Self-assembling lipid nanoparticles for targeted delivery of therapeutic agents

Abstract

The present invention provides a delivery system composition comprising self-assembling lipid nanoparticles for targeted delivery of a therapeutic or diagnostic agent to a target cell. The nanoparticle is non-covalently linked to a lipidated antibody or antibody fragment, said antibody or antibody fragment comprising an antibody or antibody fragment linked to a lipidated peptide moiety via a peptide linker, where said antibody or antibody fragment is located distal to the nanoparticle.

Description

[0001] Related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 423,069, filed on November 7, 2022, the contents of which are incorporated herein by reference in their entirety.

[0003] Sequence Listing Statement

[0004] An XML file named 97717SequenceListing.xml, created on November 7, 2023, filed concurrently with this disclosure, comprises 377,564 bytes and is incorporated herein by reference. Technical Field

[0005] The present invention relates to self-assembling lipid nanoparticles for targeted delivery of nucleic acids, proteins and drugs. The present invention also relates to methods of using the self-assembling lipid nanoparticles, in particular methods of using the self-assembling lipid nanoparticles in RNA therapy. Background Art

[0006] In the field of nanomedicine, lipid nanoparticles (LNPs) are becoming increasingly popular as a means of delivering various active agents, including nucleic acids such as siRNA and mRNA. The FDA recently approved the first RNAi-based drug, Onpattro TM (Patisiran), and the recent deployment of RNA vaccines during the COVID-19 pandemic are examples of the use of LNPs in RNA therapeutics.

[0007] Targeted drug carriers, such as immunoliposomes or immunolipid-based nanoparticles (targeted LNPs, tLNPs), are typically constructed by chemically coupling the targeting moiety to a drug (or nucleic acid) delivery system. This process requires a large amount of antibody for each coupling, and since coupling can have a deleterious effect on the function of the antibody, adjustments need to be made when using different antibodies. In addition, chemical coupling causes the targeting antibody to be inserted in a random direction. Therefore, a portion of the antibody is usually coupled, resulting in its Fc segment being exposed to the surrounding environment, with the risk of immunogenicity and phagocytosis by phagocytes.

[0008] To overcome these limitations, a new strategy for preparing antibody-targeted LNPs in a directed manner has been proposed. This strategy, known as ASSET (anchoring secondary scFv to achieve targeting), is a self-assembling modular platform that can construct targeted nanocarriers without any coupling chemistry. The self-assembly of this platform is based on membrane-anchored, lipidated single-chain antibody fragments (scFv) derived from a second antibody, which are incorporated into lipid nanoparticles loaded with therapeutic drugs. These particles then interact with the crystallizable fragment (Fc) domain of the first antibody to form a stable complex that specifically binds to target cells expressing the target of the first antibody on their surface through the first antibody (Kedmi et al., Nat. Nanotechnol. 13(3):214-219, 2018; WO 2018 / 015881). The ASSET platform has successfully demonstrated its therapeutic potential, capable of delivering siRNA, mRNA, and gRNA to target cells and affecting phenotypic changes in cells (Veiga et al., Nature Comm. 9:4493, 2018; Veiga et al., JCR 313:33-41, 2019, Rosenblum et al., Sci. Adv. 6:eabc9450, 2020).

[0009] There is still a need for additional delivery platforms to deliver therapeutic agents to target cells. Summary of the Invention

[0010] The present invention provides a delivery system composition called lipidated antibody nanoparticle delivery (i.e., LAND) and its use for delivering therapeutic agents (such as nucleic acids) to target cells. The delivery system utilizes antibodies as cell targeting moieties. The antibodies are anchored to lipid-based nanoparticles via lipidated peptide moieties and peptide linkers containing at least 40 amino acids, which gives them an unexpected advantage in effectively binding to target cells. In some embodiments, the linker is a combination of a functional protein, a linker, and a spacer sequence. The system of the present invention overcomes the limitations of previous compositions and methods and represents a major development in precision medicine.

[0011] The present invention is based in part on the unexpected discovery that better target cell transduction efficiency can be achieved by extending the distance between the lipid nanoparticle and the antibody using a linker (e.g., a linker containing at least 40 amino acids). Specifically, the LAND platform based on the principles of the present invention has been shown to be able to transduce target cells to a greater extent than the ASSET platform compared to ASSET. It is generally believed that scFv antibodies with a single antigen binding site have lower binding efficiency compared to intact IgG antibodies with two antigen binding sites. Surprisingly, LAND constructs incorporating primary scFv antibody targeting with a single antigen binding site showed significantly enhanced therapeutic efficacy compared to primary IgG antibody targeting via ASSET containing two antigen binding sites. Therefore, the self-assembling modular platform of the present invention is capable of constructing a variety of targeted nanocarriers, particularly suitable for RNA therapy.

[0012] According to one aspect, a delivery system composition for delivering a therapeutic agent to a target cell is provided, wherein the delivery system comprises a lipid nanoparticle, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker and a lipidated antibody or a fragment thereof, wherein the linker is fused to the lipidated antibody or a fragment thereof, and the fusion protein is non-covalently linked to the lipid nanoparticle by the anchoring lipid such that the lipidated antibody or a fragment thereof is located at the distal end of the nanoparticle. In one embodiment, the linker comprises a peptide or protein having at least 40 amino acid residues.

[0013] According to another aspect, there is provided a composition for delivering a therapeutic agent or a diagnostic agent to a target cell, comprising:

[0014] Lipid nanoparticles encapsulating therapeutic or diagnostic agents,

[0015] a first antibody, non-covalently linked to the lipid nanoparticle via a lipidated peptide moiety,

[0016] A peptide linker is directly attached to the first antibody at one end of the linker, and the lipidated peptide portion is attached to the other end of the linker, wherein the antibody or antibody fragment is located at the distal end of the nanoparticle and binds to the target antigen on the target cell.

[0017] According to another aspect, a delivery system composition for delivering a therapeutic agent or a diagnostic agent to a target cell is provided, wherein the delivery system comprises:

[0018] A lipidated antibody comprising an antibody linked to a lipidated peptide moiety via a peptide linker, wherein the peptide linker comprises at least 40 amino acid residues; and

[0019] a lipid nanoparticle comprising said therapeutic or diagnostic agent,

[0020] wherein the lipidated antibody is non-covalently linked to the lipid nanoparticle via the lipidated peptide moiety.

[0021] According to another aspect, a method of delivering a therapeutic or diagnostic agent to a subject in need thereof is provided, the method comprising administering to the subject a composition or delivery system described herein, thereby delivering the therapeutic or diagnostic agent to the subject.

[0022] According to another aspect, there is provided a method of treating a medical condition in a subject in need thereof, the method comprising the step of administering to the subject a therapeutically effective amount of a composition or delivery system described herein, wherein the agent is a therapeutic agent, thereby treating the medical condition.

[0023] According to yet another aspect, a method of diagnosing a medical condition in a subject is provided, comprising administering to the subject an effective amount of a composition or delivery system described herein, wherein the agent is a diagnostic agent, thereby diagnosing the medical condition.

[0024] According to another aspect, there is provided use of a composition or delivery system described herein for diagnosing or treating a medical condition.

[0025] According to an embodiment of the present invention, the lipidated peptide portion comprises an inner membrane lipidation signal.

[0026] According to an embodiment of the present invention, the lipidated peptide portion of the antibody includes the first two amino acids encoded by the Escherichia coli NlpA gene or the first six amino acids encoded by the Escherichia coli NlpA gene.

[0027] According to an embodiment of the present invention, the lipidated peptide portion of the antibody is contained in an inner membrane lipoprotein or a fragment thereof, and the inner membrane lipoprotein or a fragment thereof is selected from the group consisting of: AraH, MglC, MalF, MalG, Mal C, MalD, RbsC, RbsC, ArtM, ArtQ, GliP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E, Dpp B, DppC, OppB, AmiC, AmiD, BtuC, FhuB, FecC, FecD, FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, P stC, PotB, PotC, PotH, PotI, ModB, NosY, PhnM, LacY, SecY, TolC, Dsb,B, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB and Aas.

[0028] According to an embodiment of the present invention, the peptide linker comprises 40 to 400 amino acid residues.

[0029] According to an embodiment of the present invention, the peptide linker comprises 40 to 300 amino acid residues.

[0030] According to an embodiment of the present invention, at least 30% of the amino acid residues of the peptide linker are glycine or serine.

