Primer and probe for detecting carbapenemase drug-resistant gene by using RPA-lateral flow immunochromatography technology and application of primer and probe for detecting carbapenemase drug-resistant gene by using RPA-lateral flow immunochromatography technology

Through RPA-sided flow immunochromatography technology, specific primers and capture probes are designed to achieve multiple detection of carbapenemase resistance genes, solving the problems of early diagnosis and large-scale screening in the prior art, and providing a fast, accurate and low-cost detection solution.

CN120485404APending Publication Date: 2025-08-15ANHUI PUBLIC HEALTH CLINICAL CENT (ANHUI INFECTIOUS DISEASE HOSPITAL)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510818185.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-18
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The existing carbapenemase-resistant strain detection methods cannot achieve early diagnosis, and most rely on large-scale instruments and equipment, are expensive and not suitable for large-scale screening.

Method used

RPA-sided flow immunochromatography technology is used to design specific primers and capture probes. Through RPA amplification and sided flow immunochromatography bar detection, multiple detection of five carbapenemase resistance genes are achieved, combined with color recognition, and the risks of misdiagnosis and misdiagnosis are reduced, which is suitable for large-scale screening.

Benefits of technology

It realizes rapid and accurate detection of carbapenemase resistance genes, with high sensitivity, strong specificity, low cost, no large instruments required, and is suitable for multi-scene bedside detection, suitable for resource-constrained areas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485404A_ABST
    Figure CN120485404A_ABST
Patent Text Reader

Abstract

The invention provides a primer and a probe for detecting a carbapenemase drug-resistant gene by an RPA-lateral flow immunochromatography technology. The primers comprise a KPC primer pair, an NDM primer pair, a VIM primer pair, an IMP primer pair and an OXA primer pair, and the probes comprise a gold nanoparticle capture probe, a KPC capture probe, an NDM capture probe, a VIM capture probe, an IMP capture probe, an OXA capture probe and a quality control capture probe. The invention also provides an application of the primer and the probe in preparation of a carbapenemase drug resistance gene detection product. In addition, the invention also provides a corresponding detection kit and method. According to the invention, the multiple detection of the carbapenemase drug-resistant gene is realized through the RPA-lateral flow immunochromatography technology; besides, detection can be completed in a short time, rapid and accurate recognition and color development of amplification products are achieved, detection sensitivity and specificity are improved, dependence on large instruments is not needed, and cost is low.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of medical detection technology, and in particular to primers, probes and applications for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology. Background Art

[0002] Antibiotic resistance has become one of the most serious threats to global public health. Infections caused by carbapenem-resistant Enterobacteriaceae (CRE) are associated with particularly severe economic burdens and mortality rates, with mortality rates typically 2–3 times higher than those caused by carbapenem-susceptible Enterobacteriaceae. Furthermore, CRE isolates are resistant to most available antimicrobial agents, limiting the choice of antimicrobial agents in clinical practice. According to the 2017 World Health Organization's priority list of antibiotic-resistant bacteria, CRE, carbapenem-resistant Pseudomonas aeruginosa (CRPA), and carbapenem-resistant Amoebacterium baumannii (CRAB) were listed as the most pressing threats. This suggests that rapid detection of CRE is crucial for improving treatment outcomes, reducing mortality, controlling the spread of resistance, and ensuring precise medication use.

[0003] Currently, clinical detection of carbapenemase-producing strains primarily relies on phenotypic testing, such as the CarbaNP test, mCIM and eCIM tests, and enzyme inhibitor enhancement tests. However, phenotypic testing can only distinguish whether a strain is resistant to carbapenems, but cannot determine its specific genotype. Furthermore, such methods require post-culture testing and are incapable of early diagnosis. The recent development of molecular diagnostic technologies has provided new platforms for genotypic testing, such as QPCR, nested PCR, microfluidic chip technology, and next-generation sequencing. However, these methods can typically only identify one or several drug-resistant genotypes and rely on large-scale instruments and equipment, which are expensive and unsuitable for large-scale screening.

[0004] Therefore, a new method for detecting carbapenemase-resistant genes is urgently needed, which has important guiding significance for clinical diagnosis and medication. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a primer, probe and application for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology. Through unique primer design and RPA (recombinase polymerase amplification)-lateral flow immunochromatography technology, multiple detection of five major carbapenemase resistance genes (KPC, NDM, VIM, IMP, OXA) is achieved. Specifically, the primer design of the present invention is targeted at the highly conserved sequences of these resistance genes. By introducing nucleic acid modification and spacer structure (such as C12 spacer modification), the specificity and amplification efficiency of the primers are effectively improved, and the problem of primer self-polymerization to form dimers is avoided, thereby ensuring the accuracy and stability of the amplified product. In addition, the present invention combines the rapid amplification ability of RPA technology and the convenient detection characteristics of lateral flow immunochromatography strips, and can complete the detection in a short time. The specific capture probe on the lateral flow immunochromatography strip can realize rapid and accurate identification and color development of the amplified product, significantly improving the sensitivity and specificity of the detection, reducing the risk of misdiagnosis and missed diagnosis, and at the same time, without relying on large-scale instruments and equipment, the cost is low and suitable for large-scale screening.

