A molecular marker related to hen egg haugh unit and application thereof

Abstract

The application relates to the technical field of gene detection, discloses a molecular marker related to chicken egg Haugh unit and application thereof, the molecular marker related to the application is located in sequence information of a chicken reference genome Gallus_gallus 7.0_W version published by an ENSEMBL database, is located on a No. 1 chromosome, and is located at a 1032742 site from a 5' end, the base of the site is A / G; in addition, the application further relates to a specific primer for detecting the above-mentioned single nucleotide polymorphism molecular marker. By using the molecular marker and the matching primer thereof, a high-efficiency and accurate molecular marker assisted breeding technology can be constructed, so that the breeding process of the chicken egg Haugh unit is improved. The technology has remarkable application value.

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and more specifically, to a molecular marker associated with egg Hardy units and its application. Background Technology

[0002] Chickens, as important agricultural animals, provide humans with high-quality chicken meat and eggs, rich in protein. Haugh units, a key indicator of egg freshness, significantly impact consumer purchasing decisions and the economic benefits of the egg industry. Therefore, this indicator has become a quality trait of laying hens that is of common concern to consumers, farmers, and breeding experts.

[0003] Currently, Haugh units in eggs are maintained through measures such as adjusting feed formulation and improving storage management; a higher Haugh unit indicates better preservation of egg freshness. Studies indicate significant variation in Haugh units within a population, revealing breeding potential for obtaining individuals with higher Haugh units through selective breeding strategies. Haugh unit assessment primarily relies on albumen height and egg weight, but this process requires repeated measurements on a large number of samples. The time-consuming and destructive nature of the measurement process limits secondary sales of eggs and increases costs. Traditional breeding methods are lengthy and result in slow genetic progress. In contrast, trait selection using genetic variations such as SNP molecular markers allows for early and precise trait selection, thereby accelerating the breeding process of target traits at the genetic level. Therefore, the discovery and validation of molecular markers related to Haugh units in eggs, and the establishment of molecular breeding techniques, are crucial for improving the efficiency of this trait's selection. Summary of the Invention

[0004] In view of this, the present invention proposes a molecular marker associated with the Haugh unit in eggs and its application, aiming to overcome the shortcomings of the prior art, to mine important SNP sites that are significantly associated with the Haugh unit trait in eggs from the whole genome, and to provide a basis for improving breeding results by applying molecular marker-assisted selection.

[0005] This invention proposes an application, wherein the application is A1, A2 or A3;

[0006] A1 refers to the application of substances for detecting SNP locus genotypes in the identification or auxiliary identification of Haugh units in eggs;

[0007] A2 refers to the application of substances for detecting SNP locus genotypes in the preparation of products for identifying or assisting in the identification of Haugh units in eggs.

[0008] A3 refers to the application of substances for detecting SNP locus genotypes in egg breeding or the preparation of egg breeding products.

[0009] The SNP is the sequence information of the chicken reference genome Gallus_gallus 7.0_W version, located at position 1032742 from the 5' end on chromosome 1, and its value is A / G.

[0010] The present invention also proposes a product containing the above-mentioned substance for detecting the genotype of SNP sites in the chicken reference genome, and wherein the substance is B1, B2 or B3;

[0011] B1 is a product for detecting the genotype of SNP loci associated with Haugh units in eggs;

[0012] B2 is a product used to identify or assist in the identification of Haugh units in eggs;

[0013] B3 is a product used for chicken breeding.

[0014] The present invention also proposes a method for identifying or assisting in the identification of Haugh units in eggs, wherein the method is C1 or C2;

[0015] The C1 includes detecting the genotype of the above-mentioned SNPs in the chicken to be tested, and identifying or assisting in the identification of Haugh units in eggs based on the genotype of the chicken to be tested.

[0016] When the genotypes of the SNP are GG, AG, and AA, the Haugh unit of the egg corresponding to the chicken being tested increases sequentially.

[0017] The present invention also proposes an application of the above method in chicken breeding.

[0018] Preferably, according to the above-described applications, products, or methods, the substance used to detect the polymorphism or genotype of the SNP is at least one of the following:

[0019] D1) Contains in vitro nucleic acid amplification primers that specifically amplify the SNP;

[0020] D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1);

[0021] D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);

[0022] D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the kit described in D3).

[0023] The present invention also proposes an in vitro nucleic acid amplification primer pair for identifying or assisting in the identification of egg Hardy units, wherein the nucleotide sequence of the upstream primer of the in vitro nucleic acid amplification primer pair is shown in SEQ ID NO: 2; and the nucleotide sequence of the downstream primer of the in vitro nucleic acid amplification primer pair is shown in SEQ ID NO: 3.

