Composition for RAA-CRISPR / Cas12a integrated detection of spring viraemia of carp virus and application

Abstract

The invention belongs to the technical field of aquaculture and aquaculture prevention and control, and particularly relates to a composition for RAA-CRISPR / Cas12a integrated detection of spring viremia of carp virus and application. The composition for RAA-CRISPR / Cas12a integrated detection of the spring viraemia of the carp comprises a crRNA sequence for detecting the spring viraemia of the carp and an RAA primer pair for cDNA amplification of the spring viraemia of the carp, the crRNA sequence is shown as any one of SEQ ID NO.9 to SEQ ID NO.13, and the RAA primer pair is shown as any one of SEQ ID NO.1 to SEQ ID NO.8. The invention further discloses a kit for detecting the spring viraemia of the carp. According to the present invention, the integrated reaction of the RAA amplification and the CRISPR / Cas12a detection of the spring viremia of carp virus is achieved, the experiment operation process is simplified, the detection efficiency is improved, the problem that the samples are easily polluted by the step-by-step RAA-CRISPR detection method is effectively overcome, the method is suitable for the fluorescence detection method or the test strip detection method, and the application prospect is wide.

Description

Technical Field

[0001] The present invention belongs to the technical fields of agriculture, fishery, aquaculture, and aquaculture disease prevention and control, and specifically relates to a RAA-CRISPR detection kit for detecting carp spring viremia virus in cyprinid fish. Background Art

[0002] Spring viremia of carp virus (SVCV) is a single-stranded RNA virus that specifically infects cyprinid fish, inducing a toxic hemorrhagic disease. It belongs to the genus Vesiculovirus in the family Rhabdoviridae. SVCV particles are oval at one end and flat at the other, resembling a typical bullet-shaped particle. SVCV is 80–180 nm in length and typically 60–90 nm in diameter. SVCV is an enveloped RNA virus with an approximately 11 kb genome containing five major open reading frames (ORFs), encoding five proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA polymerase (L). Nucleoprotein N is the most abundant virion protein and plays an important role in transcriptional regulation. Phosphoprotein P is a component of the rhabdovirus nucleocapsid and, along with the L and N proteins, is essential for transcription. Matrix protein M connects the cytoplasmic nucleocapsid to the viral envelope, forming the bullet-shaped structure of the virion. Surface glycoproteins are the primary viral antigens, determining the virus's serological properties. The L protein interacts with the N and P proteins on the nucleocapsid to enable viral transcription and replication.

[0003] SVCV has a wide host range, infecting a variety of cyprinid fish, including common carp (Cyprinus carpio), koi (Cyprinus carpio koi), grass carp (Ctenopharyngodon idellus), and crucian carp (Carassius auratus). Common carp is the most susceptible host. According to the 2024 China Fisheries Statistical Yearbook, my country's common carp production exceeded 2.8 million tons in 2023, making it one of the country's most productive farmed freshwater fish species. SVCV has long been prevalent in Europe and the Middle East, primarily affecting one-year-old common carp. It is estimated that annual losses of one-year-old common carp in Europe due to SVCV are approximately 4,000 tons (10%-15% of total production). In 1998, the Centre for Environment, Fisheries and Aquaculture Science (CEFAS) in the United Kingdom isolated SVCV strains from goldfish and koi in Beijing, China. This was the earliest report of common carp spring viremia in China, indicating a long history of the virus in China and providing an important reference for subsequent research. In the spring of 2024, a viral disease primarily affecting carp species broke out in aquaculture areas across my country, with Spring Cyprinid Viremia Virus (SVCV) identified as one of the primary pathogens. The disease was characterized by a high mortality rate (up to 50% to 70%), with diseased fish exhibiting symptoms such as darkening, abdominal swelling, and internal bleeding.