[0006] The present invention adopts the following technical solutions to solve the above technical problems:

[0007] A primer set for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology includes five nucleic acid sequence marker-specific primer pairs: a KPC primer pair, an NDM primer pair, a VIM primer pair, an IMP primer pair, and an OXA primer pair; the five nucleic acid sequence marker-specific primer pairs each include a forward primer F and a reverse primer R, and the sequences are as follows:

[0008] KPC-F:AACAAACAAACAAACA / iSpC12 / CACTGTGCAGTCATTCAAGGGCTTTCT;

[0009] KPC-R:CTGATCGAGAATTAGC / iSpC12 / AATTGGCGGCGGCGTTATCACTGTATTG;

[0010] NDM-F:AACAAACAAACAAACA / iSpC12 / TCGCACCGAATGTCTGGCAGCACACTTCC TAT;

[0011] NDM-R:CATTCTGCTTCCAAGT / iSpC12 / GTTCGACAACGCATTGGCATAAGTCGCAAT CC;

[0012] VIM-F:AACAAACAAACAAACA / iSpC12 / GGGAGCCGAGTGGTGAGTATCCGACAGT; VIM-R:TAGATAGATAGATAGA / iSpC12 / TTTTCGCACCCCACGCTGTATCAATCAA;

[0013] IMP-F:AACAAACAAACAAACA / iSpC12 / AGGCAGTATTTCCTCTCATTTTCATAGTGAC AGC;

[0014] IMP-R:CTAATCCGCCTTAACA / iSpC12 / ATTTTCCTTTCAGGCAGCCAAACTACTAGGT TAT;

[0015] OXA-F: AACAAACAAACAAACA / iSpC12 / ATTATCGGAATGCCAGCGGTAGCAAAGGA; OXA-R: TCGACTGAGAATTGAC / iSpC12 / TCGAGGGCGATCAAGCTATTGGGAATTTT.

[0016] As one of the preferred embodiments of the present invention, the 5' end of each primer sequence of the five nucleic acid sequence-labeled specific primer pairs is labeled with a nucleic acid sequence, and a C12 backbone structure modification is designed between the labeled nucleic acid sequence and the adjacent unmodified sequence; the C12 is used to prevent the formation of primer dimers, resulting in the disappearance of the single-stranded structure at both ends of the amplified product, affecting the experimental results of the amplified product on the lateral flow immunochromatography strip.

[0017] As one of the preferred embodiments of the present invention, the KPC primer pair, NDM primer pair, VIM primer pair, IMP primer pair and OXA primer pair are used for detecting the carbapenemase resistance genes KPC, NDM, VIM, IMP and OXA, respectively.

[0018] An application of the above primers in the preparation of a carbapenemase resistance gene detection product.

[0019] A probe for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology includes a gold nanoparticle capture probe, a KPC capture probe, an NDM capture probe, a VIM capture probe, an IMP capture probe, an OXA capture probe, and a quality control capture probe, the sequences of which are as follows:

[0020] Gold nanoparticle capture probe: TGTTGTTTGTTTGTTTTTTTTTT-SH (the thiol-modified gold nanoparticle probe is used to complementarily bind to the 5'-end tag sequence of the amplification product);

[0021] KPC capture probe: GCTAATTCTCGATCAGTTTTTT-Biotin;

[0022] NDM capture probe: ACTTGGAAGCAGAATGTTTTTT-Biotin;

[0023] VIM capture probe: TCTATCTATCTATCTATTTTTT-Biotin;

[0024] IMP capture probe: TGTTAAGGCGGATTAGTTTTTT-Biotin;

[0025] OXA capture probe: GTCAATTCTCAGTCGATTTTTT-Biotin;

[0026] Quality control capture probe: AACAAACAAACAAACA-Biotin.

[0027] As one of the preferred embodiments of the present invention, the gold nanoparticle capture probe is a capture probe designed for the carbapenemase resistance genes KPC, NDM, VIM, IMP, and OXA, so that the amplified product has the ability to develop color; the KPC capture probe, NDM capture probe, VIM capture probe, IMP capture probe, and OXA capture probe are detection line probes designed for the resistance genes KPC, NDM, VIM, IMP, and OXA, respectively, so that the amplified product develops color on the corresponding detection line; the quality control capture probe enables the quality control line to develop color.

[0028] An application of the above probe in the preparation of a carbapenemase resistance gene detection product.

[0029] A kit for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology, comprising the following components:

[0030] (1) the above primers;

[0031] (2) the above-mentioned probes;

[0032] (3) Lateral flow immunochromatographic strips;

[0033] (4) RPA amplification buffer;

[0034] (5) Lateral flow immunochromatographic strip detection system.

[0035] As one of the preferred embodiments of the present invention, the lateral flow immunochromatography strip comprises a sample pad, a gold label pad, an NC membrane, a water absorbent pad and a bottom plate; wherein the sample pad is used to load the sample, the gold label pad is used to store the AuNP-RP conjugate, the NC membrane is used to fix the detection line and the quality control line, and the water absorbent pad is used to collect the aqueous phase and provide a driving force for the reaction solution to flow along the test strip; the bottom plate serves as a base lining for assembling the above four modules (sample pad, gold label pad, NC membrane, water absorbent pad).

[0036] A method for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology for non-diagnostic purposes, using the above-mentioned RPA-lateral flow immunochromatography technology to detect carbapenemase resistance genes, the method is as follows:

[0037] Using the sample DNA to be tested as a template, the primers and the RPA amplification buffer system are used to form an RPA amplification system to perform RPA amplification;

[0038] The probe is fixed to the lateral flow immunochromatographic strip for subsequent binding and color development with the RPA amplification product;

[0039] The amplified product is combined with a lateral flow immunochromatographic strip, and the drug-resistant genotype is determined by the detection result of the lateral flow immunochromatographic strip detection system.