[0024] This invention also proposes an application of the above-mentioned primer pairs for identifying or assisting in the identification of egg Hardy units in in vitro nucleic acid amplification, wherein the application includes at least one of the following:

[0025] E1) Application in identifying or assisting in the identification of Haugh units in eggs;

[0026] Application of E2 in chicken breeding;

[0027] Application of E3 in the preparation of chicken breeding products.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0029] The single nucleotide polymorphism (SNP) molecular markers covered in this invention show a significant association with Haugh unit in eggs, representing an innovative molecular marker technology. By accurately detecting the genotype of a chicken at a specific locus, researchers and breeders can identify chickens carrying the dominant genotype. This technology allows for effective selection at an early stage in chicken breeding, thereby accelerating the breeding process for chickens with high Haugh unit eggs. This early selection method not only improves breeding efficiency but also has significant application value and potential economic benefits due to its ability to rapidly screen individuals with superior traits. Attached Figure Description

[0030] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Furthermore, the same reference numerals denote the same parts throughout the drawings. In the drawings:

[0031] Figure 1 This is a graph showing the results of the genome-wide association analysis in Example 1. Detailed Implementation

[0032] Exemplary embodiments of the present disclosure will now be described in more detail with reference to the accompanying drawings. While exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present disclosure and to fully convey the scope of the disclosure to those skilled in the art. It should be noted that, unless otherwise specified, embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0033] Example 1: Determination of SNP molecular markers related to the size of the Harper's unit in an egg

[0034] (1) Experimental animals: 197 white Leghorn chickens were used as experimental subjects in this study. During the feeding period, they were allowed free access to feed and water, and the feeding conditions strictly followed the relevant provisions of the industry standard (NY / T 33-2004).

[0035] (2) Phenotypic determination: The Haugh unit of eggs was determined three times for each chicken at 32 weeks of age.

[0036] (3) Genomic DNA extraction: 0.5 mL of blood was collected from the subwing vein of all experimental chickens using anticoagulated vacuum blood collection tubes. Whole-genome DNA was extracted using the phenol-chloroform extraction method. Qualified DNA samples were subjected to agarose gel electrophoresis to further evaluate the purity and integrity of the DNA samples. The sample concentration should be greater than 50 ng / μL, with a purity OD260 / 280 between 1.8 and 2.0, and good integrity. Qualified DNA samples were stored at -20 degrees Celsius for later use.

[0037] (4) Genome resequencing: DNA samples from all experimental chickens were sent to BGI Genomics. Individual whole-genome resequencing was performed using the DNBSEQ sequencing platform according to standard operating procedures, with a sequencing depth of approximately 15×. Sequence alignment and genotype extraction were performed using BWA and GATK software. After SNP call rate and MAF quality control, 7,498,204 SNPs were obtained and used for subsequent analysis.

[0038] (5) Genome-wide association analysis: Pedigree data, phenotypic data, and genomic SNP locus data were compiled, and genome-wide association analysis was performed using GCTA software. The univariate mixed linear model was:

[0039] y = Xb + jα + u + e;

[0040] Where y represents the phenotypic value; b represents the fixed effect (including population effect and cage position effect); X represents the corresponding relationship matrix; J represents the additive genotype of the SNP locus to be detected; α represents the additive SNP effect; u represents the random animal effect, which follows the law of animal behavior. Where G represents the additive relation matrix of genomes, The variance represents additive inheritance; e indicates obedience. The residual effect, where I represents the identity matrix, This represents the residual variance. The genome-wide FDR value was calculated using the R package qvalue, with FDR < 0.01 used as the significance threshold (P = 7.36E-07). The GWAS analysis results are as follows: Figure 1As shown, the egg Haugh unit is significantly associated with a 0.05 Mb region (chr1:1022532-1068485) on chromosome 1. Further verification of all sites in the associated genome region led to the identification of the chr1:1032742 site as a candidate site.

[0041] Table 1

[0042] SNP chromosome physical location Base substitution Minimum allele frequency p-value chr1:1032742 1 1032742 A / G 0.43 2.09E-07

[0043] Example 2: Correlation between different genotypes at the chr1:1032742 locus and Haugh unit in eggs

[0044] (1) Experimental animals: 197 white Leghorn chickens were fed in the same way as in Example 1.

[0045] (2) Phenotypic determination: Same as in Example 1.

[0046] (3) Extraction of genomic DNA: Same as in Example 1.

[0047] (4) Genotyping of specific gene loci: Same as in Example 1.

[0048] (5) Identification of dominant genotypes: At the chr1:1032742 locus, the Haugh unit count of eggs produced by experimental animals with the GG genotype was 66.21, that of eggs produced by experimental animals with the AG genotype was 70.64, and that of eggs produced by experimental animals with the AA genotype was 73.21. Based on this analysis, the AA genotype is the dominant genotype for this trait. Table 2 shows the correlation between different genotypes and Haugh unit counts in eggs at the chicken chr1:1032742 SNP locus.

[0049] Table 2

[0050]

[0051] ab: Different letters on the shoulder indicate significant differences between groups (P<0.05).

[0052] Example 3: Establishment of a molecular marker detection method for the chr1:1032742 locus and its application in breeding.