[0004] Outbreaks of SVCV are primarily determined by water temperature, the age and physiological state of the fish, and growth stress factors. Water temperature is a key environmental factor in SVCV infection, particularly in the spring, when outbreaks are most likely to occur at water temperatures between 10°C and 17°C. Infected fish often lie motionless on the pond bottom. As the disease progresses, they develop symptoms such as anorexia, abdominal distension, and difficulty maintaining balance in the water. Infected fish also develop darkening, redness and swelling of the anus, intestinal inflammation, and punctate hemorrhages on the skin, gills, eyes, and internal organs. Autopsies reveal enlargement and hemorrhages in various tissues and organs, particularly in the spleen and swim bladder, where prominent hemorrhages are observed. Histopathologically, the liver exhibits congestion, multifocal necrosis, and fatty degeneration, while the spleen exhibits congestion and extensive proliferation of reticuloendothelial cells. Lymphatic vessels may also be extremely dilated and filled with macrophages and lymphocytes.

[0005] Because SVCV infects a wide range of hosts and can cause over 70% mortality in infected juvenile carp, an SVCV outbreak can easily cause severe economic losses. my country's "List of Category I, II, and III Animal Epidemic Diseases" includes SVCV as a Category I animal disease. Prevention is central to the prevention and control of viral diseases in aquatic animals and is the ideal response strategy. Among the many preventive measures, isolating the virus and blocking its transmission pathways is arguably the most effective. The effective implementation of these isolation and blocking measures relies heavily on rapid detection technology.

[0006] Currently, the developed SVCV nucleic acid detection methods are primarily based on molecular biology detection technologies represented by the polymerase chain reaction (PCR), as well as recombinase polymerase amplification (RPA), recombinase-mediated strand displacement nucleic acid amplification (RAA), and loop-mediated isothermal amplification (LAMP). In terms of PCR technology, typical detection methods include the current national testing standard, "Diagnostic Procedure for Spring Viremia of Carp" (GB / T 15805.5-2018), as well as various multiplex PCR and fluorescence quantitative PCR technologies developed based on PCR technology. Although various PCR-based detection methods have demonstrated good specificity and sensitivity for SVCV, the requirement of specialized and expensive laboratory equipment and skilled laboratory personnel significantly limits the application scenarios and scope of these technologies.

[0007] Isothermal amplification technologies such as LAMP, RPA, and RAA, because they maintain a constant reaction temperature and eliminate the need for repeated temperature changes, do not require specialized equipment such as a PCR machine. Furthermore, their reaction times are significantly improved compared to traditional PCR techniques. Therefore, these technologies have the potential to be developed into first-line rapid tests.

[0008] A study reported that Liang Junni et al. designed specific primers based on the G gene of SVCV and established an SVCV detection method based on RPA technology. This method can complete detection within 20 minutes, with a minimum detection limit of 89.2 copies / μL. Saleh et al. used RT-LAMP combined with nanobiotechnology to detect SVCV in clinical samples within 15 minutes without amplifying viral RNA.

[0009] Compared to RPA, RAA uses a similar reaction principle. The primary difference lies in the source of the recombinase: the recombinase used in RPA is primarily extracted from T4 bacteriophage, while the recombinase used in RAA is primarily derived from bacteria and fungi, a more diverse source. Furthermore, the polymerase used in RAA possesses only DNA polymerase activity, which allows for exponential growth of the reaction product.

[0010] Cas12a can be used to edit target DNA. The protein was originally called Cpf1 and was first proposed by Zhang Feng's team in 2015. Cas12a (Cpf1) is an important member of the gene editing enzyme family. It can cut DNA at locations where Cas9 cannot act; it forms a ternary complex with crRNA and target DNA, and the complex exhibits strong trans-nuclease activity, which can cut non-target single-stranded DNA in the system into "fragments" of several bases in length. Taking advantage of this feature, Professor Doudna's team developed a diagnostic system called "DETECTR" (DNA Endonuclease Targeted CRISPR Trans Reporter), which consists of CRISPR-Cas12a (Cpf1) and guide RNA, fluorescent reporter molecules and RPA (recombinasepolymerase amplification) isothermal amplification reagents. A single-tube reaction can quickly and easily detect small amounts of DNA in clinical samples. When heated to a certain temperature, RPA amplifies the target DNA, making it easier for Cas12a (Cpf1) to find and cut it, and then activates the nuclease activity of Cas12a (Cpf1) to cut other single-stranded DNA in the system (that is, fluorescent reporter molecules), thereby emitting fluorescence.