[0040] As one of the preferred embodiments of the present invention, the sample to be tested is an environmental sample or a bacterial culture.

[0041] As one of the preferred embodiments of the present invention, the RPA amplification system is used to amplify carbapenemase resistance genes, and specifically comprises:

[0042] KPC, NDM, VIM triple reaction system: 0.7 μL of each primer of the KPC, NDM, and VIM primer pairs, 29.4 μL of buffer A, 2.5 μL of buffer B, 5 μL of DNA template, and 8.9 μL of ddH2O;

[0043] IMP and OXA duplex reaction system: 0.7 μL of each primer of the IMP and OXA primer pairs, 29.4 μL of Abuffer, 2.5 μL of Buffer, 5 μL of DNA template, and 10.3 μL of ddH2O.

[0044] As one of the preferred embodiments of the present invention, the lateral flow immunochromatography strip detection system is used for the color development of the combination of RPA amplification products and lateral flow immunochromatography strips, and is specifically composed of: 1 μL of RPA amplification product, 50 μL of loading buffer; the loading buffer includes 10 mmol / L Tris-HCl, 5 mmol / L KCl, 5 mmol / L MgCl2, 2×SSC, 2% PEG 20000, 1% BSA, 1% CTAB, 1% Tween-20, pH 8.0.

[0045] The advantages of the present invention over the prior art are:

[0046] (1) The present invention uses RPA-lateral flow immunochromatographic strip technology (RPA-LFS) to simultaneously perform rapid, multiplex detection and accurate typing of five carbapenemase resistance genes (KPC, NDM, VIM, IMP, OXA), with high sensitivity and specificity, and can detect KPC, NDM, VIM, IMP, OXA to 10 2 Copies / mL, which is basically consistent with the finished fluorescent quantitative PCR kits on the market. The low detection limit greatly meets clinical needs. At the same time, the entire detection process of the present invention only takes 30 to 40 minutes, which is better than the 1 hour required by the Genxpert Carba-R technology. Compared with the Genxpert Carba-R method, it does not require large and complex instruments, and can realize rapid bedside detection in multiple scenarios.

[0047] (2) The method of the present invention only costs about RMB 50 to test one sample, and does not require high instrument costs. This price is lower than the price of similar testing products on the market.

[0048] (3) The integrated technology of the present invention enables early detection of pathogens, which is crucial for clinical situations that require a rapid response. The technology is easy to operate and can be performed instantly by even minimally trained individuals, which increases its applicability in different medical settings. RPA-LFS technology does not require large amounts of reagents and materials and can be mass-produced. In addition, the technology does not require specialized instruments and training, which makes it economically feasible and can be quickly expanded to large-scale applications, even in remote areas with limited resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 This is the electropherogram for verifying the effectiveness of the primers in the validation example;

[0050] Figure 2 This is the technical principle diagram of the RPA-lateral flow immunochromatographic strip used in the verification example;

[0051] Figure 3This is a diagram showing the results of the lateral flow immunochromatography strips in the validation example (in the diagram, from left to right, the positive results of KPC, NDM, VIM, KPC NDM, NDM VIM, KPC VIM, KPC NDM VIM, IMP, OXA, and IMP OXA are shown);

[0052] Figure 4 This is the detection limit test result graph of KPC, NDM, VIM, IMP, and OXA in the verification example. DETAILED DESCRIPTION

[0053] The following examples of the present invention are described in detail. These examples are implemented based on the technical solutions of the present invention, and detailed implementation methods and specific operating procedures are given. However, the scope of protection of the present invention is not limited to the following examples. The reagents and experimental methods used in the following examples and verification examples are conventional reagents or methods in the art unless otherwise specified and will not be described in detail.

[0054] The primer and probe sequences involved in the following examples are shown in Table 1.

[0055]

[0056]

[0057] Example 1

[0058] In this embodiment, primers for detecting carbapenemase resistance genes using an RPA-lateral flow immunochromatography technique include five nucleic acid sequence marker-specific primer pairs: a KPC primer pair, an NDM primer pair, a VIM primer pair, an IMP primer pair, and an OXA primer pair.

[0059] The KPC primer pair, NDM primer pair, VIM primer pair, IMP primer pair and OXA primer pair are used for detecting the carbapenemase resistance genes KPC, NDM, VIM, IMP and OXA, respectively, and each includes a forward primer F and a reverse primer R, and the sequences are shown in Table 1.

[0060] Example 2

[0061] In this embodiment, an RPA-lateral flow immunochromatography technique is used to detect probes for carbapenemase resistance genes, including a gold nanoparticle capture probe (RP), a KPC capture probe (CP KPC), an NDM capture probe (CP NDM), a VIM capture probe (CPVIM), an IMP capture probe (CP IMP), an OXA capture probe (CP OXA), and a quality control capture probe (CCP). The sequences are shown in Table 1.

[0062] Among them, the gold nanoparticle capture probe is a capture probe designed for the carbapenemase resistance genes KPC, NDM, VIM, IMP, and OXA, which enables the amplified product to have the ability to display color; the KPC capture probe, NDM capture probe, VIM capture probe, IMP capture probe, and OXA capture probe are detection line probes designed for the resistance genes KPC, NDM, VIM, IMP, and OXA, respectively, which enable the amplified product to display color on the corresponding detection line; the quality control capture probe enables the quality control line to display color.

