Triple RT-qPCR (Reverse Transcription-Quantitative Polymerase Chain Reaction) primer group and kit for detecting G4, G5 and G9 strains of group A porcine rotaviruses and application of triple RT-qPCR primer group and kit

By designing a triple RT-qPCR primer set of specific primers and probes, the problem of difficult to quickly identify the genotype of pig rotavirus G4, G5 and G9 in the prior art is solved, and efficient and low-cost rapid detection is achieved, improving detection accuracy and efficiency.

CN120485435AActive Publication Date: 2025-08-15INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202510637992.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-16
Publication Date
2025-08-15
Estimated Expiration
2045-05-16

AI Technical Summary

Technical Problem

The existing pig rotavirus detection methods cannot quickly and accurately identify G4, G5 and G9 genotype strains. The traditional method has many steps and takes time, resulting in unsatisfactory diagnostic accuracy.

Method used

A triple RT-qPCR primer set of specific primers and probes was designed to optimize the reaction system, and the genotype of group A pig rotavirus G4, G5 and G9 in a single reaction were realized, which simplified the detection process and improved the typing and detection efficiency.

Benefits of technology

It realizes the rapid and accurate detection of three genotypes in a PCR reaction tube, reduces detection costs, improves sensitivity and typing detection efficiency, and supports the precise monitoring of pig rotavirus and vaccine development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485435A_ABST
    Figure CN120485435A_ABST
Patent Text Reader

Abstract

The invention discloses a triple RT-qPCR (Reverse Transcription-Quantitative Polymerase Chain Reaction) primer group for detecting G4, G5 and G9 strains of group A porcine rotaviruses, a kit and application of the triple RT-qPCR primer group and the kit, and belongs to the field of molecular biology. The primer group comprises a primer and a probe, and nucleotide sequences of the primer and the probe are shown as SEQ ID NO.1-SEQ ID NO.8. According to the present invention, the group A porcine rotavirus G4, G5 and G9 genotype strains can be simultaneously detected in the same PCR reaction tube, and the kit has characteristics of good specificity, good sensitivity and good repeatability, and can be directly used for the laboratory diagnosis of pig clinical diarrhea sample pathogens, the invention provides a rapid and accurate detection method for epidemiological research and clinical differential diagnosis of G4, G5 and G9 genotypes of group A porcine rotaviruses, is especially suitable for scientific research and clinical application, and has good commercial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a triple RT-qPCR primer set, a kit and applications thereof for detecting group A porcine rotavirus G4, G5 and G9 strains. Background Art

[0002] Porcine rotavirus (PoRV) is a major enteric pathogen causing diarrhea and gastroenteritis in suckling and weaned piglets. Its widespread prevalence has caused significant economic losses to the swine industry and severely hampered its healthy development. Epidemiological surveys of PoRV have shown that Group A porcine rotavirus (PoRV A) is the predominant and most widespread serotype. Genotypes G4, G5, and G9 are the most prevalent, with G9 becoming the most prevalent strain, with reports of its detection occurring annually in recent years.

[0003] Currently, most PoRVA detection methods are focused on distinguishing it from other porcine viruses and are unable to identify strains with different G genotypes. Traditional PoRVA typing and identification methods are complex and often require reverse transcription and PCR amplification (3 hours), nucleic acid electrophoresis (0.5 hours), gel imaging analysis, gel excision and recovery (1 hour), and sequencing (2-3 days). The sequencing results are then compared with a known gene database using the NCBI-blast tool to determine the subtype of the virus. This time-consuming process makes rapid diagnosis difficult, and conventional PCR lacks sensitivity and specificity, resulting in suboptimal diagnostic accuracy. Summary of the Invention

[0004] The purpose of the present invention is to provide a triple RT-qPCR primer set, kit and application thereof for detecting group A porcine rotavirus G4, G5 and G9 strains, so as to solve the problems existing in the above-mentioned prior art. The present invention has good repeatability, specificity and sensitivity, and can simultaneously perform rapid and accurate clinical detection of the three genotypes of group A porcine rotavirus G4, G5 and G9 strains.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a triple RT-qPCR primer set for detecting group A porcine rotavirus G4, G5, and G9 strains, the primer set comprising the following primers and probes:

[0007] PoRVA G4F:GCTCCTTTTAATGTATGGTATTG;

[0008] PoRVA G4R:ATTTATTCCATAATTTTGTGCATTAG;

[0009] PoRVA G4P:TTCGTTCTTGTGAGTTAYATTYTGAAAAC;

[0010] PoRVA G5F:GCTCCTTTTAATGTATGGTATTG;

[0011] PoRVA G5R: ATCCAGTTATTGGTAAATTAATTCC;

[0012] PoRVA G5P:ATAAAGTCATTGTTCTAGTHACTGATTT;

[0013] PoRVA G9F: GGCCAACTGGATCAGTYT;

[0014] PoRVAG9R:ACCATTCATTTAGAATCAAATCAGC;

[0015] PoRVA G9P: ATCGCTTCATTCTCAATTGAYCCACA.

[0016] Optionally, the 5′ end of the PoRVA G4P is modified with FAM, and the 3′ end is modified with BHQ1;

[0017] The PoRVA G5P is modified with CY5 at the 5′ end and BHQ2 at the 3′ end;

[0018] The 5′ end of the PoRVA G9P was modified with Texas red, and the 3′ end was modified with BHQ2.

[0019] The present invention also provides the use of the primer set in preparing a triple RT-qPCR kit for detecting group A porcine rotavirus G4, G5 and G9 strains.

[0020] The present invention also provides a triple RT-qPCR kit for detecting group A porcine rotavirus G4, G5 and G9 strains, comprising the primer set.

[0021] Optionally, the steps of the kit for detecting group A porcine rotavirus G4, G5 and G9 strains are as follows:

[0022] Using the RNA of the sample to be tested as a template, a triple RT-qPCR reaction was performed using the primer set, and the fluorescence signal was collected to obtain the Ct value of the sample to be tested.

[0023] Optionally, if the sample to be tested has no Ct value, it is negative, and it is determined that the sample to be tested does not contain group A porcine rotavirus G4, G5 and G9 strains; if the Ct value of the sample to be tested is greater than 35, it is determined to be suspicious and needs to be tested again;

[0024] If the Ct value of the sample to be tested is ≤35 and it is green fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain;

[0025] If the Ct value of the sample to be tested is ≤35 and it is red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G5 strain;

[0026] If the Ct value of the sample to be tested is ≤35 and it shows orange-red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G9 strain;

[0027] If the Ct value of the sample to be tested is ≤35 and there is green fluorescence and red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain and G5 strain;

[0028] If the Ct value of the sample to be tested is ≤35, and red fluorescence and orange-red fluorescence are present, it is determined that the sample to be tested contains group A porcine rotavirus G5 strain and G9 strain;

[0029] If the Ct value of the sample to be tested is ≤35, and green fluorescence, red fluorescence and orange-red fluorescence are present, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain, G5 strain and G9 strain.

[0030] Optionally, the reaction system of the triple RT-qPCR reaction is: 10 μL of reaction buffer, 0.4 μL of DNA polymerase, 0.4 μL of reverse transcriptase mixture, 0.8 μL of upstream and downstream primers, 0.3 μL of probes, 1.5 μL of RNase-free water and 2 μL of template RNA.

[0031] Optionally, the reaction program of the triple RT-qPCR reaction is: 42°C, 5 min, 95°C, 10 s; 95°C, 5 s, 48.2°C, 30 s, 40 cycles; 24°C, 30 s.