[0011] Furthermore, studies have shown that the nuclease activity of Cas proteins is irreversibly damaged at temperatures exceeding 45°C. However, the entire reaction temperature of RPA and RAA technologies is kept between 37°C and 42°C, giving the two technologies a natural coupling advantage. Combining RAA technology with the CRISPR system allows for direct observation of fluorescence from positive samples under 470nm blue or ultraviolet light, further simplifying the interpretation of test results. However, fluorescence-based RAA-CRISPR / Cas12a detection often requires a low-intensity environment to clearly observe the test results. In complex testing environments, such situations can lead to errors in the interpretation of test results. Based on this property, the RAA-CRISPR / Cas12a system is combined with lateral flow dipsticks (LFDs), allowing test results to be displayed directly on the test strip, eliminating the fluorescence method's dependence on ambient light intensity. Summary of the Invention

[0012] The present invention combines RAA technology with CRISPR / Cas technology to develop a one-step detection system for the detection of carp spring viremia virus, thereby realizing integrated rapid nucleic acid detection of carp spring viremia virus.

[0013] The present invention provides an RAA-CRISPR / Cas12a integrated detection composition for carp spring viremia virus, comprising a crRNA sequence for detecting carp spring viremia virus and a RAA primer pair for amplifying carp spring viremia virus cDNA. RAA amplification of carp spring viremia virus cDNA and CRISPR / Cas12a detection of carp spring viremia virus are integrated into a reaction.

[0014] The crRNA sequence is shown in any one of SEQ ID NO.9-SEQ ID NO.13, preferably the crRNA sequence shown in SEQ ID NO.10.

[0015] The RAA primer pair is any one of the following primer pairs:

[0016] a.SEQ ID NO.1 and SEQ ID NO.2;

[0017] b. SEQ ID NO. 3 and SEQ ID NO. 4;

[0018] c. SEQ ID NO. 5 and SEQ ID NO. 6;

[0019] d.SEQ ID NO.7 and SEQ ID NO.8;

[0020] Preferred are SEQ ID NO. 3 and SEQ ID NO. 4.

[0021] When used for test strip detection, it also contains a reporter probe shown in SEQ ID NO.14.

[0022] The RAA-CRISPR / Cas12a integrated detection composition for carp spring viremia virus provided above can be used to prepare RAA-CRISPR / Cas12a detection products for carp spring viremia virus, and the products can be reagents, kits, test strips, detection systems, instruments or equipment, etc.

[0023] The present invention provides a product for detecting RAA-CRISPR / Cas12a of carp spring viremia virus, comprising the above-mentioned RAA-CRISPR / Cas12a integrated detection composition of carp spring viremia virus of the present invention. The product can be a reagent, and / or a kit, and / or a test strip, and / or a detection system, and / or an instrument, and / or a device, etc.

[0024] The product also contains carp spring viremia virus cDNA or a plasmid containing carp spring viremia virus cDNA as a standard product.

[0025] The product also contains RAA amplification components such as sucrose, reaction buffer, core mix, etc., which together with the RAA primer pair constitute an RAA amplification system.

[0026] The product also contains Cleavage Buffer, signal probe Reporter, Cas12a protein, nuclease-free water and other CRISPR detection components, which together with the crRNA sequence form a CRISPR detection system. The signal probe Reporter includes but is not limited to FAM Reporter, LFD Reporter, etc. FAM Reporter is used for fluorescence detection, and LFD Reporter is used for test strip detection.

[0027] The RAA-CRISPR / Cas12a integrated detection composition or detection product for carp spring viremia virus provided above in the present invention can be used for the detection of carp spring viremia virus.

[0028] The present invention provides a method for detecting carp spring viremia virus, which comprises the following steps: obtaining cDNA after reverse transcription of total RNA of a sample, mixing it with the RAA-CRISPR / Cas12a integrated detection composition or detection product of carp spring viremia virus provided above to obtain a reaction system, performing RAA amplification and CRISPR / Cas12a detection integrated reaction to obtain a reaction solution, observing fluorescence or color development of a test strip, and performing qualitative and / or quantitative determination.

