Primer probe, kit and detection method for detecting EB (Epstein-Barr) virus DNA (Deoxyribose Nucleic Acid)
By developing primers, probes, and kits for EB virus DNA and combining them with qPCR, the accuracy and specificity issues of EB virus detection in existing technologies have been resolved, achieving efficient and stable EB virus DNA detection.
Patent Information
- Application Number
- CN202510736445.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-08-15
AI Technical Summary
Existing EBV detection methods suffer from long culture times and low positivity rates, and serological tests cannot accurately reflect the replication status of EBV infection in the body.
A kit comprising forward primers, reverse primers, and fluorescent probes has been developed for the detection of EB virus DNA via qPCR. The primers and probes are specifically labeled with reporter fluorescent groups and quenching groups, and combined with internal references and quality control products, to achieve high accuracy and specificity in detection.
It achieves high accuracy, specificity and repeatability in the detection of EB virus DNA, can track and quantify the presence of EB virus DNA in samples, has strong applicability, and provides stable and sensitive detection results.
Smart Images
Figure CN120485440A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of virus detection, and specifically relates to a primer probe, a kit and a detection method for detecting Epstein-Barr virus DNA. Background Art
[0002] Epstein-Barr virus (EBV) is a widely disseminated herpesvirus that is transmitted through close contact between susceptible individuals and asymptomatic EBV shedders. EBV is the primary etiologic agent of infectious mononucleosis. Almost all adults with EBV are infected lifelong but remain asymptomatic, though some develop B-cell and T-cell lymphomas, Hodgkin lymphoma, nasopharyngeal carcinoma, and gastric cancer. Most primary EBV infections worldwide are subclinical. The two main EBV antibodies are detectable in all populations worldwide. While 90%-95% of adults are seropositive for EBV antibodies, studies suggest that primary EBV infection may develop later in childhood in developed countries.
[0003] Currently, the main laboratory detection method for EBV is viral culture, but this method has problems such as long incubation times and low positive rates. Serological testing and immunohistochemistry can effectively diagnose EBV infection, but they can only serve as indicators of past viral infection and cannot accurately reflect the replication of EBV infection in the body. Therefore, there is a lack of a TaqMan-qPCR method with high accuracy, strong specificity, and good reproducibility, as well as corresponding primers, probes, and kits. Summary of the Invention
[0004] The technical solution provided by the present invention is: A primer probe for detecting EB virus DNA of the present invention comprises Forward primer: CTACGCTGCCCTAGAGGTTT, as shown in SEQ ID NO. 1; Reverse primer: AGACAACCACAGACACCGTC, as shown in SEQ ID NO. 2; Fluorescent probe: AGGAGACGTGTGTGGCTGTAGC, as shown in SEQ ID NO. 3. The 5' end of the fluorescent probe is labeled with a reporter fluorescent group FAM, and the 3' end is labeled with a quencher group NFQ-MGB.
[0005] A kit for detecting Epstein-Barr virus DNA, comprising the forward primer, reverse primer and fluorescent probe according to claim 1.
[0006] Preferably, it also includes Internal reference IC, qPCR reaction solution, ROX, nuclease-free high-purity water, positive quality control and negative quality control.
[0007] Preferably, the positive quality control product is a plasmid standard product having the target fragment; the negative quality control product is EB virus negative cell genomic DNA or RNase / DNase-free water.
[0008] A qPCR detection method for a kit for detecting Epstein-Barr virus DNA, for non-disease diagnosis and treatment applications, using the above-mentioned kit, the detection method comprises: S1. Extract sample genomic DNA; S2, determine the reaction system and add sample; S3, qPCR program file settings; S4, qPCR standard amplification program settings; S5. Analysis of test results.
[0009] Preferably, the step S1 specifically comprises taking a sample to be tested, a positive control substance, and a negative control substance, and extracting genomic DNA according to the steps of a DNA extraction kit.
[0010] Preferably, step S2 is specifically to prepare a standard curve by mixing EBV DNA plasmid standard with EBV-negative cell genomic DNA, and adding samples according to the following reaction system: .
[0011] Preferably, step S4 includes setting the reaction volume to 20 μL, and the amplification cycle conditions and fluorescence acquisition settings are as follows: .