[0032] The present invention discloses the following technical effects:

[0033] The present invention designs three sets of specific primers and probes for the G4, G5, and G9 genotypes, optimizes the reaction system, and establishes a triple fluorescence PCR detection technology for the PoRVA G4, G5, and G9 genotypes. This technology accurately detects PoRVA and simultaneously identifies the G4, G5, and G9 genotypes within a single reaction (1-2 hours), significantly improving typing detection efficiency and effectively reducing detection costs. It allows for rapid screening of the main genotypes that cause diarrhea outbreaks and the genotypes that pose the greatest threat to pig herds, providing an efficient detection method for the precise monitoring of PoRVA G gene subtypes. The diagnostic method established by the present invention is used to test a large number of clinical samples, analyze the prevalence and dominant position of the G4, G5, and G9 genotypes in pig herds, and provide a reference for the subsequent development of targeted PoRV vaccines.

[0034] The present invention can simultaneously detect the G4, G5 and G9 genotypes of group A porcine rotavirus in one PCR reaction tube, and provides a simple, efficient and low-cost method for detecting the three genotypes.

[0035] The present invention provides a more sensitive and convenient technical support for the differential diagnosis of group A porcine rotavirus G4, G5, and G9 genotypes. Compared with conventional typing methods, it omits agarose nucleic acid electrophoresis, UV analysis, gel recovery, and sequencing steps. Compared with single-plex detection, it reduces the workload and greatly improves the efficiency of porcine rotavirus typing detection. At the same time, the detection sensitivity is significantly improved, effectively reducing the occurrence of false positives.

[0036] The present invention has good repeatability, specificity and sensitivity, and can simultaneously perform rapid and accurate clinical detection of the three genotypes of group A porcine rotavirus G4, G5, and G9, supporting the clinical differential diagnosis of the G4, G5, and G9 genotypes of group A porcine rotavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0038] Figure 1 This is the map of the p-G4 / 5 / 9-PoRVA recombinant plasmid;

[0039] Figure 2 This is the map of the p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA recombinant plasmid;

[0040] Figure 3 The triple RT-qPCR amplification curves obtained at different Tm values (48.2-60.1°C); A: G4 type; B: G5 type; C: G9 type;

[0041] Figure 4 Optimized amplification curves for the primer concentrations (AC), probe concentrations (DE) for single-plex qPCR reactions, and probe concentrations (GI) for triple-plex RT-qPCR reactions of PoRVA G4, G5, and G9.

[0042] Figure 5 Figure 1 is a graph of specific detection results; 1: G4 detection result of positive recombinant plasmid p-G4 / 5 / 9-PoRVA; 2: G5 detection result of positive recombinant plasmid p-G4 / 5 / 9-PoRVA; 3: G9 detection result of positive recombinant plasmid p-G4 / 5 / 9-PoRVA; 4: Porcine transmissible gastroenteritis virus (TGEV); 5: Porcine epidemic diarrhea virus (PEDV); 6: Pseudorabies virus (PRV); 7: Porcine deltacoronavirus nucleic acid (PDCoV); 8: Getafe virus (GETV); 9: Porcine blue ear virus (PRRSV) detection result; 10: Recombinant plasmid p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA of other genotypes of porcine rotavirus; 11: Negative control;

[0043] Figure 6 The amplification standard curve of triple RT-qPCR; A: G4 type; B: G5 type; C: G9 type;

[0044] Figure 7 The sensitivity test results of triple RT-qPCR using p-G4 / 5 / 9-PoRVA as template are shown in Figure 2. A: G4 type; B: G5 type; C: G9 type;

[0045] Figure 8 The sensitivity test results of triple RT-qPCR using G9-type PoRVA nucleic acid as template are shown in Figure 1-8. 1-8 represent the sensitivity test results of triple RT-qPCR using 3.76×4 0 ~3.76×4 -7 ng / μL G9-type PoRVA nucleic acid as template, 9 as negative control;

[0046] Figure 9 2×10 4 , 2×10 6 , 2×10 8 Repeatability test results using the copy-positive recombinant plasmid p-G4 / 5 / 9-PoRVA as a template; A: G4 type; B: G5 type; C: G9 type. DETAILED DESCRIPTION

[0047] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0048] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0049] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0050] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0051] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0052] Example 1

[0053] 1. Materials and Methods

[0054] 1. Test nucleic acid

[0055] The VP7 genes of porcine rotavirus G4, G5, and G9 types published in NCBI GenBank were aligned, and the corresponding three target gene segments were selected and concatenated into a large fragment (the nucleotide sequence is shown in SEQ ID NO.9). The fragment was sent to Shanghai Shenggong Biotechnology Co., Ltd. for synthesis of a triple positive recombinant plasmid named p-G4 / 5 / 9-PoRVA. The plasmid map is shown in Figure 1 .