[0031] In one embodiment, the linker comprises a peptide or protein having 40 to 400 amino acid residues, including each integer within the specified range. In another embodiment, the linker comprises a peptide or protein having 40 to 300 amino acid residues, including each integer within the specified range. In yet another embodiment, the linker comprises a peptide or protein having 40 to 200 amino acid residues, including each integer within the specified range. In a further embodiment, the linker comprises a peptide or protein having 40 to 100 amino acid residues, including each integer within the specified range. In a specific embodiment, the linker comprises a peptide having the sequence shown in SEQ ID No.11. In another specific embodiment, the linker comprises a peptide having the sequence shown in SEQ ID No.12.

[0032] In some embodiments, the antibody or fragment thereof is a primary antibody or primary antibody fragment comprising an antigen recognition domain capable of binding to an antigen expressed by a target cell. In other embodiments, the antibody or fragment thereof is a humanized or human primary antibody or antibody fragment, a chimeric antibody, or a nanobody, collectively referred to as a primary antibody or antibody fragment. In specific embodiments, the primary antibody or primary antibody fragment is selected from the group consisting of anti-CD44, anti-CD34, anti-CD38, anti-Ly6C, anti-CD3, anti-CD4, anti-CD8, anti-CD25, anti-CD47, anti-CD117, anti-CD147, anti-EGFR, and anti-integrin beta 7 antibodies. Each possibility represents a separate embodiment. In other embodiments, the primary antibody or primary antibody fragment is capable of binding to an antigen listed in Table 1. In alternative embodiments, the antibody is a secondary antibody comprising an antigen recognition domain capable of specifically binding to the primary antibody. In other embodiments, the antibody is a secondary antibody comprising an antigen recognition domain capable of specifically binding to the humanized or human primary antibody. In further embodiments, the antibody is a monoclonal antibody. In additional embodiments, the antibody is lipidated at its N-terminus.

[0033] In other embodiments, the antibody fragment is selected from the group consisting of Fab, Fab', F(ab')2, Fv, scFv, dsFv, and Nanobodies. Each possibility represents a separate embodiment. In one embodiment, the antibody fragment is an scFv. In other embodiments, the antibody is selected from the group consisting of IgG1, IgG2, IgG3, and IgG4. Each possibility represents a separate embodiment. In certain embodiments, the antibody comprises a monovalent or multivalent Nanobody.

[0034] In various embodiments, the lipid nanoparticles include at least one of an ionizable lipid, a stabilizing lipid, a helper lipid, and a PEG-lipid. Each possibility represents a separate embodiment.

[0035] In certain embodiments, the lipid nanoparticles comprise an ionizable lipid selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, N,N-dimethyl-N',N'-bis[(9Z,12Z)-octadeca-9,12-dien-1-yl]ethane-1,2-diamine, 2-(bis((9Z,12Z)-octadeca-9,12-dien-1-yl)ethane-1,2-diamine, 4-(4-methylpiperazin-1-yl) propionate (EA-PIP), dioleyl-succinyl-seryl-tobramycin, dioleyl-adipyl-tobramycin, dioleyl-suberoyl-tobramycin, dioleyl-sebacoyl-tobramycin, dioleyl-dithioglycoloyl-tobramycin, monocationic lipid N-[1-(2,3-dioleoyloxy)]-N,N,N-trimethylammonium propane (DOTAP), BCAT O-(2R-1,2-di-O-(1'Z,9'Z-octadecadienyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate, BGSC (bis-guanidine-spermidine-cholesterol), BGTC (bis-guanidine-triaminoethylamine-cholesterol), CDAN (N'-cholesteryloxycarbonyl-1,3,7-diazanonane-1,9-diamine), CHDTAEA (cholesteryl hemi-dithiodiglycol tris(III) (amino(ethyl)amine), DCAT (O-(1,2-di-O-(9'Z-octadecenyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate), DC-Chol (3β[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol), DLKD (O,O'-dilauryl N-lysyl aspartate), DMKD (O,O'-dimyristyl N-lysyl aspartate esters), DOG (glycerol diol), DOGS (dioctadecylamido glycyl spermine), DOGSDSO (1,2-dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl ornithine disulfide), DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOSN (dioleylsuccinylethylthioneomycin), DOSP (dioleylsuccinylparomomycin), DOST (dioleylsuccinyltobramycin), 1,2-dioleoyl-3-trimethylammonium propane, DOTMA (N'[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride), DPPES (dipalmitoylphosphatidylethanolamine spermine), DDAB and DODAP, or any combination thereof. Each possibility represents a separate embodiment.

[0036] In other embodiments, the ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, 2-(bis((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)ethyl 4-(4-methylpiperazin-1-yl)propionate (EA-PIP), dioleyl-succinyl-seryl-tobramycin, dioleyl-adipyl-tobramycin, dioleyl-suberoyl-tobramycin, dioleyl-sebacoyl-tobramycin, N,N-dimethyl-N',N'-bis[(9Z,12Z)-octadeca-9,12-dien-1-yl]ethane-1,2-diamine, and dioleyl-dithioglycoloyl-tobramycin, or any combination thereof. Each possibility represents a separate embodiment. Additional ionizable lipids are disclosed in WO 2018 / 087753 and WO 2022 / 168085, the contents of which are disclosed in their entirety herein.

[0037] In some embodiments, the stabilizing lipid is selected from the group consisting of cholesterol, phospholipids (such as phosphatidylcholine (PC)), cephalin, sphingolipids and glycoglycerolipids, or a combination thereof. Each possibility represents a separate embodiment.

[0038] In a further embodiment, the helper lipid is selected from the group consisting of: 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dilauroyl-L-phosphatidylethanolamine (DLPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhPE), 1,3-dipalmitoyl-sn-glycero-2-phosphoethanolamine (1,3-DPPE), 1-palmitoyl-3-oleoyl-sn-glycero-2-phosphoethanolamine (1,3-POPE), biotin-phosphatidylethanolamine, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) and dipalmitoylphosphatidylethanolamine (DPPE), or a combination thereof. Each possibility represents a separate implementation.

[0039] In another embodiment, the PEG-lipid is selected from the group consisting of DMG-PEG, PEG-cDMA, PEG-cDSA, DLPE-PEG, DSPE-PEG, 3-N-(-methoxypoly(ethylene glycol)2000)carbamoyl-1,2-dimyristyloxypropylamine, 3-N-(-methoxypoly(ethylene glycol)2000)carbamoyl-1,2-distearoyloxypropylamine, or a combination thereof. Each possibility represents a separate embodiment.

[0040] In a specific embodiment, the lipid nanoparticles comprise an ionizable lipid (e.g., DLinDMA, DLinMC3-DMA, or DlinKC2-DMA), a stabilizing lipid (e.g., cholesterol), a helper lipid (e.g., DSPC or DOPE), and a PEG-lipid (e.g., DMG-PEG).

[0041] In some embodiments, the lipid nanoparticles comprise about 30 to 70% (mol%) ionizable lipids, including each value within the specified range. In other embodiments, the lipid nanoparticles comprise about 30 to 50% (mol%) stabilizing lipids, including each value within the specified range. In further embodiments, the lipid nanoparticles comprise about 5 to 20% (mol%) helper lipids, including each value within the specified range. In additional embodiments, the lipid nanoparticles comprise about 0.5 to 5% (mol%) PEG-lipids, including each value within the specified range.

[0042] In various embodiments, the lipid nanoparticles have a particle size (diameter) ranging from about 1 to about 500 nm, including each value within the specified range. In other embodiments, the lipid nanoparticles have a particle size ranging from about 1 to about 300 nm, including each value within the specified range. In other embodiments, the lipid nanoparticles have a particle size ranging from about 1 to about 200 nm, including each value within the specified range. In specific embodiments, the lipid nanoparticles have a particle size ranging from about 1 to about 100 nm, including each value within the specified range.

[0043] In certain embodiments, the anchor lipid comprises a glycerolipid. In a specific embodiment, the anchor lipid comprises a disubstituted glycerolipid. In other specific embodiments, the anchor lipid is linked to the fusion protein via a cysteine residue.

[0044] In various embodiments, the delivery system composition further comprises a detectable moiety.

[0045] In other embodiments, the delivery system composition further comprises an affinity tag.

[0046] In some embodiments, the therapeutic agent is encapsulated within lipid nanoparticles.