[0012] Compared with the prior art, the technical solution provided by the present invention has the following beneficial effects: The present invention discloses a primer probe, a kit, and a detection method for detecting Epstein-Barr virus DNA. The primer probe includes a forward primer (CTACGCTGCCCTAGAGGTTT); a reverse primer (AGACAACCACAGACACCGTC); and a fluorescent probe (AGGAGACGTGTGTGGCTGTAGC). The fluorescent probe is labeled with a reporter fluorescent group (FAM) at its 5' end and a quencher group (NFQ-MGB) at its 3' end. The kit includes the primer probe, and the qPCR detection method employed in the kit can track and quantitatively detect Epstein-Barr virus DNA in a sample, demonstrating advantages such as high accuracy, strong specificity, and good reproducibility. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 Flow chart of the detection method of the kit of Example 1; Figure 2 is the primer / probe specific amplification curve of Example 1; Figure 3 The primer / probe specificity standard curve of Example 1 is shown; Figure 4 Figure 1 is a diagram of amplification curves for precision and accuracy verification obtained using the kit and method of Example 1; Figure 5 Figure 1 is a specific amplification curve obtained using the kit and method of Example 1; Figure 6 FIG1 is an illustration of the suitability amplification curve obtained using the kit and method of Example 1; Figure 7 Figure 1 is a diagram of a stability amplification curve obtained using the kit and method of Example 1; Figure 8 Attached is a detection limit amplification curve obtained using the kit and method of Example 1. DETAILED DESCRIPTION
[0014] In order to enable those skilled in the art to better understand the present invention, the following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of this application.
[0015] It should be noted that the terms "first", "second", etc. in the specification and claims of the present application and the above-mentioned drawings are used to distinguish similar objects and are not necessarily used to describe a specific order or sequential order. It should be understood that the data used in this way can be interchanged where appropriate, so that the embodiments of the present application described here. In addition, the terms "including" and "having" and any of their variations are intended to cover non-exclusive inclusions. For example, a process, method, system, product or device that includes a series of steps or units is not necessarily limited to those steps or units clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or devices.
[0016] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments in this application can be combined with each other. The present application will be described in detail below with reference to the accompanying drawings and in conjunction with Example 1.
[0017] Refer to the attached Figure 1 、 2 3. A primer probe for detecting EB virus DNA in this embodiment comprises Forward primer: CTACGCTGCCCTAGAGGTTT, as shown in SEQ ID NO. 1; Reverse primer: AGACAACCACAGACACCGTC, as shown in SEQ ID NO. 2; Fluorescent probe: AGGAGACGTGTGTGGCTGTAGC, as shown in SEQ ID NO. 3; the 5' end of the fluorescent probe is labeled with a reporter fluorescent group FAM, and the 3' end is labeled with a quencher group NFQ-MGB.
[0018] A kit for detecting Epstein-Barr virus DNA comprises the aforementioned forward primer, reverse primer and fluorescent probe.
[0019] Also includes Internal reference IC, qPCR reaction solution, ROX, nuclease-free high-purity water, positive quality control and negative quality control.
[0020] The positive quality control product is a plasmid standard with the target fragment; the negative quality control product is EB virus negative cell genomic DNA or RNase / DNase-free water.
[0021] The qPCR detection method of the above-mentioned kit for detecting EB virus DNA is used for non-disease diagnosis and treatment applications, comprising the following steps: S1. Extract sample genomic DNA; S2, determine the reaction system and add sample; S3, qPCR program file settings; S4, qPCR standard amplification program settings; S5. Analysis of test results.
[0022] The step S1 specifically comprises taking the sample to be tested, the positive control substance, and the negative control substance, and extracting genomic DNA according to the steps of DNA extraction reagent (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., product number DP304).
[0023] Specifically, step S2 uses the genomic DNA obtained in step S1 as a template and mixes it with the genomic DNA of K562 cells to prepare a standard curve. The standard curve contains 6 detection points, and the EB virus DNA is diluted in a concentration gradient. In the precision and accuracy samples, the EB virus DNA is diluted to 1.500E+06cp / 5μL, 1.200E+06cp / 5μL, 1.500E+04cp / 5μL, 7.500E+01cp / 5μL, and 1.500E+01cp / 5μL, respectively.
[0024] Add samples according to the following reaction system: .
[0025] Specifically, step S3 involves using an Applied Biosystems ABI 7500 Real-Time PCR instrument. Under "Plate Setup," in "Define Targets and Samples," create a Target 1 channel (FAM), select FAM as the reporter fluorophore, and NFQ-MGB as the quencher fluorophore. Create a Target 2 channel (Cy5), select Cy5 as the reporter fluorophore, and NFQ-MGB as the quencher fluorophore. Under "Plate Setup," in "Assign Targets and Samples," select "ROX."
[0026] Step S4 includes setting the reaction volume to 20 μL, and the amplification cycle conditions and fluorescence acquisition settings are as follows: .
[0027] Specifically, step S5 is as follows: after the concentrations of the standard curve (at least 6 points) are regressed to a linear equation, R2 ≥ 0.99; and the accuracy (RE%) of each concentration point is -75% to 150%. The sample result determination method is as follows:
[0028] Set the fluorescence threshold (threshold value) during the exponential growth phase; retest the gray zone samples: re-extract the nucleic acid from the samples and retest. If the retest result is 35≤Ct<40 and there is an obvious amplification curve, it is judged as positive, otherwise it is negative.