[0056] Other nucleic acid templates: porcine transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), and Getafe virus (GRTV) were provided by the Swine Disease Research Laboratory, Institute of Animal Health, Guangdong Academy of Agricultural Sciences. Porcine deltacoronavirus (PDCoV) was purchased from a commercial vaccine on the market. The p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA recombinant plasmid was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The nucleotide sequence of p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA is shown in SEQ ID NO. 10, and its plasmid map is shown in Figure 2 .

[0057] SEQ ID NO.9 (p-G4 / 5 / 9-PoRVA nucleotide sequence):

[0058]

[0059] SEQ ID NO.10 (p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA nucleotide sequence):

[0060]

[0061] 2. Main reagents and instruments

[0062] One Step PrimeScript TM The RT-PCR Kit (Perfect Real Time) was purchased from TaKaRa, Cat No. RR064A. The reagents used in the present invention were of analytical grade or biochemical reagents. The experimental water met the specifications of first-grade water in GB / T6682. All reagents were packaged in containers free of nuclease contamination. The RT-qPCR instrument was a Tianlong Gentier 96R.

[0063] 3. Design and screening of primers and probes

[0064] Three pairs of specific primers and three specific probes were designed based on the VP7 gene sequences of porcine rotavirus genotypes G4, G5, and G9 published in GenBank. The primer and probe sequences are shown in Table 1. All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0065] Table 1 Triple RT-qPCR primer and probe sequences

[0066]

[0067] 4. Preparation of positive control

[0068] The positive control plasmid p-G4 / 5 / 9-PoRVA was synthesized by Sangon Biotech (Shanghai) Co., Ltd. After the sequencing results were aligned with the GenBank sequence, the plasmid was dissolved into 2×10 9 copies / μL.

[0069] 5. Viral nucleic acid extraction

[0070] According to the operating instructions of the viral nucleic acid extraction kit (Magen, R4410-03), the viral genomic nucleic acids of TGEV, PEDV, PRV, PDCoV, GETV, and PRRSV were extracted and used as templates.

[0071] 6. Optimization of triple RT-qPCR reaction conditions

[0072] Optimization of primer and probe concentrations for PoRVA G4, G5, and G9 single-plex qPCR: primers were set at 5 concentration gradients of 0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L, and probes were set at 5 concentration gradients of 0.1, 0.15, 0.2, 0.25, and 0.3 μmol / L, for a total of 25 primer and probe combinations. Single-plex qPCR amplification of G4, G5, and G9 genotypes was performed, with a concentration of 2×10 5The p-G4 / 5 / 9-PoRVA recombinant plasmid with 10 copies / μL was used as a template and pUC57 empty vector was used as a negative control to optimize the concentrations of primers and probes.

[0073] Optimization of triple RT-qPCR probe concentration: The primer concentration was kept at the optimal concentration after single-plex qPCR optimization, and 5 probe concentrations of 0.1, 0.15, 0.2, 0.25, and 0.3 μmol / L were set for triple RT-qPCR reaction. 5 The p-G4 / 5 / 9-PoRVA recombinant plasmid with 10 copies / μL was used as the template and the pUC57 empty vector was used as the negative control to optimize the concentration of triple RT-qPCR probes.

[0074] Amplification was performed using a seven-temperature gradient reaction system with annealing temperatures of 48.2°C, 49.9°C, 52°C, 54.2°C, 55.9°C, 58°C, and 60.1°C. The p-G4 / 5 / 9-PoRVA recombinant plasmid was used as a positive template and the pUC57 empty vector was used as a negative control. Amplification curves were generated and the annealing temperature was optimized. The optimized triplex RT-qPCR reaction system and reaction procedure are shown in Tables 2 and 3.