[0053] Establishment of molecular marker detection method: Based on the upstream and downstream DNA sequence information of the chr1:1032742 site published in the Ensemble database (SEQ ID NO:1), specific primers were designed and synthesized for PCR amplification. SEQ ID NO:1:

[0054] AACCGTAATACTTACAGATCCATGGAAGTGAACCAAGCAGCCTTTGTAGCACTTACAGCACGGGGAGAGCGGGTGGCTTTAAAGCAGATGAGAAGCAAAGGAGACCCGGAGAACTGCAACCGCAGAGCCGTG CAGCTCGCAGCAGCAGCTCTGCTCGAGGTCAGCGTGAGAGCATCTGGAGCTCAGAGAGCTCTGCTCAGCTGAGCACAGCTCTATAAATAGGGCGGGCACCCCGCCAGCGCGCTGCACG / ACTCAGCCCCAC CACTTCTCTGCTGATTCCTCGGCAAGGTCGCCTGGGCGGCCTCAGAGAGAGGCAGCAAACCAACCATTAAAAACTATGCCAATTAGCTTCGCTGAGAGAAGAGAGGATGATGCAGGAGCGAACTTATCCCACACGCGGTGGTGCTGAGGTTGGAGCTGGAGGAGGGCTGGAGCACGAAGGGCTGGAGCACGAAGGGATGCCTCACAGCTGCACTGCAGGAGCTGACACACTCTTC.

[0055] Primer sequence information is detailed in Table 3, polymerase chain reaction (PCR) amplification system in Table 4, and PCR amplification conditions in Table 5. The amplification products were analyzed using next-generation sequencing technology to determine the genotype located at locus 1032742 on chromosome 1 (chr1). The genotype results covered three types: GG, AG, and AA.

[0056] Table 3

[0057] Primer name Sequence (5'-3') Sequence list corresponding number upstream primer CAAAGGAGACCCGGAGAACT SEQ ID NO:2 Downstream primer GTTGGTTTGCTGCCTCTCTC SEQ ID NO:3

[0058] Table 4

[0059] reagents Volume (μL) ddH2O 8.0 2×Taq Plus Master Mix 10.0 Upstream primer (10 μM) 0.5 Downstream primer (10 μM) 0.5 Genomic DNA 1.0 Total 20.0

[0060] Table 5

[0061]

[0062]

[0063] (2) Breeding strategy based on the chr1:1032742 molecular marker to improve the Haugh unit in eggs

[0064] This study selected 224 purebred Beijing Oil Chickens as breeding subjects to improve their Haugh units. Blood samples were collected from all individuals at 3 weeks of age, and genomic DNA was extracted according to step (3) of Example 1. The target locus sequence was amplified using specific primers, and genotyping was performed using first-generation sequencing technology. Among the obtained genotypes, there were 171 individuals with the GG genotype, 46 individuals with the AG genotype, and 7 individuals with the AA genotype. Based on the dominant genotype of Haugh units, individuals with the AA genotype were selected for subsequent breeding. After being raised to the egg-laying period, Haugh units were measured at 32 weeks of age. Table 6 shows the correlation results between different genotypes of chickens at the chr1:1032742 SNP locus and Haugh units in eggs. The average Haugh units of individuals with the GG genotype was 66.49, that of individuals with the AG genotype was 67.49, and that of individuals with the AA genotype reached 73.26.

[0065] Table 6

[0066]

[0067] ab: Different letters on the shoulder indicate significant differences between groups (P<0.05).

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the specific implementation of the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. An application, characterized in that, The application is A1, A2, or A3; A1 refers to the application of substances for detecting SNP locus genotypes in the identification or auxiliary identification of Haugh units in eggs; A2 refers to the application of substances for detecting SNP locus genotypes in the preparation of products for identifying or assisting in the identification of Haugh units in eggs. A3 refers to the application of substances for detecting SNP locus genotypes in chicken breeding or the preparation of chicken breeding products. The SNP site is located at position 1032742 from the 5' end on chromosome 1 of the chicken reference genome Gallus_gallus7.0_W version, with a polymorphism of A or G; When the genotypes of the SNP loci are GG, AG, or AA, the Haugh unit of the egg increases sequentially; the trait of chicken breeding is the Haugh unit of the egg. The chickens are either White Leghorn or Beijing Oil Chicken.

2. The application according to claim 1, characterized in that, The substance used to detect the genotype of the SNP locus is any one of the following: D1) Contains in vitro nucleic acid amplification primers that specifically amplify the SNP sites; D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1); D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2); D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the kit described in D3).

3. A method for identifying or assisting in the identification of Haugh units in eggs, characterized in that, The method is C1 or C2; The C1 includes detecting the genotype of the SNP site described in claim 1 in the chicken to be tested, and identifying or assisting in the identification of Haugh units in eggs based on the genotype of the chicken to be tested. When the genotypes of the SNP loci are GG, AG, and AA, the Haugh unit of the eggs of the chickens being tested increases sequentially. The chicken species mentioned are White Leghorn or Beijing Oil Chicken.

4. The application of the method of claim 3 in chicken breeding; The chicken breeding specifically involves using SNP molecular marker technology to identify dominant genes, enabling effective selection in the early stages of chicken breeding, thereby accelerating the breeding process of chickens with high Harper's units. When the genotypes of the SNP loci are GG, AG, or AA, the Haugh unit in the egg increases sequentially. The chicken species mentioned are White Leghorn or Beijing Oil Chicken.

Images