[0029] Figure 2 This is the EB virus DNA primer / probe specific amplification curve. Figure 3 is the standard curve (where R2≥0.99), Figure 2 There are 6 concentration gradients in total. The amplification curves from left to right are 1.500E+06cp / 5μL, 1.500E+05cp / 5μL, 1.500E+04cp / 5μL, 1.500E+03cp / 5μL, 1.500E+02cp / 5μL, and 1.500E+01cp / 5μL. Figure 2 and Figure 3 It can be seen that the correlation is good.
[0030] Figure 4The attached figure is the amplification curve for precision and accuracy verification. Specifically, EB virus DNA was prepared to five verification samples with concentrations of LLOQ, LQC, MQC, HQC, and ULOQ. The intra-batch and inter-batch precision and accuracy of samples with different concentrations met the acceptance criteria. The RE% values of LLOQ and LQC were between -75% and 150%, and the CV% values were less than or equal to 70%; while the RE% values of HQC, MQC, and ULOQ were between -75% and 150%, and the CV% values were less than or equal to 60%.
[0031] Figure 5 This is a specific expansion curve obtained by adding equal volumes of EBV DNA and RNase / DNase-free water to the genomic DNA of EBV-negative cells. The group with only EBV DNA added can detect signals within the quantitative range.
[0032] Figure 6 Amplification curves were generated for the suitability of EBV DNA diluted to MQC sample (1.500E+04 cp / 5 μL) using different matrices (K562 genomic DNA, iPS-NK genomic DNA, MSC genomic DNA, and DNase / RNase-free water). The results showed that the accuracy of this detection method was not affected by the dilution matrix.
[0033] Figure 7 The figure is a diagram of the stability amplification curve. Specifically, K562 cell genomic DNA (20.000 ng / μL) was used as a diluent to dilute EB virus DNA into MQC samples, which were tested immediately and after being placed at 4°C for 24 hours. EB virus DNA samples of the same concentration were also tested immediately. The results showed that within the measured time of 0h and 24h, EB virus DNA was stable in the K562 cell genomic DNA.
[0034] Figure 8 This is the attached figure of the detection limit amplification curve. Specifically, the LLOQ sample (1.500E+01cp / 5μL) was diluted to 7.5cp / 5μL, and the test was repeated 20 times. The detection rate was 100%. The lowest concentration of the standard sample that can be detected by this method is 7.500E+00cp / 5μL.
[0035] The above-mentioned embodiments only express a certain implementation method of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the patent scope of the present invention. It should be pointed out that for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent of the present invention shall be based on the attached claims.
Claims
1. A primer probe for detecting Epstein-Barr virus DNA, characterized in that: include Forward primer: CTACGCTGCCCTAGAGGTTT, as shown in SEQ ID NO. 1; Reverse primer: AGACAACCACAGACACCGTC, as shown in SEQ ID NO. 2; Fluorescent probe: AGGAGACGTGTGTGGCTGTAGC, as shown in SEQ ID NO.
3. The 5' end of the fluorescent probe is labeled with a reporter fluorescent group FAM, and the 3' end is labeled with a quencher group NFQ-MGB.
2. A kit for detecting Epstein-Barr virus DNA, characterized in that: The method comprises the forward primer, reverse primer and fluorescent probe according to claim 1.
3. A kit for detecting Epstein-Barr virus DNA according to claim 2, characterized in that: Also includes Internal reference IC, qPCR reaction solution, ROX, nuclease-free high-purity water, positive quality control and negative quality control.
4. A kit for detecting Epstein-Barr virus DNA according to claim 3, characterized in that: The positive quality control product is a plasmid standard with the target fragment; the negative quality control product is EB virus negative cell genomic DNA or RNase / DNase-free water.
5. A qPCR detection method for a kit for detecting Epstein-Barr virus DNA, for non-disease diagnosis and treatment applications, characterized by: Using the kit according to any one of claims 2 to 4, the detection method comprises: S1. Extract sample genomic DNA; S2, determine the reaction system and add sample; S3, qPCR program file settings; S4, qPCR standard amplification program settings; S5. Analysis of test results.
6. The qPCR detection method of a kit for detecting Epstein-Barr virus DNA according to claim 5, characterized in that: The step S1 specifically comprises taking the sample to be tested, the positive control substance, and the negative control substance, and extracting genomic DNA according to the steps of the DNA extraction kit.
7. The qPCR detection method of a kit for detecting Epstein-Barr virus DNA according to claim 6, characterized in that: The step S2 specifically comprises preparing a standard curve by mixing EBV DNA plasmid standard with EBV-negative cell genomic DNA, and adding samples according to the following reaction system: 。 8. The qPCR detection method of a kit for detecting Epstein-Barr virus DNA according to claim 7, characterized in that: Step S4 includes setting the reaction volume to 20 μL, and the amplification cycle conditions and fluorescence acquisition settings are as follows: 。