[0075] Table 2 Optimized triple RT-qPCR reaction system

[0076]

[0077]

[0078] Table 3 Optimized triple RT-qPCR reaction procedure

[0079]

[0080] Judgment criteria: If the sample to be tested has no Ct value, it is negative, and it is determined that the sample to be tested does not contain group A porcine rotavirus G4, G5 and G9 strains; if the Ct value of the sample to be tested is greater than 35, it is determined to be suspicious and needs to be tested again;

[0081] If the Ct value of the sample to be tested is ≤35 and it is green fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain;

[0082] If the Ct value of the sample to be tested is ≤35 and it is red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G5 strain;

[0083] If the Ct value of the sample to be tested is ≤35 and it shows orange-red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G9 strain;

[0084] If the Ct value of the sample to be tested is ≤35 and there is green fluorescence and red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain and G5 strain;

[0085] If the Ct value of the sample to be tested is ≤35, and red fluorescence and orange-red fluorescence are present, it is determined that the sample to be tested contains group A porcine rotavirus G5 strain and G9 strain;

[0086] If the Ct value of the sample to be tested is ≤35, and green fluorescence, red fluorescence and orange-red fluorescence are present, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain, G5 strain and G9 strain.

[0087] 7. Specificity detection

[0088] At a concentration of 2×10 5 The nucleic acids of recombinant plasmids p-G4 / 5 / 9-PoRVA, p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA and other common porcine viruses PEDV, TGEV, PRV, PRRSV, PDCoV, and GETV were used as templates. The optimized triple qPCR system was used for detection, and the pUC57 empty vector was set as a negative control to evaluate the specificity of the triple RT-qPCR detection method.

[0089] 8. Establishment of standard curve

[0090] The recombinant plasmid p-G4 / 5 / 9-PoRVA was used as the standard positive plasmid and diluted 10 times to obtain 2×10 8 ~2.19×10 3 Six dilutions of the recombinant plasmid, each containing 60 copies / μL, were used as standard templates. Three replicates were prepared for each template concentration. RT-qPCR amplification was performed according to the reaction system and protocol in Tables 2 and 3. Fluorescence amplification curves were obtained and used to construct standard curves. The amplification curves were used to determine the minimum copy number of the recombinant plasmid detected. Finally, a standard curve was constructed using the Ct value as the vertical axis and the logarithm of the copy number as the horizontal axis.

[0091] 9. Sensitivity test

[0092] p-G4 / 5 / 9-PoRVA recombinant plasmid was used as template: the recombinant plasmid p-G4 / 5 / 9-PoRVA was used as standard positive plasmid and diluted 10 times to obtain 2×10 8 ~2×10 0 The recombinant plasmid with 9 dilutions of 1×10 copies / μL was used as the standard template, and 3 parallel samples were made for each template concentration. 1 , 5×10 1 , 1×10 2 , 2×102 The final detection limit was determined at four concentrations (10 replicates / μL). Ten replicates were prepared for each concentration. The lowest concentration with a Ct ≤ 35 in nine or more replicates was determined as the detection limit for the triplex RT-qPCR assay. Triplex RT-qPCR amplification was performed according to the reaction system and procedure in Tables 2 and 3 to evaluate the sensitivity of the reaction system.

[0093] G9-type PoRVA nucleic acid was used as template: the initial concentration of 3.76 ng / μL G9-type PoRVA nucleic acid was diluted 4-fold to obtain 3.76-3.76×4 -7 ng / μL with a total of 8 dilutions were used as templates for triple RT-qPCR amplification to evaluate the sensitivity of the system.

[0094] 10. Repeatability test

[0095] Repeated test within the batch: 2×10 8 , 2×10 6 , 2×10 4 The positive plasmid p-G4 / 5 / 9-PoRVA with 200 copies / μL was used as template for triple RT-qPCR test, and the same batch was tested 6 times. 8 , 2×10 6 , 2×10 4 A triplex RT-qPCR assay was performed using the standard plasmid p-G4 / 5 / 9-PoRVA at 100 copies / μL as a template. Six batches were run, with 24-hour intervals between each run. Empty pUC57 vector served as a negative control. The Ct values of the repeatability tests were statistically analyzed, and the mean Ct value, standard deviation, and coefficient of variation were calculated for each concentration to assess the repeatability of the triplex RT-qPCR assay.