[0029] Furthermore, the reaction system also contains RAA amplification components such as sucrose, Reaction Buffer, Core Mix, etc., which together with the RAA primer pair constitute the RAA amplification system.

[0030] Furthermore, the reaction system also contains Cleavage Buffer, signal probe Reporter, Cas12a protein, nuclease-free water and other CRISPR detection components, which together with the crRNA sequence constitute the CRISPR detection system.

[0031] Furthermore, the RAA amplification system is added first, and then the CRISPR detection system is added. Furthermore, after the sucrose in the RAA amplification system is completely dissolved, the cDNA obtained by reverse transcription of the total RNA of the sample is added, and then the CRISPR detection system is added.

[0032] Furthermore, the reaction was carried out at 37° C. for 60 minutes. Furthermore, after the reaction was carried out at 37° C. for 30 minutes, the reaction system was mixed again (eg, by flicking and turning upside down 3 times), and then the reaction was carried out at 37° C. for another 30 minutes.

[0033] Furthermore, the reaction solution was irradiated with blue light of 470 nm wavelength to observe fluorescence.

[0034] Furthermore, the reaction solution is added to the test strip, and the color development of the test strip is observed.

[0035] Compared with the prior art, the advantages of the present invention are:

[0036] The present invention is the first to integrate the traditional RAA-CRISPR step-by-step detection method into a dual-use integrated detection method and apply it to the detection of carp spring viremia virus (SVCV).

[0037] 1. The method of the present invention is used to detect carp spring viremia virus, simplifies the experimental operation process, can further improve the detection efficiency, reduce the difficulty of operation, and effectively overcome the problem of easy contamination between samples in the previous step-by-step RAA-CRISPR detection method.

[0038] 2. The method of the present invention is used to detect carp spring viremia virus. The corresponding fluorescence detection method or test strip detection method can be selected according to the specific detection requirements and on-site environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The figures are the results of dual-purpose SVCV-RAA-CRISPR primer screening (A) and dual-purpose SVCV-RAA-CRISPRcrRNA screening results (B, C).

[0040] Figure 2 This is the sensitivity test result of the dual-use SVCV-RAA-CRISPR fluorescence detection method - fluorescence spectrum diagram (A), from top to bottom are the first, second, and third parallel experimental groups.

[0041] Figure 3 The sensitivity test results of the dual-use SVCV-RAA-CRISPR fluorescence detection method - actual picture (B), from top to bottom are the first, second, and third parallel experimental groups.

[0042] Figure 4 This is the sensitivity test result of the dual-use SVCV-RAA-CRISPR test strip detection method. Three parallel experimental groups were set up.

[0043] Figure 5 This is the specificity test result of the dual-use SVCV-RAA-CRISPR fluorescence detection method - fluorescence spectrum diagram (A), from top to bottom are the first, second, and third parallel experimental groups.

[0044] Figure 6 The specificity test results of the dual-use SVCV-RAA-CRISPR fluorescence detection method - actual picture (B), from top to bottom are the first, second, and third parallel experimental groups.

[0045] Figure 7 This is a graph showing the specificity test results of the dual-use SVCV-RAA-CRISPR test strip detection method. Three parallel experimental groups were set up.

[0046] Figure 8 These are the clinical sample test results of the current national standard detection method (clinical samples 1-30, the left side (clinical samples 1-30) is the first round of PCR, the right side (clinical samples 1-30) is the second round of PCR, NC-negative control: nuclease-free water was added during the amplification stage, PC-positive control: SVCV-positive cDNA was added during the amplification stage).

[0047] Figure 9Results of the dual-use SVCV-RAA-CRISPR fluorescence detection assay for clinical samples—fluorescence spectrum (A) (clinical samples 1-30, NC-negative control: nuclease-free water was added during the amplification phase, PC-positive control: SVCV-positive cDNA was added during the amplification phase).

[0048] Figure 10 Results of the dual-use SVCV-RAA-CRISPR fluorescence detection assay for clinical samples—actual image (B) (clinical samples 1-30, NC-negative control: nuclease-free water was added during the amplification phase, PC-positive control: SVCV-positive cDNA was added during the amplification phase).