[0063] Example 3

[0064] The kit of this embodiment for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology includes the following components: primers (Example 1), probes (Example 2), lateral flow immunochromatography strips, RPA amplification buffer, and lateral flow immunochromatography strip detection system.

[0065] In this embodiment, the structure of the lateral flow immunochromatography strip includes a sample pad, a gold label pad, a NC membrane, a water absorbent pad and a bottom plate; wherein the sample pad is used to load the sample; the gold label pad is used to store the AuNP-RP conjugate; the NC membrane is used to fix the detection line T (probe CP KPC, CP NDM, CP VIM, CP IMP or CP OXA) and the quality control line C (probe CCP); the water absorbent pad is used to collect the aqueous phase and provide a driving force for the reaction solution to flow along the test strip; the bottom plate serves as a base for assembling the above four modules (sample pad, gold label pad, NC membrane, water absorbent pad).

[0066] The primers and the RPA amplification buffer system constitute an RPA amplification system for amplifying the corresponding carbapenemase resistance gene. The system consists of: primers, A buffer and B buffer (Amp Future Company, DNA Constant Temperature Rapid Amplification Kit (Basic Type), Product No. WLN8201KIT), DNA template, and ddH2O.

[0067] The probe is fixed on the lateral flow immunochromatography strip and subsequently hybridized with the amplified product.

[0068] The lateral flow immunochromatographic strip detection system is used for color development after hybridization of RPA amplification products with probes on the lateral flow immunochromatographic strip. The system consists of: RPA amplification products, loading buffer; wherein the loading buffer used includes 10mmol / L Tris-HCl, 5mmol / L KCl, 5mmol / L MgC l2 , 2× SSC, 2% PEG 20000, 1% BSA, 1% CTAB, 1% Tween-20, pH 8.0.

[0069] Example 4

[0070] This embodiment is a method for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology for non-diagnostic purposes, using the kit of Example 3 above, and the method is as follows:

[0071] S1. Nucleic acid extraction:

[0072] To extract DNA from cultured bacterial colonies, we used Lysis Buffer for Microorganism to Direct PCR (Takara Bio, Beijing, China). The procedure was as follows: 50 μL of Lysis Buffer for Microorganism to Direct PCR was pipetted into an EP tube. A single colony was picked with a sterile cotton swab and placed in the tube, where it was mixed thoroughly. Subsequently, the culture was heat denatured at 80°C for 15 minutes, centrifuged at low speed, and 4 μL of the lysed supernatant was used as the template for subsequent reactions.

[0073] S2. RPA primer and capture probe design:

[0074] Multiple pairs of published carbapenemase-resistant genotype sequences were downloaded from the NCBI official website, and multiple sequence alignments were performed using SnapGene software to obtain highly conserved sequences. Based on the conserved sequences, multiple pairs of RPA primers for five carbapenemase-resistant genotypes (KPC, NDM, VIM, IMP, OXA) were designed using Primer Premier 5 software (PremierBiosoft International, CA, USA). The designed primers were species-specifically verified using the NCBI-BLAST online tool. Nucleic acid modification and C12 spacer modification primer sequences (Example 1) for amplification of the optimal primer set, as well as capture probe sequences (Example 2), were designed and commissioned to be synthesized by Shanghai Biotech.

[0075] S3, RPA amplification

[0076] Using the DNA of the sample to be tested as a template, using primers and RPA amplification buffer system to form an RPA amplification system, RPA amplification is performed;

[0077] Reaction system 1 (KPC, NDM, VIM triple reaction system): 0.7 μL of each primer of the KPC, NDM, and VIM primer pairs, 29.4 μL of Abuffer (Anpu Future Company, DNA Constant Temperature Rapid Amplification Kit, Catalog No. WLN8201KIT), 2.5 μL of B buffer (Anpu Future Company, DNA Constant Temperature Rapid Amplification Kit, Catalog No. WLN8201KIT), 5 μL of DNA template, and 8.9 μL of ddH2O.

[0078] Reaction system 2 (IMP and OXA double reaction system): 0.7 μL of each primer of the IMP and OXA primer pairs, 29.4 μL of A buffer (Amp Future, DNA Constant Temperature Rapid Amplification Kit, Catalog No. WLN8201KIT), 2.5 μL of B buffer (Amp Future, DNA Constant Temperature Rapid Amplification Kit, Catalog No. WLN8201KIT), 5 μL of DNA template, and 10.3 μL of ddH2O.

[0079] To reduce aerosol contamination caused by opening the lid, 50 μL of liquid paraffin oil was added to the reaction liquid surface to achieve a sealing effect. After a brief centrifugation, the reaction solution was incubated at 39°C for 20 min for RPA amplification, and the obtained mRPA product was characterized by 3.5% agarose gel electrophoresis.

[0080] S4. Preparation of loading buffer:

[0081] 10 mmol / L Tris-HCl, 5 mmol / L KCl, 5 mmol / L MgCl2, 2×SSC, 2% PEG 20000, 1% BSA, 1% CTAB, 1% Tween-20, pH 8.0.

[0082] S5. Preparation of lateral flow immunochromatographic strips:

[0083] (1) Preparation of gold nanoparticles (AuNPs)

[0084] Take a 250mL conical flask, soak it in the prepared aqua regia, and then rinse it with ultrapure water.