[0096] 11. Testing of clinical samples

[0097] Between 2023 and 2025, a total of 109 diarrheal samples and 5 laboratory virus cultures were collected from various pig farms in Guangdong Province. The nucleic acids were extracted as templates to be tested and detected simultaneously using three methods: RT-PCR based on the VP7 gene (primers, reaction system and reaction procedure are shown in Tables 4-6), RT-qPCR based on the RVA NSP5 gene (primers, reaction system and reaction procedure are shown in Tables 7-9), and the PoRVA G4, G5 and G9 triple RT-qPCR method established in the present invention.

[0098] Table 4 RT-PCR primers based on VP7 gene

[0099]

[0100] Table 5 RT-PCR reaction system based on VP7 gene

[0101]

[0102]

[0103] Table 6 RT-PCR reaction procedure based on VP7 gene

[0104]

[0105] Table 7 RT-qPCR primers based on RVA NSP5 gene

[0106]

[0107] Table 8 RT-qPCR reaction system based on RVANSP5 gene

[0108]

[0109] Table 9 RT-qPCR reaction procedures based on RVA NSP5 gene

[0110]

[0111]

[0112] 2. Results and Analysis

[0113] 1. Reaction condition optimization results

[0114] By comparing the Ct values of the amplification curves at different annealing temperatures, the results are as follows: Figure 1 As shown in the figure, the VP7 gene amplification effect of group A porcine rotavirus G4, G5 and G9 is the best at 48.2℃. Therefore, the annealing temperature of 48.2℃ is the optimal annealing temperature for triple RT-qPCR of PoRVA G4, G5 and G9. The amplification curve was obtained by amplifying the reaction system of 0.1, 0.2, 0.3, 0.4 and 0.5μmol / L upstream and downstream primers, and the concentration of upstream and downstream primers was optimized. The results are shown in the figure. Figure 2 As shown, when the concentrations of the upstream and downstream primers PoRVA G4, G5, and G9 were all 0.4 μmol / L, and the probe concentration was 0.15 μmol / L, the amplification efficiency of the p-G4 / 5 / 9-PoRVA positive control plasmid was the highest and the Ct value was the lowest. Therefore, the optimal concentrations of the upstream and downstream primers PoRVA G4, G5, and G9 were all 0.4 μmol / L, and the optimal concentration of the probe was 0.15 μmol / L.

[0115] 2. Specificity test results

[0116] RT-qPCR was performed simultaneously on the genomes of TGEV, PEDV, PRV, PDCoV, GETV, and PRRSV, as well as the recombinant plasmids of p-G1 / 2 / 3 / 11 / 12 / 26-PoRVA and p-G4 / 5 / 9-PoRVA. The results were as follows: Figure 3 As shown in the figure, only the p-G4 / 5 / 9-PoRVA positive recombinant plasmid can produce a specific fluorescence curve, while the others are negative, which proves that this method has good specificity.

[0117] 3. Establishment of standard curve

[0118] The p-G4 / 5 / 9-PoRVA positive control plasmid was diluted 10-fold to 2 × 10 3 ~2×10 8 A total of 6 dilutions of copies / μL were used for triple RT-qPCR amplification, and the amplification curves were obtained, as shown in Figure 4 As shown, the concentration of the standard curve is 2×10 3 ~2×10 8 PoRVA G4, G5, and G9 showed good correlation within the copies / μL range, and the linear equations were PoRVA G4: y = -3.418x + 39.73, R 2 =0.9980; PoRVA G5: y=-3.455x+38.96, R 2 =0.9966; PoRVA G9: y=-3.487x+40.22, R 2 =0.9979.