[0047] According to another aspect, a method for delivering a therapeutic agent to a subject in need thereof is provided, the method comprising administering to the subject a delivery system composition comprising a lipid nanoparticle encapsulating the therapeutic agent, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker, and a lipidated antibody or fragment thereof, wherein the linker is fused to the lipidated antibody or fragment thereof, and the fusion protein is non-covalently linked to the lipid nanoparticle via the anchoring lipid such that the lipidated antibody or fragment thereof is located at the distal end of the nanoparticle, and wherein the linker comprises a peptide or protein having at least 40 amino acid residues.

[0048] In one embodiment, the weight ratio of the therapeutic agent to the lipid nanoparticles ranges from about 1:50 to 50:1, including all iterations of ratios within the specified range. In another embodiment, the weight ratio of the therapeutic agent to the lipid nanoparticles ranges from about 1:1 to 1:25, including all iterations of ratios within the specified range. In another embodiment, the weight ratio of the therapeutic agent to the lipid nanoparticles ranges from about 45:1 to 1:1, including all iterations of ratios within the specified range.

[0049] In some embodiments, administration is by a local route / injection (e.g., intramuscular (IM), intraperitoneal (IP), intratumoral, intradermal, intracystic, intratracheal, intrathecal, intradermal, or subcutaneous (SC) administration). In various embodiments, administration is systemic (e.g., intravenous or intraarterial). In some embodiments, the delivery system is administered as a pharmaceutical composition further comprising a pharmaceutically acceptable excipient comprising at least one of a surfactant, a suspending agent, and an emulsifier. Each possibility represents a separate embodiment.

[0050] In certain embodiments, the therapeutic agent is a nucleic acid or polynucleotide.

[0051] In other embodiments, the therapeutic agent is exome-encoded DNA or mRNA.

[0052] In other embodiments, the therapeutic agent is a non-exome-encoded RNA. In a specific embodiment, the non-exome-encoded RNA is a microRNA, a long non-coding RNA (IncRNA), a long non-coding intergenic RNA (lincRNA), a pseudogene, a circular RNA (circRNA), a transfer RNA (tRNA) or an interfering RNA (siRNA and shRNA). Each possibility represents a separate embodiment.

[0053] In a further embodiment, the therapeutic agent is a catalytically active or inactive gene-editing nuclease.

[0054] In a specific embodiment, the catalytically active or inactivated gene editing nuclease is selected from the group consisting of: meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), transposases, integrases, mobile genetic elements (MGE)-encoded recombinases, clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) nucleases and their associated guide nucleic acids and targeting moieties. Each possibility represents a separate embodiment.

[0055] In other specific embodiments, the CRISPR-associated (Cas)-nuclease is Cas9, Cas12a, Cas12b, Cas12e, Cas13, Cas13a, Cas13b, Cas14, Cas-θ, CasX, CasY, or listed in Table 6. Each possibility represents a separate embodiment.

[0056] In certain embodiments, the therapeutic agent is a gene editing agent, including base editors, prime editors, and mobile genetic element gene writers.

[0057] In certain embodiments, the base editor is a cytosine base editor (CBE) or an adenine base editor (ABE), comprising but not limited to a catalytically inactive (dCas) or partially inactive (Cas nickase or nCas) Cas nuclease, a cytidine deaminase or an adenosine deaminase, and a guide RNA that confers target sequence specificity.

[0058] In a specific embodiment, the base editor or gene editing agent is selected from but not limited to those listed in Tables 2 and 3.

[0059] In other embodiments, the therapeutic agent is a guide editor composed of a guide editing guide RNA (pegRNA) targeting sequence and an RNA template, and a fusion protein composed of a Cas9 nickase fused to an engineered reverse transcriptase (RT), wherein the pegRNA guide template and Cas9 nickase direct the reverse transcriptase to the target site where a new DNA strand from the RNA template is inserted.

[0060] In certain embodiments, the therapeutic agent is a gene writer that incorporates a mobile genetic element for sequence targeting, which is combined with an engineered integrase or transposase to integrate the nucleic acid sequence at the target sequence.

[0061] In a specific embodiment, the therapeutic agent is incorporated into a CRISPR-Cas9 targeting element that is combined with an engineered piggyBac transposase to integrate a nucleic acid sequence at the target sequence.

[0062] In other embodiments, a donor DNA sequence is simultaneously provided to repair or insert a therapeutic DNA sequence. In specific embodiments, the delivered gene editing moiety knocks out, repairs, or inhibits the expression of a harmful or aberrant nucleic acid sequence. In other specific embodiments, the delivered gene editing moiety knocks in, provides, or increases the expression of a therapeutically beneficial nucleic acid sequence.

[0063] In various embodiments, the therapeutic agent is a catalytically inactive CRISPR-associated (Cas) protein or mRNA fused to a transcriptional modifier.

[0064] In some embodiments, the mRNA fused to the transcription modifier is a transcription repressor. In other embodiments, the transcription repressor is a methyltransferase or a histone deacetylase. In other embodiments, the transcription repressor is DNA methyltransferase 3A (DNMT3A), methyl-CpG-binding protein 2 (MeCP2), Krüppel associated box (KRAB), MeCP2-KRAB, histone deacetylase 3 (HDAC3), Ezh2, SALL1 and / or SDS3. Each possibility represents a separate embodiment.

[0065] In certain embodiments, the mRNA fused to the transcription modifier is a transcriptional activator. In a specific embodiment, the transcriptional activator is VP64, p65, Rta (VPR), a synergistic activating regulator (SAM) activation system MS2-p65-HSF1, a DNA demethylation moiety, or an acetyltransferase, alone or in combination. Each possibility represents a separate embodiment.

[0066] In certain embodiments, the delivery system compositions of the present invention can be used for knocking out, repairing or suppressing the expression of harmful or abnormal nucleic acid sequences.In a specific embodiment, the nucleic acid sequence knocking out, repairing or suppressing includes but is not limited to essential genes, growth-promoting genes, oncogenes, angiogenesis genes, immunosuppressive genes, anti-apoptotic genes, treatment resistance genes (therapy resistance gene), dominant negative mutation genes, mutant genes, viral genes, disease promotion miRNA, IncRNA, lincRNA, pseudogene, tRNA or circular RNA targets, including but not limited to those listed in Table 4, wherein each possibility represents a separate embodiment.

[0067] In other embodiments, the delivery system compositions of the present invention can be used to knock in, provide or increase the expression of therapeutically beneficial nucleic acid sequences. In specific embodiments, the beneficial nucleic acid sequences knocked in, provided or increased in expression include but are not limited to tumor suppressor nucleic acid sequences, pro-apoptotic nucleic acid sequences, immunostimulatory nucleic acid sequences, anti-angiogenic nucleic acid sequences, anti-cancer nucleic acid sequences, beneficial nucleic acid sequences silenced by hypermethylation or other epigenetic mechanisms, or therapeutic sensitizing nucleic acid sequences, including but not limited to those listed in Table 5. Each possibility represents a separate embodiment.

[0068] In other embodiments, the therapeutic agent is a protein, ribonucleoprotein, or drug.

[0069] In further embodiments, the therapeutic agent is delivered to cells. In specific embodiments, the therapeutic agent is delivered to pre-malignant or malignant cells. In other embodiments, the therapeutic agent is delivered to leukocytes. In other embodiments, the leukocytes are primary lymphocytes. In some embodiments, the lymphocytes are selected from B cells and T cells. Each possibility represents a separate embodiment.

[0070] According to another aspect, a method for treating a medical condition in a subject in need thereof is provided, the method comprising the steps of administering to the subject a delivery system comprising a lipid nanoparticle encapsulating a therapeutic agent, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker, and a lipidated antibody or fragment thereof, wherein the linker is fused to the lipidated antibody or fragment thereof, and the fusion protein is non-covalently linked to the lipid nanoparticle via the anchoring lipid such that the lipidated antibody or fragment thereof is located at the distal end of the nanoparticle, and wherein the linker comprises a peptide or protein having at least 40 amino acid residues.

[0071] In some embodiments, the medical condition is a cancer or a premalignant condition that predisposes to cancer. In specific embodiments, the cancer is a solid tumor or a hematopoietic cancer. In other embodiments, the medical condition is an autoimmune disease or an inflammatory disease, such as inflammatory bowel disease. In other embodiments, the medical condition is a monogenic or polygenic genetic disease. In certain embodiments, the medical condition is a cardiovascular, respiratory, genitourinary, neurological, endocrine, gastrointestinal, immune, or musculoskeletal condition. Each possibility represents a separate embodiment. In other embodiments, the medical condition is a condition caused by an infectious agent.