[0085] Clean, dry and set aside;

[0086] Add 120 mL of chloroauric acid solution (0.01%, w / v) to the treated conical flask and heat to boil;

[0087] Under vigorous stirring, 1.5 mL of trisodium citrate solution (1%, w / v) was quickly added;

[0088] Continue heating and stirring until the solution color stabilizes, then continue heating for 15 minutes;

[0089] After cooling to room temperature, add ultrapure water to 100 mL and store at 4°C.

[0090] (2) Preparation of gold-probe conjugate (AuNP-RP)

[0091] Concentration of AuNPs: Add 1 mL of AuNPs solution to a 1.5 mL clean centrifuge tube, centrifuge at 8000 rpm for 15 min, remove the supernatant, and resuspend the precipitate in 100 μL of ultrapure water.

[0092] Probe activation: Add 50 μL of gold nanoparticle probe RP (thiol-modified recognition probe) (10 μmol / L), 5 μL of acetic acid buffer (0.5 mol / L, pH 5.2) and 10 μL of TCEP solution (1 mmol / L) into a clean glass bottle and incubate at room temperature in the dark for 1 h.

[0093] Probe coupling: Add 500 μL of concentrated AuNPs to the glass bottle of the above probe and react at room temperature for 6 h or overnight.

[0094] System stabilization: add 25 μL Tween-20 (1%, v / v) and incubate at room temperature for 10 min.

[0095] Salt aging: Add 2 mol / L NaCl three times with an interval of 1 hour each time to make the final concentration of NaCl in the system reach 0.3 mol / L, and continue the reaction at room temperature for 12 hours.

[0096] Washing and resuspension: Centrifuge at 8000 rpm for 15 min, remove the supernatant, and wash the pellet three times with Tris-HCl buffer (10 mmol / L, pH 7.4). Resuspend the pellet in 500 μL of resuspension buffer (1 mmol / L Tris-HCl, 5% BSA, 0.25% Tween-20, and 10% sucrose, pH 8.0).

[0097] (3) The size of the lateral flow immunochromatographic strip (LFS) is 3 mm × 60 mm and consists of five modules. The specific preparation method is as follows:

[0098] The sample pad was used to load the sample. To improve the water absorption and surface activity of the sample pad and avoid the influence of complex matrix on the test results, the sample pad was soaked in sample pad treatment solution (0.05 mol / L Tris-HCl, 0.15 mol / L NaCl, 0.25% Triton-100, pH 8.0) for 2 h after cutting and dried at 30°C for use.

[0099] The gold label pad was used to store the AuNP-RP conjugate. To improve its carrying capacity and ensure the dispersion of the AuNP-RP conjugate, the gold label pad was cut and soaked in a gold label pad treatment solution (10 mmol / L PB, 5% sucrose, 1% trehalose, 0.3% Tween-20, 0.25% PEG 20000, pH 7.4) for 2 hours and then dried at 30°C. 6 μL of AuNP-RP conjugate was then added dropwise to the dry gold label pad, dried at 30°C, and stored for later use.

[0100] The NC membrane was used to immobilize the test (T) line and the control (C) line. Three biotinylated capture probes were immobilized on the T line of test strip 1: specifically, the capture probe targeting KPC (CP KPC) on line T1, the capture probe targeting NDM (CP NDM) on line T2, and the capture probe targeting VIM (CP VIM) on line T3. Two biotinylated capture probes were immobilized on the T line of test strip 2: specifically, the capture probe targeting IMP (CPIMP) on line T1, and the capture probe targeting OXA (CP OXA) on line T2. The C line was immobilized with a biotinylated control probe (CCP). Prior to membrane coating, all biotinylated capture probes were pre-conjugated with streptavidin. Specifically, 2.5 μL of biotinylated capture probe (100 μmol / L), 2.5 μL of streptavidin (5 mg / mL), and 15 μL of 1× PBS were added to a PCR tube and incubated at room temperature for 1 hour. The spray rate of the film sprayer was set to 0.5 μL / cm. After the film spraying was completed, the NC film was dried in a 30°C oven and stored.

[0101] The absorbent pad is used to collect the aqueous phase and provide the driving force for the reaction solution to flow along the test strip.

[0102] The base plate serves as a base to assemble the above four modules. The four modules are connected in sequence on the base plate and overlap each other by about 2 mm.

[0103] S6. Hybridization and color development of the amplified product with the capture probe on the lateral flow immunochromatography strip:

[0104] Add 1 μL of RPA amplification product to 50 μL of loading buffer (10 mmol / L Tris-HCl, 5 mmol / L KCl, 5 mmol / L MgCl2, 2× SSC, 2% PEG 20,000, 1% BSA, 1% CTAB, 1% Tween-20, pH 8.0). Mix thoroughly and immerse the test strip in the sample. After 5–10 minutes, observe the color development and determine the result.

[0105] Verification Example

[0106] This verification example is used to verify the feasibility of the above method (Example 3), and combines clinical sample testing to achieve nucleic acid extraction, RPA amplification, lateral flow immunochromatographic strip detection, and color development, including the following specific steps:

[0107] S1. Nucleic acid extraction:

[0108] To extract DNA from cultured bacterial colonies, we used Lysis Buffer for Microorganism to Direct PCR (Takara Bio, Beijing, China). The procedure was as follows: 50 μL of Lysis Buffer for Microorganism to Direct PCR was pipetted into an EP tube. A single colony was picked with a sterile cotton swab and placed in the tube, where it was mixed thoroughly. Subsequently, the culture was heat denatured at 80°C for 15 minutes, centrifuged at low speed, and 4 μL of the lysed supernatant was used as the template for subsequent reactions.