[0119] 4. Sensitivity test results

[0120] The p-G4 / 5 / 9-PoRVA positive control plasmid was diluted 10-fold to 2 × 10 0 ~2×10 8 The amplification curves of each gene showed a typical S-shaped pattern, with uniform spacing between the curves (see Figure 5 ). The concentration is 2×10 2 Among the 10 replicates with a Ct ≤ 35, the number of replicates with Ct ≤ 35 was 9 / 10 for G4, 9 / 10 for G5, and 10 / 10 for G9. The number of replicates with Ct ≤ 35 for the remaining concentrations was less than 9 (Table 10). The minimum detection limit for the VP7 gene of group A porcine rotavirus G4, G5, and G9 was 100-200 copies.

[0121] 3.76~3.76×4 -7ng / μL, a total of 8 concentrations of G9-type PoRVA nucleic acid were used as templates for triple RT-qPCR amplification. The results showed that when the nucleic acid concentration was 3.76×4 -6 ng / μL, the test result is positive, and the nucleic acid concentration is 3.76×4 -7 ng / μL is a negative test result ( Figure 6 ). Combined with the differences in the sensitivity of the three genotypes in detecting plasmids, the sensitivity of the triple RT-qPCR established in the present invention for detecting G4, G5 and G9 type PoRVA is 3.76×4 -6 ng / μL.

[0122] Table 10 Determination of the minimum detection limit of triple RT-qPCR

[0123] Concentration (copies / uL) <![CDATA[1×10 1 ]]> <![CDATA[5×10 1 ]]> <![CDATA[1×10 2 ]]> <![CDATA[2×10 2 ]]> G4(FAM) 0 / 10 1 / 10 1 / 10 9 / 10 G5(Cy5) 0 / 10 1 / 10 7 / 10 9 / 10 G9 (Texas Red) 0 / 10 1 / 10 7 / 10 10 / 10

[0124] 5. Repeatability test results

[0125] like Figure 7 As shown in the figure, the detection results of three repetitive amplification curves of PoRV G4, G5 and G9 were basically consistent, and the corresponding fluorescence curves could be observed at the same position. The coefficient of variation of the intra-batch repetitive test was ≤1.25%, and the coefficient of variation of the inter-batch repetitive test was ≤2.13%, indicating that the nucleic acid probe RT-qPCR method had good reproducibility.

[0126] 6. Testing of clinical samples

[0127] The triple RT-qPCR method established by the present invention and the RT-qPCR method based on the RVA NSP5 gene (primers, reaction system and reaction procedure are shown in Tables 7-9) were used to detect diarrhea samples collected from various pig farms in Guangdong Province from 2023 to 2025 and diarrhea samples of pigs tested in this laboratory, totaling 109 and 5 cell samples. The results are shown in Tables 11 and 12. The triple RT-qPCR test detected 46 positive samples and 68 negative samples, and the total positive rate of PoRVA G4, G5 and G9 types was 40.35% (46 / 114). Among the positive samples, the number of G9 type was the largest (24 / 46), followed by G4 type (18 / 46), and the least was G5 type (1 / 46). There were 2 samples of G4+G9 type dual infection, 1 sample of G5+G9 type dual infection, and no triple infection sample was detected. Forty-one samples tested positive by singleplex RT-qPCR, with a positive rate of 35.96% (41 / 114), and a concordance rate of 92.98% with the tripleplex RT-qPCR results. Sample 18 tested negative by tripleplex RT-qPCR but positive by singleplex qPCR, and was identified as G3 by sequencing. Except for some samples with high Ct values that failed sequencing, the concordance rate between the tripleplex RT-qPCR typing results and the sequencing results for the remaining 26 positive samples was 100%.