[0072] In other embodiments, the delivery system compositions of the present invention are used to inhibit the target nucleic acids or genes listed in Table 4. Each possibility represents a separate embodiment.

[0073] In other embodiments, the delivery system compositions of the present invention are used for therapeutic expression of the target nucleic acids or genes listed in Table 5. Each possibility represents a separate embodiment.

[0074] In other embodiments, the delivery system compositions of the present invention are used to correct or repair the target nucleic acids or genes listed in Table 4, Table 5, or Table 7. Each possibility represents a separate embodiment.

[0075] In a further embodiment, the LAND therapeutic construct comprises the amino acid sequence SEQ ID No. 13MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGR, followed by a functional protein, followed by the amino acid sequence SEQ ID No. 1ASGGSGGGKASGG, followed by a "secondary" scFv sequence specific for the Fc fragment of a "first" antibody specific for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid linker AAAGSHHHHHH (SEQ ID NO: 19) is added to the terminus of the composition.

[0076] In a further embodiment, the LAND therapeutic construct comprises the amino acid sequence (SEQ ID No. 13MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGR), followed by a functional protein, followed by SEQ ID No. 6ASGGSGGGKASGGGGGGSGGGGSGGGGS, followed by a "primary" scFv sequence specific for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid linker AAAGSHHHHHH (SEQ ID NO: 19) is added to the terminus of the composition.

[0077] In a further embodiment, the LAND therapeutic construct comprises the amino acid sequence SEQ ID No. 14MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGRSAGKAEGSEGKSSGSGSES KSTVGSAGSAAGSGESGGSAGSAAASASGGSGGGKASGG, followed by a "secondary" scFv sequence specific for the Fc fragment of a "first" antibody specific for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid linker AAAGSHHHHHH (SEQ ID NO: 19) is added to the terminus of the composition.

[0078] In further embodiments, the LAND therapeutic construct comprises the amino acid sequence of SEQ ID No. 14, followed by a "primary" scFv sequence specific for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, an amino acid linker AAAGSHHHHHH (SEQ ID NO: 19) is added to the terminus of the composition.

[0079] In a further embodiment, the antibody comprises the amino acid sequence shown in SEQ ID NO: 5, 8, 24, 27, 28 or 30.

[0080] In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent by reference to the drawings and by study of the following detailed descriptions.

[0081] BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1A -G is Figure 1A - Schematic diagram of a delivery system according to an embodiment of the present invention and the prior art (ASSET) (G) in F.

[0083] Figure 1A : The overall scheme of the delivery system, in which the lipidated peptide (LP) portion is separated from the antibody by a linker (e.g., more than 40 amino acids); (B) primary IgG LAND; (C) primary scFv LAND; (D) long linker LAND (primary IgG targeting); (E) long linker LAND (primary scFv targeting) and (F) primary Fab LAND. "1" indicates primary IgG antibody targeting, "2" indicates primary scFv antibody targeting, and "3" indicates primary Fab antibody targeting.

[0084] The following is a representative description of each of these delivery systems, but is not intended to be limiting.

[0085] Figure 1BA representative example of a primary IgG LAND construct is shown. This example includes a lipidated peptide portion (amino acid sequence SEQ ID NO: 17 (CDQSSS), followed by Linker 1 (SEQ ID NO: 18; GGGGSGGLSGR), followed by a functional protein, followed by Linker 3 (SEQ ID No. 1; ASGGSGGGKASGG), followed by a "secondary" scFv sequence specific for the Fc fragment of a "first" antibody that is specific for an antigen expressed on the cell type to be targeted for therapy). The amino acids of Linker 1, the functional protein, and Linker 3 make up the amino acids of the total linker. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.

[0086] Figure 1C An exemplary construct is shown that includes a lipidated peptide portion (amino acid sequence SEQ ID NO: 17 (CDQSSS), followed by Linker 1 (SEQ ID NO: 18 GGGGSGGLSGR), followed by a functional protein, followed by Linker 4 (amino acid SEQ ID No. 6 ASGGSGGGKASGGGGGGSGGGGSGGGGS), followed by a "primary" scFv sequence that is specific for an antigen expressed on the cell type to be targeted for therapy. The amino acids of Linker 1, the functional protein, and Linker 4 make up the amino acids of the total linker. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.

[0087] Figure 1D An exemplary construct is shown that includes a lipidated peptide portion (amino acid sequence SEQ ID No. 17), followed by a linker 5GGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASAS GGSGGGKASGG (SEQ ID NO: 12), followed by a "secondary" scFv sequence specific for the Fc fragment of a "first" antibody specific for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.

[0088] Figure 1EAn exemplary construct is shown that includes a lipidated peptide portion (amino acid sequence SEQ ID No. 17), followed by a linker 5GGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASAS GGSGGGKASGG (SEQ ID NO: 12), followed by a "primary" scFv sequence specific for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.

[0089] Figure 1F An exemplary construct for expressing LAND in the form of a Fab antibody is shown. It includes a lipidated peptide portion (amino acid sequence SEQ ID NO: 17), followed by an 11-amino acid long linker 1 (SEQ ID NO: 18), followed by the functional protein, followed by another 20-amino acid long linker (linker 4; SEQ ID NO: 6), followed by the primary Fd heavy chain. The light chain portion of the Fab is encoded by a sequence located on a separate DNA cassette and, upon export to the periplasm of E. coli, combines with the Fd portion to form the Fab, which is covalently stabilized by interchain disulfide bonds. The Fab serves as the primary antibody, specific for the antigen expressed on the cell type to be targeted for therapy.

[0090] Figure 1G A prior art ASSET construct is shown, comprising a lipidated peptide portion (amino acid sequence SEQ ID NO: 17), followed by Linker 1 (SEQ ID NO: 18), followed by a second antibody capable of binding to a first antibody specific for an antigen expressed on the cell type to be targeted for therapy, followed by an additional Linker (Linker 2; SEQ ID NO: 21), followed by a functional protein.

[0091] Figure 2 Analysis of purified fractions of RG7 LAND protein. Aliquots of the Triton fraction (TF, 20 μg protein load), the unbound fraction from the His-Trap column (Ni-FT, 20 μg protein load), and purified lipidated RG7 scFv (neat, 5 μg protein load) were separated on a 12% SDS / polyacrylamide gel. Arrows mark the location of the LAND protein. Representative gel of 24 products.

[0092] Figure 3A-B Comparison of RG7-LAND and RG7-ASSET binding to rat IgG2a by ELISA and FACS. (A) ELISA plates were coated overnight (ON) at 4°C, half with FIB504 (rat IgG2a) and half with BSA. The plates were blocked with 300 μl / well of 3% MPBS at 37°C for 1 h. The plates were washed three times with PBST, and purified LAND or ASSET proteins were dissolved in PBST in triplicate at a starting concentration of 300 nM and serially diluted three-fold at room temperature for 1 h. The plates were washed again, and HRP-anti-HIS / 5000 in PBST was applied for 1 h at room temperature. The plates were washed and 50 μl / well of TMB (Dako) was added. After 5 minutes, the color reaction was stopped with 50 μl / well of 1 M H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). (B) Binding of RG7-LAND and RG7-ASSET to TK-1 cells in the presence of FIB504 mAb was measured by flow cytometry on a CytoFLEX (Beckman Coulter, USA). US represents unstained cells; Cy5 represents the fluorescence of the encapsulated siRNA. Data are the mean ± SD of five independent experiments. Applied proteins: ASSET on rat IgG2a is marked by circles. ASSET on BSA is marked by diamonds. LAND on rat IgG2a is marked by triangles. LAND on BSA is marked by squares.