[0049] Figure 11 These are the clinical sample test results of the dual-use SVCV-RAA-CRISPR test strip assay (clinical samples 1-30, NC-negative control: nuclease-free water was added during the amplification phase, PC-positive control: SVCV-positive cDNA was added during the amplification phase). DETAILED DESCRIPTION

[0050] 1. Materials

[0051] 1.1 Reagents and consumables

[0052] RAA nucleic acid amplification reagent (basic type) (S001ZC), Hangzhou Zhongce Biotechnology Co., Ltd.; CRISPR / Cas12a DNA detection kit (DF-CAS12-2S), Shenzhen Yizhi Biotechnology Co., Ltd.; pMD TM 19-T Vector Cloning Kit, r Taq polymerase, PrimeScript TM RT Master Mix (RR036A) was purchased from TaKaRa (Dalian Bao Biotechnology Co., Ltd.); agarose gel recovery kit (MI17101M) was purchased from Mona (Suzhou) Biotechnology Co., Ltd.; nucleic acid analyzer (Nanodrop ONE) was purchased from Thermo; GS-8 constant temperature fluorescence amplification instrument was purchased from Suzhou Xinda Gene Technology Co., Ltd.; CRISPR test strips (TS104) were purchased from Suzhou Xinda Gene Technology Co., Ltd.; sucrose (57-50-1) was purchased from Macklin; phenol (108-95-2), chloroform (67-66-3), and isoamyl alcohol (123-51-3) were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0053] Industrial synthesis of oligonucleotides (primers and crRNAs) was performed by Sangon Biotechnology (Shanghai) Co., Ltd.

[0054] 2 Methods

[0055] 2.1 Construction of SVCV standard positive plasmid

[0056] Total RNA from SVCV-positive samples was extracted using the Trizol method, and the Premix reverse transcription reagent PrimeScript was used. TM Reverse transcribe total RNA according to the RT Master Mix instructions. Reverse transcription procedures include: 37°C for 15 minutes, 85°C for 5 seconds, to obtain SVCV-positive cDNA, which was then stored at -20°C.

[0057] Using SVCV positive cDNA (GenBank: KJ513477.1) as a template, conventional PCR was performed to amplify a truncated sequence within the complete SVCV G gene sequence to obtain the target product. This product was cloned in DH5α using the pMD19-T vector, and the cloned fragment was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification (target fragment, 1470 bp). After amplification of the recombinant vector culture, plasmid DNA was extracted using a plasmid extraction kit and stored at -20°C until use.

[0058] 2.2SVCV RAA-CRISPR Primer Screening

[0059] Design 4 sets of primers in the target sequence region to be amplified, totaling 8 primers. The primer sequences are shown in Table 1:

[0060] Table 1 SVCV RAA primers

[0061]

[0062] Using SVCV positive cDNA as template, perform RAA-AGE detection reaction:

[0063] Mix 25 μL of A Buffer, 13.5 μL of Nuclease-free H₂O, and 2 μL each of the RAA upstream and downstream primers (primer concentration: 10 μM) and add to a detection tube containing dry reaction powder. Then, add 5 μL of the DNA sample to be tested. Finally, add 2.5 μL of B Buffer to the cap of the detection tube. Close the cap and gently shake the tube upside down 5-6 times to thoroughly mix. Centrifuge at low speed for 10 seconds. Incubate the detection tube in a 39°C thermoamplifier for 30 minutes. After the reaction, add 50 μL of phenol:chloroform:isoamyl alcohol (25:24:1) extraction buffer for purification. After thorough mixing, centrifuge at 12,000 rpm / min for 5 minutes. The supernatant is analyzed by agarose gel electrophoresis.

[0064] 2.3crRNA Screening

[0065] Five single-stranded crRNA sequences were designed within the RAA amplification product region. Using the SVCV standard positive plasmid as a template, a two-step RAA-Cas12a amplification and detection method was employed to screen each of the five crRNA groups. The optimal crRNA primer set was identified by comparing the peak fluorescence times of different crRNAs under the same sample. The crRNA sequences are shown in Table 2.