[0109] S2. Design and validation of RPA primers and capture probes:

[0110] Multiple pairs of published carbapenemase-resistant genotype sequences were downloaded from the NCBI official website, and multiple sequence alignments were performed using SnapGene software to obtain highly conserved sequences. Based on the conserved sequences, multiple pairs of RPA primers for five carbapenemase-resistant genotypes (KPC, NDM, VIM, IMP, OXA) were designed using Primer Premier 5 software (PremierBiosoft International, CA, USA). The designed primers were species-specifically verified using the NCBI-BLAST online tool. Nucleic acid modification and C12 spacer modification primer sequences (Example 1) for amplification of the optimal primer set, as well as capture probe sequences (Example 2), were designed and commissioned to be synthesized by Shanghai Biotech.

[0111] In order to verify the feasibility of RPA primers, five carbapenemase-resistant bacterial strains were used to perform RPA amplification and electrophoresis verification on the designed primers. The results are as follows: Figure 1 As shown, it was shown that the primers of the present invention can effectively amplify the five carbapenemase resistance genes (KPC, NDM, VIM, IMP, OXA).

[0112] S3, RPA amplification:

[0113] RPA amplification was performed using the designed primers and the extracted nucleic acid.

[0114] The RPA amplification system (single sample) is:

[0115] KPC NDM VIM detection:

[0116] 0.7 μL of each primer of the KPC, NDM, and VIM primer pairs, 29.4 μL of A buffer (Amp Future, DNA Constant Temperature Rapid Amplification Kit, Catalog No. WLN8201KIT), 2.5 μL of B buffer (Amp Future, DNA Constant Temperature Rapid Amplification Kit, Catalog No. WLN8201KIT), 5 μL of DNA template, and 8.9 μL of ddH2O.

[0117] IMP OXA test:

[0118] 0.7 μL of each primer of the IMP and OXA primer pairs, 29.4 μL of A buffer (Anpu Future Company, DNA Constant Temperature Rapid Amplification Kit, Product No. WLN8201KIT), 2.5 μL of B buffer (Anpu Future Company, DNA Constant Temperature Rapid Amplification Kit, Product No. WLN8201KIT), 5 μL of DNA template, and 10.3 μL of ddH2O.

[0119] RPA amplification conditions were: 39°C, 20 min.

[0120] S4. Prepare loading buffer:

[0121] 10 mmol / L Tris-HCl, 5 mmol / L KCl, 5 mmol / L MgCl2, 2×SSC, 2% PEG 20000, 1% BSA, 1% CTAB, 1% Tween-20, pH 8.0.

[0122] S5. Preparation of lateral flow immunochromatographic strips:

[0123] (1) Preparation of gold nanoparticles (AuNPs)

[0124] Take a 250mL conical flask, soak it in the prepared aqua regia, and then rinse it with ultrapure water.

[0125] Clean, dry and set aside;

[0126] Add 120 mL of chloroauric acid solution (0.01%, w / v) to the treated conical flask and heat to boil;

[0127] Under vigorous stirring, 1.5 mL of trisodium citrate solution (1%, w / v) was quickly added;

[0128] Continue heating and stirring until the solution color stabilizes, then continue heating for 15 minutes;

[0129] After cooling to room temperature, add ultrapure water to 100 mL and store at 4°C.

[0130] (2) Preparation of gold-probe conjugate (AuNP-RP)

[0131] Concentration of AuNPs: Add 1 mL of AuNPs solution to a 1.5 mL clean centrifuge tube, centrifuge at 8000 rpm for 15 min, remove the supernatant, and resuspend the precipitate in 100 μL of ultrapure water.

[0132] Probe activation: Add 50 μL of gold nanoparticle probe RP (thiol-modified recognition probe) (10 μmol / L), 5 μL of acetic acid buffer (0.5 mol / L, pH 5.2) and 10 μL of TCEP solution (1 mmol / L) into a clean glass bottle and incubate at room temperature in the dark for 1 h.

[0133] Probe coupling: Add 500 μL of concentrated AuNPs to the glass bottle of the above probe and react at room temperature for 6 h or overnight.

[0134] System stabilization: add 25 μL Tween-20 (1%, v / v) and incubate at room temperature for 10 min.

[0135] Salt aging: Add 2 mol / L NaCl three times with an interval of 1 hour each time to make the final concentration of NaCl in the system reach 0.3 mol / L, and continue the reaction at room temperature for 12 hours.

[0136] Washing and resuspension: Centrifuge at 8000 rpm for 15 min, remove the supernatant, and wash the pellet three times with Tris-HCl buffer (10 mmol / L, pH 7.4). Resuspend the pellet in 500 μL of resuspension buffer (1 mmol / L Tris-HCl, 5% BSA, 0.25% Tween-20, and 10% sucrose, pH 8.0).

[0137] (3) The size of the lateral flow immunochromatographic strip (LFS) is 3 mm × 60 mm and consists of five modules. The specific preparation method is as follows:

[0138] The sample pad was used to load the sample. To improve the water absorption and surface activity of the sample pad and avoid the influence of complex matrix on the test results, the sample pad was soaked in sample pad treatment solution (0.05 mol / L Tris-HCl, 0.15 mol / L NaCl, 0.25% Triton-100, pH 8.0) for 2 h after cutting and dried at 30°C for use.