[0093] Figure 4A-B Comparison of RG7-LAND and RG7-ASSET binding to rat IgG2a anti-EGFR by ELISA and FACS. (A) ELISA plates were coated overnight (ON) at 4°C, half coated with anti-hEGFR (rat IgG2a clone 30-F11, BioRad) and half coated with BSA (as a negative specificity control), both at a concentration of 2 μg / ml in PBS, 50 μl / well. The plates were blocked with 300 μl / well of 3% MPBS at 37°C for 1 h. The plates were washed three times with PBS containing 0.05% Tween-20 (PBST), and purified LAND or ASSET proteins were dissolved in PBST in triplicate at a starting concentration of 300 nM and serially diluted three-fold at room temperature for 1 h. The plates were washed three times with PBST, and HRP-anti-HIS diluted ×5000 in PBST was applied at room temperature. The plates were washed three times with PBST and 50 μL / well of TMB (Dako) was added. After 8 minutes, the color development reaction was stopped with 50 μL / well of 1M H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). Error bars represent the SD of the data. Applied proteins: ASSET on EGFR - marked with circles. ASSET on BSA - marked with diamonds. LAND on EGFR - marked with triangles. LAND on BSA - marked with squares. (B) In the presence of anti-hEGFR mAb, the binding of RG7-LAND and RG7-ASSET incorporated into LNPs to OVCAR8 cells was measured by flow cytometry (on a CytoFLEX (Beckman Coulter, USA)). US - unstained cells; Cy5 is the fluorescence of the encapsulated siRNA. Representative histograms of five independent preparations.

[0094] Figure 5 In vitro binding of purified D1D2-Fc protein to TK-1 cells mediated by RG7-LAND, compared to RG7-ASSET, as determined by flow cytometry. LNPs associated with D1D2-Fc bind to TK-1 cells only when associated with RG7 LAND, but not RG7 ASSET. US = unstained cells; Cy5 is the fluorescence of encapsulated siRNA. Representative histograms from five independent preparations.

[0095] Figure 6A -C Erbitux LAND "LAND with primary scFv targeting" versus OVCAR8 (EGFR) measured by flow cytometry +) In vitro binding of cells. (A) Binding of purified Erbitux-LAND protein in OG micelles. (B) Binding of EA-PIP LNPs incorporating purified Erbitux-LAND protein. (C) Binding of MC3 LNPs incorporating purified Erbitux-LAND protein. US – unstained cells; ASSET-RG7-RG7 LAND protein as a negative control; ASSET-Erb–Erbitux LAND; mCherry in A represents the fluorescence of the mCherry component of LAND. Cys5 in B and C represents the fluorescence of encapsulated siRNA. Representative histograms from four independent preparations. Significance was assessed using analysis of variance (ANOVA) with Tukey's multiple comparison test. ****P < 0.0001.

[0096] Figure 7 Competitive binding: Erbitux-LAND was measured by flow cytometry for the binding of OVCAR8 (EGFR + In vitro binding of siRNA to cytosolic (100 mM) cells. US – unstained cells; EA-PIP LNP – empty LNP (without scFv integration); Avastin+Erb-LNP – LNP incorporating Erbitux-LAND in the presence of the isotype control mAb Avastin; Erbitux+Erb-LNP – LNP incorporating Erbitux-LAND in the presence of the mAb Erbitux. Cys5 represents the fluorescence of the encapsulated siRNA. Representative histograms of four independent preparations. Significance was assessed using analysis of variance (ANOVA) with Tukey's multiple comparison test. ****P < 0.0001.

[0097] Figure 8A-B The efficacy of LAND was compared with that of ASSET under conditions that minimize nonspecific LNP internalization (4°C) and under standard conditions (37°C). Cell viability assay: OVCAR8 cells were treated in vitro with EA-PIP LNPs (A) at 4°C for 1 hour with 2 μg / ml LNPs (where nonspecific LNP internalization was minimized) or (B) at 37°C for 15 minutes under standard conditions with 0.2 μg / ml LNPs (where nonspecific LNP internalization was not minimized). Cells were washed to remove non-internalized LNPs, supplemented with fresh medium, and cultured for 72 hours, after which cell viability was assessed using the XTT assay. NC5 - negative control siRNA; PLK1 - siPLK1; ASSET-EGFR - RG7-LAND protein-targeted LNPs with rat IgG2a anti-hEGFR; ASSET-Iso - RG7-LAND protein-targeted LNPs with isotype control rat IgG2a; NlpA-Erb - LNPs targeted by Erbitux-LAND; NlpA-RG7 - LNPs targeted by RG7-LAND protein without primary antibody. Error bars represent SD of three replicates. Unexpectedly, as shown in Figure 8, under the two conditions that minimize nonspecific LNP internalization ( Figure 8A of 4°C) and under standard conditions ( Figure 8B At 37°C, LAND-targeted LNPs (NlpA-Erb) demonstrated statistically significant improvements in efficacy compared with ASSET-targeted LNPs (ASSET-EGFR). Significance was assessed using analysis of variance (ANOVA) with Tukey's multiple comparison test (*p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.001).

[0098] Figure 9A -B In vivo tumor cell uptake: Athymic nude mice bearing OVCAR8 tumors were intraperitoneally injected with 0.75 mg / kg of EA-PIP LNPs encapsulating Cy5-labeled siRNA. Tumors were harvested 4 hours after injection for analysis. (A) Gating strategy: Tumor single-cell suspensions were stained with MCD45-FITC, and Cy5-positive mCherry was determined by flow cytometry. + The proportion of cells (tumor cells that took up LNP) and Cy5-positive CD45 +(B) Proportion of cells (mouse leukocytes that take up LNPs). (C) Proportion of Cys5-positive cells in tumor cells or mouse leukocytes. ASSET-EGFR - LNPs targeted with RG7 LAND protein with rat IgG2a anti-hEGFR; ASSET-Iso - LNPs targeted with RG7 LAND protein with isotype control rat IgG2a; NlpA-Erb - LNPs targeted with Erbitux LAND protein; NlpA-RG7 - LNPs targeted with RG7 LAND protein without primary antibody. Error bars represent SEM, N = 4.

[0099] Figure 10 PLK1 Silencing by siRNA in Tumors: Athymic nude mice bearing OVCAR8 tumors were intraperitoneally injected with AEA-PIP LNPs encapsulating either siRNA for PLK1 or negative control siRNA at a dose of 0.75 mg / kg. Tumors were harvested 48 hours after injection for analysis. RNA was extracted from the tumors, and PLK1 mRNA levels were assessed by RT-PCR and compared to the human 3C gene as an endogenous control. All samples were normalized to mock. NC5—negative control siRNA; PLK1—siPLK1; ASSET-EGFR—RG7 LAND protein-targeted LNPs with rat IgG2a anti-hEGFR; ASSET-Iso—RG7 LAND protein-targeted LNPs with isotype control rat IgG2a; NlpA-Erb—Erbux LAND protein-targeted LNPs; NlpA-RG7—RG7 LAND protein-targeted LNPs without primary antibody. Error bars represent SD, N = 4.

[0100] Figure 11A -D The expression of THB-7LAND and Z138 (CD38 +In vitro binding of ) and CAG (MM) cells. (A) THB-7-LAND micelles, purified THB-7-LAND protein bound to CAG cells in OG micelles. (B) NlpA-LNP (EA-PIP), EA-PIP LNPs with integrated purified THB-7-LAND protein bound to CAG cells. (C) THB-7-LAND micelles, purified THB-7-LAND protein bound to Z138 cells in OG micelles. (D) NlpA-LNP (EA-PIP), EA-PIP LNPs with integrated purified THB-7-LAND bound to Z138 cells. US - unstained cells; ASSET-RG7 - RG7 LAND protein used as a negative control; ASSET-THB7 - THB-7-LAND. Anti-His PE in A and C is a fluorescent marker for the His component of LAND. Cys5 in B and D is a fluorescent marker for encapsulated siRNA. Representative histograms of four independent preparations. Significance was assessed using analysis of variance (ANOVA) with Tukey's multiple comparison test. ****P < 0.0001.

[0101] Figure 12A -B ELISA analysis of RG7-LAND binding to rat IgG2a and BSA compared to the RG7-LAND "long linker". (A) ELISA plates were coated overnight at 4°C, half with FIB504 and half with BSA. The plates were blocked with 300 μl / well of 3% MPBS at 37°C for 1 h. The plates were washed three times with PBST, and purified LAND protein was applied in triplicate at a starting concentration of 300 nM and serially diluted three-fold for 1 h at room temperature. The plates were washed again, and HRP-anti-HIS / 5000 in PBST was applied for 1 h at room temperature. The plates were washed and 50 μl / well of TMB (Dako) was added. After 3 minutes, the color reaction was stopped with 50 μl / well of 1 M H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). (B) The FIB504 binding data in (A) were plotted as a fraction of the maximum binding signal. Representative histograms of four independent preparations. Significance was assessed using analysis of variance (ANOVA) with Tukey's multiple comparison test. ****P < 0.0001.