[0066] Table 2SVCV RAAcrRNA sequence

[0067]

[0068]

[0069] The RAA-CRISPR / Cas12a first step amplification reaction system is as follows:

[0070] Add 10 μL Reaction Buffer (2X), 5 μL Core Mix (4X), 1 μL each of RAA upstream and downstream primers (primer concentration 10 μM each), 1 μL DNA, and finally 2 μL Starter (10X). Mix thoroughly by flicking several times and briefly centrifuging. Incubate at 37°C for 30 minutes to complete the reaction.

[0071] The second-step detection reaction system of RAA-CRISPR / Cas12a is as follows:

[0072] 2μL Cleavage Buffer (10X), 0.6μL signal probe Reporter (4μM), 1μL Cas12a protein (1μM), 1μL crRNA (Cas12a) (1μM), 10.4μL Nuclease-free H2O, and finally add 5μL RAA-CRISPR / Cas12a first step amplification product.

[0073] Mix gently by flicking several times and centrifuging briefly (avoid vortexing). Repeat three times. Place the reaction tube in a thermostated reactor and incubate at 37°C for 30 minutes. Observe the fluorescence intensity to determine the result.

[0074] 2.4 Establishment of a dual-use RAA-CRISPR fluorescence and test strip detection system

[0075] Because the detection principle of the test strip method is different from that of the fluorescence method, the reporter probes used in the test strip method and the fluorescence method are different probes. The specific sequence of the reporter probe used in the test strip method is: 5'-6-FAM-TTTTTTATTTTTT-Biotin-3' (SEQ ID NO.14)

[0076] The final reaction system is as follows:

[0077] Table 3 RAA system configuration method

[0078]

[0079]

[0080] Table 4 Fluorescence CRISPR reaction system

[0081]

[0082] Table 5 Test strip method CRISPR reaction system

[0083]

[0084]

[0085] The specific steps are as follows:

[0086] 1. Before starting the reaction, you need to pre-configure the RAA amplification system reagents and CRISPR detection system reagents. The specific configuration method is as follows. (Note: Starter (2×) should be added last)

[0087] 2. After all the sucrose in the RAA detection system is dissolved, add 1 μL DNA sample and 2 μL Starter (2×) to the system in sequence. Note: 2 μL Starter (2×) should be added last.

[0088] 3. Slowly add the prepared CRISPR detection system along the tube wall into the reaction tube containing the RAA amplification system.

[0089] 4. Place the prepared reaction tube in a thermocoupler and incubate at 37°C for 60 minutes. (After 30 minutes, remove the reaction tube, flick it gently, and invert it three times. After a brief centrifugation, place it back in the thermocoupler and continue incubating for another 30 minutes.)

[0090] 5. If fluorescence detection is used, irradiate the reaction tube with 470nm wavelength blue light after the reaction is completed. The positive sample solution will emit green light, while the negative sample solution will not emit light.

[0091] 6. If using the LFD method for detection, add 50-60 μL of the reaction product to the sample pad of the test strip after the reaction is completed, wait for 5 minutes and then read the result.

[0092] 2.5Svcv dual-use RAA-CRISPR detection system sensitivity experiment

[0093] Fluorescence method: 7 serial dilutions (6.04x106 -6.04x10 0 The positive quality control sample with 100 copies / μL) and nuclease-free water were used as templates for RAA-Cas12a detection, and the detection sensitivity of the method was determined by the fluorescence curve.

[0094] Weigh 3.53 mg of sucrose and add it to a reaction tube, 10 μL Reaction Buffer (2X), 5 μL Core Mix (4X), 1 μL each of RAA upstream and downstream primers (primer concentration is 10 μM), 1 μL DNA, and finally add 2 μL Starter (10X) and mix well. Then add CRISPR system premix (8 μL Cleavage Buffer (10X), 2.4 μL signal probe Reporter (4 μM), 4 μL Cas12a protein (1 μM), 4 μL crRNA (Cas12a) (1 μM), 41.6 μL Nuclease-free H2O) to the tube and react at 37°C for 60 minutes. Observe the fluorescence intensity to determine the test results. Repeat the test three times.

[0095] Test strip method: 7 dilutions (6.04x10 6 -6.04x10 0 The positive quality control sample with 100 copies / μL) and nuclease-free water were used as templates for RAA-Cas12a detection, and the detection sensitivity of the method was determined by the fluorescence curve.