[0128] Table 11 Triple RT-qPCR and single qPCR clinical sample detection results

[0129]

[0130] Table 12 Number of positive results for each genotype in clinical samples

[0131]

[0132] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A triple RT-qPCR primer set for detecting group A porcine rotavirus G4, G5, and G9 strains, characterized in that: The primer set includes the following primers and probes: PoRVA G4F:GCTCCTTTTAATGTATGGTATTG; PoRVA G4R:ATTTATTCCATAATTTTGTGCATTAG; PoRVA G4P:TTCGTTCTTGTGAGTTAYATTYTGAAAAC; PoRVA G5F:GCTCCTTTTAATGTATGGTATTG; PoRVA G5R: ATCCAGTTATTGGTAAATTAATTCC; PoRVA G5P:ATAAAGTCATTGTTCTAGTHACTGATTT; PoRVA G9F: GGCCAACTGGATCAGTYT; PoRVA G9R:ACCATTCATTTAGAATCAAATCAGC; PoRVA G9P: ATCGCTTCATTCTCAATTGAYCCACA.

2. The primer set according to claim 1, wherein The PoRVA G4P is modified with FAM at the 5′ end and BHQ1 at the 3′ end; The PoRVA G5P is modified with CY5 at the 5′ end and BHQ2 at the 3′ end; The 5′ end of the PoRVA G9P was modified with Texas red, and the 3′ end was modified with BHQ2.

3. Use of the primer set according to claim 1 or 2 in the preparation of a triple RT-qPCR kit for detecting group A porcine rotavirus G4, G5 and G9 strains.

4. A triple RT-qPCR kit for detecting group A porcine rotavirus G4, G5 and G9 strains, characterized in that: Comprising the primer set according to claim 1 or 2.

5. The kit according to claim 4, wherein The steps of the kit for detecting group A porcine rotavirus G4, G5 and G9 strains are as follows: Using the RNA of the sample to be tested as a template, a triple RT-qPCR reaction is performed using the primer set described in claim 1 or 2, and the fluorescent signal is collected to obtain the Ct value of the sample to be tested.

6. The kit according to claim 5, wherein If the sample to be tested has no Ct value, it is negative, and it is determined that the sample to be tested does not contain group A porcine rotavirus G4, G5 and G9 strains; if the Ct value of the sample to be tested is greater than 35, it is determined to be suspicious and needs to be tested again; If the Ct value of the sample to be tested is ≤35 and it is green fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain; If the Ct value of the sample to be tested is ≤35 and it is red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G5 strain; If the Ct value of the sample to be tested is ≤35 and it shows orange-red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G9 strain; If the Ct value of the sample to be tested is ≤35 and there is green fluorescence and red fluorescence, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain and G5 strain; If the Ct value of the sample to be tested is ≤35, and red fluorescence and orange-red fluorescence are present, it is determined that the sample to be tested contains group A porcine rotavirus G5 strain and G9 strain; If the Ct value of the sample to be tested is ≤35, and green fluorescence, red fluorescence and orange-red fluorescence are present, it is determined that the sample to be tested contains group A porcine rotavirus G4 strain, G5 strain and G9 strain.

7. The kit according to claim 5, wherein The reaction system of the triple RT-qPCR reaction was: 10 μL of reaction buffer, 0.4 μL of DNA polymerase, 0.4 μL of reverse transcriptase mixture, 0.8 μL of upstream and downstream primers, 0.3 μL of probes, 1.5 μL of RNase-free water, and 2 μL of template RNA.

8. The kit according to claim 5, wherein The reaction program of the triple RT-qPCR reaction was: 42°C, 5 min, 95°C, 10 s; 95°C, 5 s, 48.2°C, 30 s, 40 cycles; 24°C, 30 s.

Citation Information

Patent Citations

  • New method for rapid detection of G genotype of group A rotavirus by VP7 gene

    CN102226221A

  • PCR (Polymerase Chain Reaction) primer for detecting G9 type wild strain and G5 type vaccine strain of porcine rotavirus as well as detection method and kit

    CN113215309A

  • RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer for identifying porcine rotavirus G4, G5 and G9 type strains and detection method thereof

    CN117778622A

  • PCR (Polymerase Chain Reaction) primer and typing detection method for various porcine rotavirus subtypes

    CN118086588A

  • Primer probe composition and kit for detecting group A rotavirus and application of primer probe composition and kit

    CN118147374A