[0102] Figure 13Analysis of binding of RG7-LAND-targeted MC3 LNPs compared to the RG7-LAND "long linker." Binding of LNPs to TK-1 cells (which express α4β7 integrin on their surface) mediated by Fib504 rat IgG2a (an antibody that binds to α4β7 integrin) or a rat IgG2a isotype control was measured by flow cytometry, reading the Cys5 fluorescence of the encapsulated siRNA labeled. US - unstained cells; LNPs + WT iso-RG7 LNPs; RG7 LNPs prepared with RG7-LAND in the presence of isotype control rat IgG2a; LNPs + WT Fib - RG7 LNPs prepared with RG7-LAND in the presence of Fib504 IgG; LNPs + LLiso - LNPs with RG7-LAND "long linker" (45 aa) prepared with RG7-LAND in the presence of isotype control rat IgG2a; LNPs + LL Fib - LNPs prepared with RG7-LAND in the presence of Fib504 IgG. Representative histograms of four independent preparations. Significance was assessed using analysis of variance (ANOVA) with Tukey's multiple comparison test. ****P < 0.0001.

[0103] Figure 14 Tumor cell survival experiments demonstrated the potential of LAND primary scFv targeting for gene editing applications. Tumor-targeted primary scFv LAND LNPs, which deliver mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) and guide RNA, inhibit the function of genes that promote tumor growth. THB-7 (anti-CD38 scFv) LAND LNPs for CD38 +The ability to hematopoietic cancer was demonstrated in a representative CD38 expressing mantle cell lymphoma (MCL) Z138 tumor model. In these studies, MCLZ138 tumor cell survival was assessed using anti-CD38 scFv LAND LNPs carrying mRNA encoding a CRISPR-associated (Cas) nuclease (Cas9) with a single guide RNA for SOX11, a cancer-promoting gene in MCL. Control groups included untreated MCL Z138 cells and MCL Z138 cells treated with similarly prepared anti-CD38 scFv LAND LNPs but with single guide RNAs for unrelated target genes (GFP and HPRT). Analysis of variance revealed that the survival of MCL tumor cells treated with CD38-LNPs (sgSOX11) was significantly decreased compared to all control treatments, achieving statistical significance (p < 0.0001). In the CD38-LNP (sgSOX11)-treated group, cell viability was less than 10%, whereas in the control CD38-LNP (sgGFP), CD38-LNP (sgHPRT), and untreated groups, cell viability was greater than 90%. These results demonstrate that LAND primary scFv-targeted LNPs can deliver CRISPR / Cas gene editing components to inhibit gene function that promotes tumor growth, leading to effective tumor therapy. Representative histograms of four independent preparations. Analysis of variance (ANOVA) with Tukey's multiple comparison test was used to assess significance. ****p < 0.0001.

[0104] Figure 15 To further demonstrate the potential of LAND primary scFv targeting for gene editing applications, in vivo experiments were performed comparing tumor-targeted and isotype control LNPs delivering mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) and guide RNA to inhibit the function of genes that promote tumor growth. + To investigate the hematopoietic capacity of hematopoietic cancer, we used the representative CD38 expressing mantle cell lymphoma MCL Z138. Z138 tumor cells (approximately 1×10 6cells) were injected intravenously into SCID mice (n=8 to 10 animals / group). In these studies, after tumor establishment, LAND LNPs were injected intravenously at a dose of 0.5 mg / kg, starting 10 and 15 days after tumor inoculation. These LNPs contained Cas9 mRNA and a single guide RNA for SOX11, CD38-LNP (sgSOX11). Control groups included mock treatment and LNP vectors with irrelevant scFv specificity or irrelevant sgRNA. Specifically, the control LNP vectors were CD38-targeted LNPs containing Cas9 mRNA and a single guide RNA for green fluorescent protein (GFP) - CD38-LNP (sgGFP); isotype control scFv LNPs containing Cas9 mRNA and a single guide RNA for SOX11 - Iso-LNP (sgSOX11); and isotype control scFv LNPs containing Cas9 mRNA and a single guide RNA for GFP - Iso-LNP (sgGFP). Kaplan-Meier curves and log-rank tests showed that the survival rate of the CD38-LNP (sgSOX11) treated group was increased compared with all control treatments, with a statistically significant difference (p < 0.001). In the CD38-LNP (sgSOX11) group, 90% of the animals were alive at day 50, while all animals in the control group died before day 40. These in vivo results are consistent with Figure 14 These results are consistent with the in vitro data shown, further demonstrating that LAND primary scFv-targeted LNPs can deliver CRISPR / Cas gene editing components to inhibit the function of genes that promote tumor growth, thereby effectively treating tumors.

[0105] Figure 16A To further demonstrate the potential of LAND primary scFv targeting for safe and effective gene editing, Figure 15 The percentage of gene editing in sorted tumor cells extracted from normal hepatocytes was assessed after in vivo treatment in the same representative hematopoietic tumor model used in and described in Example 3. In these studies, after tumor establishment, intravenous injection of LAND LNPs at a dose of 2.0 mg / kg containing Cas9 mRNA and a single guide RNA for SOX11-CD38-LNP (sgSOX11) was initiated. Control groups included mock treatment and LNP vectors with irrelevant scFv specificity or irrelevant sgRNA, such as Figure 15 As an additional control, mice (N=5 / group) were treated with a single intravenous administration of doxorubicin (DOX) at a dose of 1 mg / Kg or 2.5 mg / Kg. After treatment, genomic DNA was extracted from MCL tumor cells and normal hepatocytes, and INDELs were analyzed by next-generation sequencing (NGS). Figure 16A The results shown revealed that 95% of tumor cells were edited by treatment with a single guide RNA of SOX11-CD38-LNP (sgSOX11), compared to only 0-4% of tumor cells in controls that included untreated animals or treated with similarly prepared LNP vectors with an unrelated sgRNA, such as Figure 15 These differences were statistically significant using analysis of variance (ANOVA) with Tukey's multiple comparison test. **P < 0.001.

[0106] like Figure 16B As shown in Figure 2, LAND demonstrates its superiority in therapeutic applications compared to standard chemically coupled antibody LNP targeting technology. In these evaluations, an additional treatment group was tested using anti-CD38 LNPs prepared by the chemical coupling method. The chemically coupled CD38-targeted LNP (chemical CD38-LNP-sgSOX11) utilized the same Figure 16A The same lipids as in the Cas9 mRNA and SOX11 sgRNA were used. Chemical conjugation of anti-CD38 to LNP was performed as previously described by Tarab-Ravski et al. 2023. Similarly, intravenous treatment with the chemical CD38-LNP-sgSOX11 was started at a dose of 2.0 mg / kg 10 days after tumor formation, and the results were compared with those of the Figure 16A The results were compared with those obtained in the same treatment groups described in .

[0107] like Figure 16B As shown, LAND CD38-LNP-sgSOX11 achieved significantly higher tumor gene editing rates than chemical CD38-LNP-sgSOX11 (>95% vs. <40%). In addition, LAND treatment significantly reduced "off-tumor" gene editing in normal liver cells (hepatocytes and macrophages) compared with chemically conjugated LNP treatment (<4% vs. >40%). These differences were statistically significant (p < 0.0005) using analysis of variance (ANOVA) with Tukey's multiple comparison test. The significantly better efficacy of LAND than chemically conjugated antibody-targeted LNPs was unexpected because the lipidated scFv antibody used in LAND has only one binding site, while the antibody used in chemically conjugated LNPs has two binding sites.

[0108] like Figure 16CAs shown, LAND therapy has a higher safety profile than standard chemotherapy. In these evaluations, an additional control group (N=5 / group) was treated with a single intravenous dose of doxorubicin (DOX) at a dose of 1 mg / Kg or 2.5 mg / Kg. These doses are generally within the range used clinically. After treatment, genomic DNA was extracted from normal hepatocytes and INDELs were analyzed by next-generation sequencing (NGS). Surprisingly, the "out-of-tumor" gene editing rate of LAND in normal hepatocytes (<4%, Figure 16B ) compared with standard chemotherapy (>50%) INDEL rate ( Figure 16C , doxorubicin, 2.5 mg / Kg) is one order of magnitude lower.

