiveness of RNP in mediating ICAM-1 gene knockout in HEK293 cell lines, and solving the problem that there is a lack of systematic research on RNP-mediated knockout methods for the ICAM-1 gene. RNPs degrade rapidly in cells, reducing non-specific cleavage caused by long-term Cas9 expression and lowering the risk of off-target effects. Direct delivery of Cas9 protein and sgRNA avoids random integration during plasmid transfection, improving editing efficiency.

[0069] It should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprises," "comprising," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus.

[0070] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line, characterized in that: The steps include: S1. Cell transfection: Culture HEK293 cells for transfection, add transfection complex to HEK293 cells for transfection, and continue culturing; S2. Cell genome extraction: The genome of the transfected HEK293 cells was extracted; S3. PCR identification: Primers were designed based on the ICAM-1 gene sequence and used to perform PCR reaction on the genome extracted in S2; S4. Gene level verification: Sequence the PCR product and compare the sequencing results with the wild-type sequence to confirm the mutant cell line; The transfection complex consists of an RNP complex and a CRISPRMAX reagent system, and the RNP complex contains sgRNA.

2. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 1, characterized in that: In step S1, the specific steps for culturing HEK293 cells are as follows: one day before transfection, HEK293 cells were passaged into the wells of a 24-well plate, with the number of cells per well being 0.4×10 5 -1.2x10 5 The confluence of cells was 30-70% on the day of transfection.

3. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 1, characterized in that: In step S1, the transfection complex is prepared by: A1. Target design: Based on the ICAM-1 gene sequence found on NCBI, target design was performed on its exon 2 using the CRISPR sgRNA design website. The designed ICAM-1 gene knockout targets include gRNA1, gRNA2, and gRNA3; their sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively. A2. sgRNA synthesis: After the target is designed, sgRNA synthesis is performed. sgRNAs include sgRNA1, sgRNA2, and sgRNA3, and their sequences are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively; A3. Prepare the transfection complex: On the day of transfection, mix DMEM, Cas9 Ntclease, sgRNA, and Cas9Plts solution to obtain the RNP complex; add CRISPRMAX reagent to DMEM culture medium and incubate at room temperature for 5 minutes to obtain the CRISPRMAX reagent system; add the RNP complex to the CRISPRMAX reagent system to obtain the transfection complex.

4. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 3, characterized in that: In step A3, the usage ratio of DMEM, Cas9 Ntclease, sgRNA, and Cas9 Plts solution is 25 μL: 100-1000 ng: 50-500 ng: 1-2 μL.

5. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 3, characterized in that: In step A3, the volume ratio of CRISPRMAX reagent to DMEM medium is (0.5-5):

25.

6. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 3, characterized in that: In step A3, the volume ratio of RNP complex to CRISPRMAX reagent system is 1:

1.

7. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 1, characterized in that: In step S1, the specific steps of continuing the cultivation are: B1: Add the transfection complex to HEK293 cells in a 24-well plate, shake the culture dish, and then culture the cells in an incubator for 48 hours; B2: Observe the status of the cells obtained in step B1, digest and count the HEK293 cells, and plate approximately 200 cells onto 96-well plates. Plate a total of three 96-well plates. Then, place the 96-well plates in an incubator and observe under a microscope the next day. Select the wells containing single cells and mark them. B3: After the cells marked as monoclonal have grown well, prepare the plate to obtain the desired cells.

8. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 7, characterized in that: In step B1, the culture conditions of the incubator are: 37° C. in an incubator containing 5% CO 2 .

9. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 7, characterized in that: In step B2, the culture conditions of the incubator are: 37° C. in an incubator containing 5% CO 2 .

10. The method for constructing an RNP-mediated ICAM-1 gene knockout HEK293 cell line according to claim 1, characterized in that: In step S3, the primers are ICAM-1-FP and ICAM-1-RP, and the sequences of the primers are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

Images