[0139] The gold label pad was used to store the AuNP-RP conjugate. To improve its carrying capacity and ensure the dispersion of the AuNP-RP conjugate, the gold label pad was cut and soaked in a gold label pad treatment solution (10 mmol / L PB, 5% sucrose, 1% trehalose, 0.3% Tween-20, 0.25% PEG 20000, pH 7.4) for 2 hours and then dried at 30°C. 6 μL of AuNP-RP conjugate was then added dropwise to the dry gold label pad, dried at 30°C, and stored for later use.

[0140] The NC membrane was used to immobilize the test (T) line and the control (C) line. Three biotinylated capture probes were immobilized on the T line of test strip 1: specifically, the capture probe targeting KPC (CP KPC) on line T1, the capture probe targeting NDM (CP NDM) on line T2, and the capture probe targeting VIM (CP VIM) on line T3. Two biotinylated capture probes were immobilized on the T line of test strip 2: specifically, the capture probe targeting IMP (CPIMP) on line T1, and the capture probe targeting OXA (CP OXA) on line T2. The C line was immobilized with a biotinylated control probe (CCP). Prior to membrane coating, all biotinylated capture probes were pre-conjugated with streptavidin. Specifically, 2.5 μL of biotinylated capture probe (100 μmol / L), 2.5 μL of streptavidin (5 mg / mL), and 15 μL of 1× PBS were added to a PCR tube and incubated at room temperature for 1 hour. The spray rate of the film sprayer was set to 0.5 μL / cm. After the film spraying was completed, the NC film was dried in a 30°C oven and stored.

[0141] The absorbent pad is used to collect the aqueous phase and provide the driving force for the reaction solution to flow along the test strip.

[0142] The base plate serves as a base to assemble the above four modules. The four modules are connected in sequence on the base plate and overlap each other by about 2 mm.

[0143] S6. Hybridization and color development of the amplified product with the capture probe on the lateral flow immunochromatography strip:

[0144] Add 1 μL of RPA amplification product to 50 μL of loading buffer (10 mmol / L Tris-HCl, 5 mmol / L KCl, 5 mmol / L MgCl2, 2× SSC, 2% PEG 20,000, 1% BSA, 1% CTAB, 1% Tween-20, pH 8.0). Mix thoroughly and immerse the test strip in the sample. After 5–10 minutes, observe the color development and determine the result.

[0145] RPA-lateral flow immunochromatography strip technology principle diagram Figure 2As shown, since the 5' end of each primer is labeled with a nucleic acid sequence, if the target gene is present, in the free single-stranded sequence (i.e., the nucleic acid-labeled nucleic acid sequence) in the successfully amplified RPA product, the nucleic acid-labeled base sequence of the forward primer is complementary to the base sequence of the gold nanoparticle capture probe on the lateral flow immunochromatography strip, so that the amplified product has the ability to develop color; when it flows to the detection line under the action of chromatography, the nucleic acid-labeled base sequence of the reverse primer will be complementary to the base sequence of the detection line capture probe on the lateral flow immunochromatography strip at the corresponding detection line position, thereby developing color on the corresponding detection line.

[0146] The final lateral flow immunochromatographic strip results are as follows Figure 3 As shown in Table 1 and Figure 3 The results can clearly determine whether the patient has carbapenemase resistance and which specific enzyme type of carbapenemase the patient is resistant to. Figure 3 From left to right, the positive results of KPC, NDM, VIM, KPC NDM, NDM VIM, KPC VIM, KPC NDM VIM, IMP, OXA, and IMP OXA are shown.

[0147] In addition, taking KPC as an example, the detection limit of the method of the present invention for carbapenemase resistance genes was tested, and the results were as follows: Figure 4 As shown. Figure 4 It can be seen that the lower limit of detection of KPC resistant genotype is 10 2 CFU / mL.

[0148] In summary, the present invention uses RPA-lateral flow immunochromatographic strip technology (RPA-LFS) to simultaneously perform rapid, multiplex detection and accurate typing of five carbapenemase resistance genes (KPC, NDM, VIM, IMP, OXA), with high sensitivity and specificity, and can detect KPC, NDM, VIM, IMP, OXA to 10 2 Copies / mL, which is basically consistent with the finished fluorescent quantitative PCR kits on the market, and the low detection limit greatly meets clinical needs; at the same time, the entire detection process of the present invention only takes 30 to 40 minutes, and does not require large and complex instruments, with low cost, and can achieve rapid bedside detection in multiple scenarios. In addition, the integrated technology possessed by the present invention can achieve early detection of pathogens, which is crucial for clinical situations that require a rapid response; and the technology is easy to operate, and even individuals with minimal training can perform instant testing, which increases its applicability in different medical environments; RPA-LFS technology does not require a large amount of reagents and materials, and can be mass-produced; in addition, the technology does not require specialized instruments and training, which makes it economically feasible and can be quickly expanded to large-scale applications, even in remote areas with limited resources. Detection purposes can be achieved.