[0109] Figure 17 To further demonstrate the safety of LAND primary scFv therapy, hepatotoxicity and the percentage of gene editing were assessed in normal hepatocytes after administration in normal mice. In these studies, anti-EGFR LAND LNPs containing Cas9 mRNA and a single guide RNA targeting PLK1-EGFR-LNP (sgPLK1) were administered intravenously at a dose of 2.0 mg / kg. Control groups included untreated animals and LNP vectors with an irrelevant GFP sgRNA, such as Figure 15 Serum liver enzyme levels and the percentage of gene-edited hepatocytes were measured as shown in FIG16 . Consistent with the results in FIG16 , the percentage of edited cells in the liver was low and did not differ significantly between the control group treated with anti-EGFR LAND LNPs with a single guide RNA targeting PLK1-EGFR-LNP (sgPLK1) and the control group treated with anti-EGFR LAND LNPs with a single guide RNA targeting an unrelated sgRNA targeting GFP, as shown in FIG16 . Serum liver enzymes in all treated groups were not negatively affected compared to untreated animals.

[0110] Figure 18 The correlation between Erbitux LAND "LAND with primary scFv targeting" and "LAND with primary Fab targeting" and OVCAR8 (EGFR + ) cells in vitro. Binding of purified Erbitux-LAND protein in OG micelles. UT - unstained cells; RG7 micelles: RG7 detergent micelles as negative control; Erb micelles: primary Erbitux scFv LAND detergent micelles; Fab micelles: primary Erbitux Fab LAND detergent micelles; APC-anti-His: fluorescent antibody detection only, no micelles.

[0111] Figure 19THB-7 LAND "LAND with primary scFv targeting" and "LAND with primary Fab targeting" measured by flow cytometry were compared with Z138 (CD38 + ) cells in vitro. Binding of purified THB-7-LAND protein to pure OG micelles. UT - unstained cells; RG7 micelles: RG7 OG micelles; scFv: primary THB-7 scFv LAND OG micelles; Fab: primary THB-7 Fab LAND OG micelles; aHis: detection only with anti-His-Tag fluorescent antibody, no micelles. DETAILED DESCRIPTION

[0112] The present invention provides a novel platform for the effective delivery of therapeutic agents to target cells. The platform, called "LAND", provides uniform applicability and superior antigen binding potency and specificity. In one embodiment, the LAND platform comprises a first antibody that is linked to a lipid particle via a lipidated peptide and a peptide linker (e.g., 10 to 200 amino acids in length, 20 to 200 amino acids in length, 0 to 300 amino acids in length, or 40 to 400 amino acids in length). In other embodiments, the platform comprises a unique linker / spacer region (which may or may not encode a functional protein) of at least 40 amino acids in length that is incorporated between the lipidated peptide portion of the antibody and the antibody itself (see Figure 1A Unexpectedly, this platform showed high efficacy in transducing cells with LNPs encapsulating active agents (e.g., RNA).

[0113] Now refer to Figure 1B -F, are certain configurations of a delivery system according to the principles of the present invention compared to previous configurations (referred to herein as ASSET; Figure 1G ). While the ASSET configuration utilizes only a short 11 amino acid linker (Linker #1) preceding the lipidated antibody (secondary scFv), followed by an additional linker (Linker #2) and a functional protein, configurations according to the principles of the present invention utilize longer linkers (Linker #5 in D and E) or those that include a functional protein (in B and C) preceding the lipidated antibody. In one embodiment, the antibody is encoded at the 5' end of the construct. Surprisingly, the novel configuration incorporating a single antigen-binding site for the LAND primary scFv antibody targeting (Figures 1(C) and (E)) demonstrated significantly higher efficacy compared to the ASSET primary IgG antibody targeting with two antigen-binding sites, which is generally considered to have high affinity compared to its corresponding scFv fragment.

[0114] The delivery system of the present invention can be used to target various antigens and treat the corresponding diseases listed, including but not limited to those shown in Table 1.

[0115] Table 1: Targeted antigens and corresponding therapeutic indications treated by the compositions and methods of the present invention

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122] In certain embodiments, the therapeutic agent is a base editor, a guide editor, or a mobile genetic element gene writer. In a specific embodiment, the gene editing nuclease is a cytosine base editor (CBE), which is essentially composed of three fusion elements: a cytidine deaminase, a uracil DNA glycosylase inhibitor (UGI), and a catalytically inactive (dCas) or partially inactivated (Cas nickase or nCas) Cas nuclease. Such Cas9 variants contain mutations that prevent the generation of double-strand breaks (DSBs). The associated single guide RNA (sgRNA) confers target sequence specificity. In a specific embodiment, the CBE complex is recruited to the target DNA by the Cas protein and sgRNA, and the cytidine deaminase recognizes the single-stranded DNA (ssDNA) in the R-loop structure formed by the pairing between the sgRNA and the unedited DNA chain, and converts cytosine to uracil, generating a U / G pair. The mismatched U / G pair is then converted to a U / A pair and a T / A pair in sequence through the mismatch repair (MMR) pathway. In other embodiments, the gene editing nuclease is an adenine base editor (ABE). ABEs are similar to CBEs in structure and base editing mechanism, except that adenosine deaminase replaces cytidine deaminase. In certain embodiments, the ABE complex is recruited to the target DNA in a process similar to that used by CBEs, after which adenosine deaminase converts adenosine to inosine, generating an I / T pair. MMR then sequentially converts the mismatched I / T pairs to I / C and G / C pairs. Many variants of CBEs and ABEs have been generated to improve their efficiency, specificity, and reduce off-target effects. In specific embodiments, CBEs and ABEs, as well as other gene editing agents, include but are not limited to those listed in Tables 2 and 3, respectively. In specific embodiments for silencing gene expression, CBEs and ABEs, as well as other gene editing agents, are used to introduce premature stop codons (PTCs) in target genes to disrupt their expression. In specific embodiments designated CRISPR-STOP and iSTOP, base editors (including but not limited to BE3) create in-frame stop codons by converting CAA, CAG, CGA, and / or TGG codons in the genome to TAA, TAG, and TGA stop codons. Another way to inhibit gene expression is to use ABE to mutate the start codon (ATG), thereby eliminating gene expression. In one embodiment called i-Silence, an adenine base editor (such as ABEmax) is used to convert ATG to GTG or ACG, thereby silencing the target gene. In contrast, BE can bypass abnormal, pre-existing disease-associated PTCs to avoid diseases caused by the production of truncated proteins. This method is called CRISPR-pass, which successfully converts the PTC into a glutamine (CAA or CAG) or arginine (CGA) codon by A to G or T to C conversion, thereby avoiding the production of truncated proteins by allowing transcription to continue.

[0123] In addition to restoring normal gene expression and inhibiting gene function, isoform-specific gene expression can also be controlled by DNA base editors. Most proteins have multiple isoforms, and selective splicing of pre-mRNA is a key step in determining the type of isoform, whereby some exons are excluded from mature transcripts. Since most introns end with G, CBE is used in a method called CRISPR-SKIP, which converts Gs in the splice acceptor site to As by editing the Cs in the complementary chain of the target site. As a result, the corresponding exon cannot be incorporated into the mature transcript, while other exons are expressed normally.

[0124] Designing appropriate sgRNAs is crucial for the application of DNA base editors, as the design and optimization of sgRNAs for DNA base editors is more complex than CRISPR-based methods. Currently, typical CRISPR sgRNA design programs such as CRISPOR, CHOPCHOP, and Cas-Designer can be used for sgRNAs for DNA base editors. Specifically, DNA base editor-specific tools such as BE-Designer, sgSTOP, beditor, SNP-CRISPR, BE-FF, and Benchling can be used to design sgRNAs for BE. Recently, a machine learning-based sgRNA design tool, BE-Hive, was introduced, which can predict the editing efficiency and genotype results of each target based on different CBEs and ABEs and different cell lines.

[0125] In another embodiment, a base editing system is used to recruit DNA base modification enzymes through RNA aptamers within gRNA molecules. In this method, as an alternative to fusing effector deaminases to Cas9, the guide RNA (gRNA) component of the CRISPR-Cas9 complex can be transformed into a recruited anchor. In this method, the gRNA is transformed to include an RNA aptamer that interacts with its cognate ligand fused to the effector protein. The separation of DNA recognition elements from effector elements and the use of RNA aptamers to recruit effectors allow the system to be easily reconstructed by mixing and matching the various components and recruiting different effectors to different target sites at the same time. By utilizing orthologous RNA aptamers-RNA binding protein pairing to recruit different DNA deaminases, heterologous BE can be easily achieved at different sites. In a specific embodiment, a BE system mediated by an RNA aptamer called Pin-Point is used.