[0096] Weigh 3.53mg of sucrose and add it to the reaction tube, 10μL Reaction Buffer (2X), 5μL Core Mix (4X), 1μL each of RAA upstream and downstream primers (primer concentration is 10μM), 1μL DNA, and finally add 2μL Starter (10X) to mix. Then add CRISPR system premix (8μL Cleavage Buffer (10X), 1μL signal probe Reporter (2μM), 4μL Cas12a protein (1μM), 4μL crRNA (Cas12a) (1μM), 43μL Nuclease-free H2O) to the tube and react at 37°C for 60min. After the reaction is completed, 40-60μL of the reaction product is aspirated and added dropwise to the test strip to determine the test result. The test was repeated three times.

[0097] 2.6 SVCV dual-use RAA-CRISPR detection system specificity experiment

[0098] Clinical samples were collected for SVCV-positive cDNA, Cyprinid herpesvirus 2 (CyHV-2)-positive DNA, Koi herpesvirus (KHV)-positive DNA, Grass carp reovirus-Ⅰ (GCRV-Ⅰ)-positive cDNA, Grass carp reovirus-Ⅱ (GCRV-Ⅱ)-positive cDNA, Grass carp reovirus-Ⅲ (GCRV-Ⅲ)-positive cDNA, and Aeromonas hydrophila-positive DNA. Nuclease-free water was used as a negative control, and the detection method described in 2.5 was used to analyze the specificity of this method. Three replicates were performed.

[0099] 2.7 Evaluation of the practical application effect of the SVCV dual-use RAA-CRISPR detection system

[0100] Select positive cell samples (30) from the laboratory

[0101] Total RNA was extracted from the samples and then reverse transcribed into cDNA. The dual-use RAA-Cas12a system and the PCR method in the Diagnostic Protocol for Spring Viremia in Carp (GB / T 15805.5-2018) were then used for detection. Actual samples were also tested. The consistency of the two RAA-CRISPR / Cas12a-based detection methods with the national standard detection method was compared to evaluate the detection effect of the dual-use RAA-CRISPSR method.

[0102] 3 Results and Conclusions

[0103] 3.1SVCV RAA-CRISPR primer screening results

[0104] According to the brightness of the bands in agarose gel electrophoresis, a pair of primers F2 / R2 with better effect was screened, and the amplified product can produce a bright band at 181bp, such as Figure 1 A.

[0105] Subsequent experiments were performed using primer F2 / R2, whose sequence is:

[0106] SVCV-RAA-F2: CTCTATTTGGATCACAGATGAGACCGTGC (SEQ ID NO.3)

[0107] SVCV-RAA-R2:ATTACAGAATTTCATTCGACAAGACCCCC(SEQ ID NO.4)

[0108] 3.2crRNA Screening

[0109] The reaction tube was observed under blue LED light and ultraviolet light, and crRNA2-2 had the highest brightness. Based on the time and fluorescence intensity of the RAA-CRISPR / Cas12a fluorescence curve, a crRNA2-2 with better effect was screened. The results are as follows Figure 1 B, shown in 1C.

[0110] Therefore, subsequent experiments were performed using crRNA2-2, whose sequence is:

[0111] 5'-UAAUUUCUACUCUUGUAGAUUCUAUAAUAA AGUUGUUAAU-3'

[0112] 3.3 Sensitivity of the SVCV dual-use RAA-CRISPR detection system

[0113] 6.04x 10 6 -6.04x 10 0 The fluorescence values of the detection reaction with 7 plasmid concentrations as templates were between 6.04x 10 6 -6.04x 10 2 The fluorescence of the five samples with 100 copies / μL was detected, and the fluorescence intensity was significantly higher than that of the negative control group. Therefore, the detection limit of this method is 100 copies / μL. Figure 2 and Figure 3 The test strip method was performed using the same plasmid template, 1x 10 6 -1x 10 0 Seven groups of samples were tested positive. Figure 4 shown.