[0149] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A primer for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology, characterized in that: The invention comprises five nucleic acid sequence marker-specific primer pairs, namely, a KPC primer pair, an NDM primer pair, a VIM primer pair, an IMP primer pair, and an OXA primer pair; the five nucleic acid sequence marker-specific primer pairs respectively comprise a forward primer F and a reverse primer R, and the sequences are as follows: KPC-F:AACAAACAAACAAACA / iSpC12 / CACTGTGCAGTCATTCAAGGGCTTTCT; KPC-R:CTGATCGAGAATTAGC / iSpC12 / AATTGGCGGCGGCGTTATCACTGTATTG; NDM-F:AACAAACAAACAAACA / iSpC12 / TCGCACCGAATGTCTGGCAGCACACTTCC TAT; NDM-R:CATTCTGCTTCCAAGT / iSpC12 / GTTCGACAACGCATTGGCATAAGTCGCAAT CC; VIM-F:AACAAACAAACAAACA / iSpC12 / GGGAGCCGAGTGGTGAGTATCCGACAGT; VIM-R:TAGATAGATAGATAGA / iSpC12 / TTTTCGCACCCCACGCTGTATCAATCAA; IMP-F:AACAAACAAACAAACA / iSpC12 / AGGCAGTATTTCCTCTCATTTTCATAGTGAC AGC; IMP-R:CTAATCCGCCTTAACA / iSpC12 / ATTTTCCTTTCAGGCAGCCAAACTACTAGGT TAT; OXA-F:AACAAACAAACAAACA / iSpC12 / ATTATCGGAATGCCAGCGGTAGCAAAGGA; OXA-R:TCGACTGAGAATTGAC / iSpC12 / TCGAGGGCGATCAAGCTATTGGGAATTTT.

2. The primer according to claim 1, characterized in that In each primer sequence of the five nucleic acid sequence-labeled specific primer pairs, the 5' end is a labeled nucleic acid sequence, and a C12 backbone structure modification is designed between the nucleic acid sequence and the adjacent unmodified sequence; the C12 is used to prevent primer dimer formation.

3. The primer according to claim 1, characterized in that The KPC primer pair, NDM primer pair, VIM primer pair, IMP primer pair and OXA primer pair are used for detecting the carbapenemase resistance genes KPC, NDM, VIM, IMP and OXA, respectively.

4. Use of the primer according to any one of claims 1 to 3 in preparing a product for detecting carbapenemase resistance genes.

5. A probe for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology, characterized in that: It includes gold nanoparticle capture probes, KPC capture probes, NDM capture probes, VIM capture probes, IMP capture probes, OXA capture probes and quality control capture probes, and the sequences are as follows: Gold nanoparticle capture probe:TGTTTGTTTGTTTGTTTTTTTT-SH; KPC capture probe: GCTAATTCTCGATCAGTTTTTT-Biotin; NDM capture probe: ACTTGGAAGCAGAATGTTTTTT-Biotin; VIM capture probe: TCTATCTATCTATCTATTTTTT-Biotin; IMP capture probe: TGTTAAGGCGGATTAGTTTTTT-Biotin; OXA capture probe: GTCAATTCTCAGTCGATTTTTT-Biotin; Quality control capture probe: AACAAACAAACAAACA-Biotin.

6. The probe according to claim 5, characterized in that The gold nanoparticle capture probe is a capture probe designed for the carbapenemase resistance genes KPC, NDM, VIM, IMP, and OXA, so that the amplified product has the ability to develop color; the KPC capture probe, NDM capture probe, VIM capture probe, IMP capture probe, and OXA capture probe are detection line probes designed for the resistance genes KPC, NDM, VIM, IMP, and OXA, respectively, so that the amplified product develops color on the corresponding detection line; the quality control capture probe enables the quality control line to develop color.

7. Use of the probe according to claim 5 or 6 in preparing a product for detecting carbapenemase resistance genes.

8. A kit for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology, characterized in that: It includes the following components: (1) The primer according to any one of claims 1 to 3; (2) The probe according to any one of claims 4 to 5; (3) Lateral flow immunochromatographic strips; (4) RPA amplification buffer; (5) Lateral flow immunochromatographic strip detection system.

9. A method for detecting carbapenemase resistance genes using RPA-lateral flow immunochromatography technology for non-diagnostic purposes, characterized in that: Using the kit according to claim 8, the method is as follows: Using the sample DNA to be tested as a template, the primers and the RPA amplification buffer system are used to form an RPA amplification system to perform RPA amplification; fixing the probe on the lateral flow immunochromatography strip; The amplified product is combined with a lateral flow immunochromatographic strip, and the drug-resistant genotype is determined by the detection result of the lateral flow immunochromatographic strip detection system.

10. The method for detecting carbapenemase resistance genes according to claim 9, characterized in that: The RPA amplification system is used to amplify carbapenemase resistance genes, and specifically comprises: 0.7 μL of each primer, 29.4 μL of A buffer, 2.5 μL of B buffer, 5 μL of DNA template, and 8.9 μL of ddH2O; or, 0.7 μL of each primer, 29.4 μL of A buffer, 2.5 μL of B buffer, 5 μL of DNA template, and 10.3 μL of ddH2O; The lateral flow immunochromatography strip detection system is used for color development of the combination of RPA amplification products and lateral flow immunochromatography strips, and specifically comprises: 1 μL of RPA amplification product and 50 μL of loading buffer; the loading buffer comprises 10 mmol / L Tris-HCl, 5 mmol / L KCl, 5 mmol / L MgCl2, 2×SSC, 2% PEG 20000, 1% BSA, 1% CTAB, and 1% Tween-20, with a pH of 8.0.