[0114] 3.4 Specificity of the SVCV Dual-Purpose RAA-CRISPR Detection System

[0115] The specificity test results of RAA-Cas12a are as follows Figure 5-Figure 7 As shown in the figure, only the SVCV sample showed an amplification curve, while CyHV-2, KHV, GCRV-Ⅰ, GCRV-Ⅱ, GCRV-Ⅲ, Ah and negative control samples did not show amplification, indicating that the RAA-Cas12a detection system can specifically amplify and detect the target sequence in SVCV, and does not cross-react with the nucleic acids of other common fish pathogens, indicating that the detection method has good specificity and no false positives occur.

[0116] 3.5 Evaluation of the practical application effect of the SVCV dual-use RAA-CRISPR detection system

[0117] The results showed that 20 of the 30 samples were positive using RAA-Cas12a, 20 were positive using the national standard PCR method, and the detection rates of the fluorescence method and the test strip RAA-CRISPR detection method were both 100%. Figure 8 、 Figure 9-10 and Figure 11 .

[0118] Note: The above examples are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention. Therefore, although this specification has described the present invention in detail with reference to the above embodiments, it should be understood by those skilled in the art that the present invention may still be modified or replaced by equivalents. All technical solutions and improvements that do not depart from the spirit and scope of the present invention should be included in the scope of the claims of the present invention.

Claims

1. A RAA-CRISPR / Cas12a integrated detection composition for carp spring viremia virus, characterized in that It comprises a crRNA sequence for detecting carp spring viremia virus and an RAA primer pair for amplifying carp spring viremia virus cDNA, wherein the crRNA sequence is shown in any one of SEQ ID NO.9-SEQ ID NO.13, and the RAA primer pair is any one of the following primer pairs: a.SEQ ID NO.1 and SEQ ID NO.2; b. SEQ ID NO. 3 and SEQ ID NO. 4; c. SEQ ID NO. 5 and SEQ ID NO. 6; d.SEQ ID NO.7 and SEQ ID NO.

8.

2. The RAA-CRISPR / Cas12a integrated detection composition according to claim 1, characterized in that The crRNA sequence is shown as SEQ ID NO.10, and the RAA primer pair is SEQ ID NO.3 and SEQ ID NO.

4.

3. The RAA-CRISPR / Cas12a integrated detection composition according to claim 1 or 2 is used to prepare a RAA-CRISPR / Cas12a detection product for carp spring viremia virus.

4. A product for detecting RAA-CRISPR / Cas12a of carp spring viremia virus, characterized in that: A composition for integrated RAA-CRISPR / Cas12a detection comprising the composition of claim 1 or 2.

5. The RAA-CRISPR / Cas12a detection product according to claim 4, characterized in that The invention also contains carp spring viremia virus cDNA or a plasmid containing carp spring viremia virus cDNA as a standard.

6. The RAA-CRISPR / Cas12a detection product according to claim 4, characterized in that The product also contains sucrose, Reaction Buffer, Core Mix, and RAA primer pairs to form an RAA amplification system; The product also contains Cleavage Buffer, signal probe Reporter, Cas12a protein, nuclease-free water, and crRNA sequence to form a CRISPR detection system.

7. The RAA-CRISPR / Cas12a integrated detection composition according to claim 1 or 2 or the RAA-CRISPR / Cas12a detection product according to any one of claims 4 to 6 is used for the detection of carp spring viremia virus.

8. A method for detecting carp spring viremia virus, characterized in that: The steps include: Obtain cDNA after reverse transcription of total RNA from the sample, mix it with the RAA-CRISPR / Cas12a integrated detection composition according to claim 1 or 2 or the RAA-CRISPR / Cas12a detection product according to any one of claims 4 to 6 to obtain a reaction system, perform RAA amplification and CRISPR / Cas12a detection integrated reaction to obtain a reaction solution, and observe fluorescence or test strip color development.

9. The detection method according to claim 8, characterized in that The reaction system also contains sucrose, Reaction Buffer, Core Mix, and RAA primer pairs to form the RAA amplification system; The reaction system also contains Cleavage Buffer, signal probe Reporter, Cas12a protein, nuclease-free water, and crRNA sequence to form the CRISPR detection system.

10. The detection method according to claim 8, characterized in that The integrated reaction was carried out at 37°C for 60 minutes.

Images