[0126] Cytosine base editors, adenine base editors, and other gene editing agents suitable for use in specific embodiments include, but are not limited to, those in Tables 2 and 3 below, which are incorporated herein by reference and characterize their nuclease source, mutation (if any), editing window, and PAM sequence.

[0127] Table 2 Cytosine base editor (CBE) and adenine base editor (ABE)

[0128]

[0129] As listed in Table 2, Jeong et al. and Collantes et al. (both incorporated herein by reference) describe examples of cytosine base editors (CBEs), adenine base editors (ABEs), Pin-Point RNA aptamer-mediated CBEs, and ABE systems that can be used in specific embodiments.

[0130] In certain embodiments, CBEs, ABEs, and other gene editing components in Table 3 are used, including but not limited to: glycosylase base editors (GBEs) and C-to-G base editors (CGBEs), adenine transversion editors (AYBEs and AXBEs), guide editors (PEs), CRISPR-associated transposons (CASTs), CRISPR-associated serine recombinases (twinPEs and PASTEs), retrotransposons, and SeLection by Essential-Gene Exon Knock-in (doi: 10.3390 / biomedicines11082168), incorporated by reference.

[0131] Table 3 Cytosine base editor (CBE) and adenine base editor (Abe)

[0132]

[0133]

[0134] In another embodiment called primer editing, a guide RNA template and a Cas9 nickase are used to guide the reverse transcriptase to the target site to generate a new DNA chain from the RNA template and insert the target sequence. In addition to replacing a few nucleotides at the target site, the primer editor can also produce small insertions and deletions. The guide editor can change any DNA base to any other base, mediate all possible base-to-base conversions, and produce insertions and deletions (indels) and their combinations without the need for double-strand breaks (DSBs) or donor DNA (dDNA) templates. Guide editing uses a single guide RNA (sgRNA) that is longer than usual (called guide editing guide RNA (pegRNA)) and a fusion protein consisting of a Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme. Known as the "search-and-replace" base editing technology, the desired gene construct is added to the extended sequence of the guide RNA, which is then converted into DNA using the RT enzyme.

[0135] In another embodiment called gene writing, gene editing enzymes are incorporated into mobile genetic elements for targeted integration of large DNA fragments in mammalian genomes. Mobile genetic elements include, but are not limited to, transposons, retrotransposons, short interspersed nuclear elements (SINEs), and long interspersed nuclear elements (LINEs). In a specific gene writing embodiment, a CRISPR-Cas9 targeting element called "Find, Cut, and Transfer" (FiCAT) (find, cut) is combined with the payload transfer efficiency of the engineered piggyBac transposase (transfer). The piggyBac functional domain has been modified to increase the targeted integration rate while reducing off-target events. In a specific embodiment, Cas9 searches for and cuts the genomic insertion point, while a transposase with enhanced donor excision and reduced promiscuous DNA binding ability facilitates gene insertion. The system works irreversibly by destroying the preferred transposase recognition site during the insertion process. In the process of gene writing, efficient targeted insertion of several thousand bases of DNA fragments in the mammalian genome is achieved.

[0136] LAND therapies can downregulate a list of endogenous oncogenic-promoting genes and sequences, including but not limited to those listed in Table 4, as well as representative, non-limiting, designed guide RNAs fused to Cas9 and Cas9 repressor proteins.

[0137] Table 4 - Non-limiting examples of representative endogenous human cancer sequences for downregulation and gRNA sequences for use with Cas9 and dCas9 fusion inhibitors (SEQ ID 55 to 198)

[0138]

[0139]

[0140]

[0141] Without limitation, examples of one or more upregulated oncogenes and endogenous genomic sequences transcriptionally activated by LAND for cancer treatment have tumor suppressive, pro-apoptotic, immunostimulatory, therapy sensitizing, suicide, anti-oncogene silenced by hypermethylation or other epigenetic mechanisms, or secreted decoy receptor gene activity, include but are not limited to those listed in Table 5.

[0142] Table 5 - Non-limiting examples of representative targeting endogenous human cancer genomic sequences for transcriptional upregulation and gRNA sequences used with dCas9 fusion activators (SEQ ID NOs: 199 to 418)

[0143]

[0144]

[0145]

[0146] For LAND therapy, Cas and dCas nucleases can be provided in the form of mRNA encoding Cas / dCas nuclease (e.g., CleanCap Cas9 or dCas9 mRNA (modified) custom produced by TriLink BioTechnologies Inc.), or complexed with a guide RNA as a ribonucleoprotein (RNP) (e.g., custom produced by Aldevron Inc.). Without any limitation, representative Cas and dCas and their protospacer adjacent motifs (PAMs) suitable for LAND therapy in activated or inactive form include, but are not limited to, those listed in Table 6 below.

[0147] Table 6 Representative Cas and dCas enzymes suitable for LAND therapy in activated or inactivated form and their protospacer adjacent motifs (PAMs)

[0148]

[0149] Without limitation, in addition to the antibody targets and conditions associated with cancer and other hyperproliferative diseases listed in Table 1, LAND can also be used to treat genetic diseases through gene editing knockout, silencing or correction applications using the LAND platform, including but not limited to those listed in Table 7 below. These additional diseases, related genes, tissues / cells and antibody targets for LAND platform applications include but are not limited to those described in Table 7 below:

[0150]

[0151]

[0152]

[0153]

[0154] The term "antibody" as used in the present invention includes intact molecules and functional fragments thereof.

[0155] In one embodiment, the antibody is a primary antibody.

[0156] As used herein, the term "primary antibody" refers to an antibody (or antibody fragment as defined herein) that specifically recognizes an antigenic target of interest (e.g., a protein, peptide, carbohydrate, or other small molecule) and is typically unconjugated (unlabeled). Primary antibodies that recognize and bind to unique epitopes of a broad spectrum of biomolecules with high affinity and specificity can be obtained as highly specific (e.g., 1 μM to 0.5 nM) monoclonal antibodies and / or polyclonal antibodies.

[0157] According to one embodiment, the first antibody comprises an antigen recognition domain that binds to a tissue- or tumor-specific antigen.

[0158] As used herein, "tissue-specific antigen" refers to a heterologous antigen that is organ or tissue specific.

[0159] As used herein, "tumor (or cancer) specific antigen" refers to an antigenic substance produced in tumor cells, that is, it triggers an immune response in the host. Tumor antigens can be used to identify tumor cells and are potential candidate antigens for cancer treatment. The term also includes tumor-associated antigens.

[0160] According to a specific embodiment, the antigen recognized by the first antibody is a cell surface antigen.

[0161] Specifically, the antigen of the first antibody is CD44, CD34, Ly6C, CD3, CD4, CD25, CD29 and / or Itgb7.

[0162] It should be understood that, in order to improve specificity, the first antibody refers to a plurality of first antibodies that bind to different targets (e.g., 2, 3, or 4 different targets). Thus, one target may be a tissue-specific antigen, while another target may be a tumor-specific antigen, or vice versa. Alternatively, all first antibodies bind to tissue (cell)-specific antigens. In addition, all first antibodies can bind to tumor-specific antigens.

[0163] According to a specific embodiment, the first antibody is a monoclonal antibody.

[0164] According to a specific embodiment, the first antibody is a bispecific antibody.

[0165] According to a specific embodiment, the first antibody is conjugated to the agent.

[0166] According to another embodiment, the first antibody is conjugated to a diagnostic agent.

[0167] In another embodiment, the antibody is a secondary antibody.

[0168] As used herein, the phrase "secondary antibody" refers to an antibody that binds to a conserved region of a first antibody. Thus, the second antibody may be specific for an antibody class and may optionally bind specifically to an isotype of the first antibody.

[0169] There are a variety of second antibodies to choose from for specific antibody classes and fragment types. The second antibody can bind to part of the complete IgG (heavy chain and light chain, H+L), or only bind to the Fab or Fc region, or only bind to the gamma chain. In one embodiment, the second antibody described herein binds only to the Fc region of the antibody and not to the light chain of the antibody (i.e., the affinity is at least 10 times, 100 times, or 1000 times higher). There are also specific second antibodies for IgM heavy chains (μ or Fc5μ) or lambda or kappa light chains common to all immunoglobulins (IgG, IgA, IgD, IgE, and IgM).

[0170] In one embodiment, the second antibody can be an antibody fragment that binds to the Fc constant region of a rat IgG2a antibody. In another embodiment, the second antibody can be an antibody fragment that binds to the Fc constant region of a human antibody (e.g., a human IgG antibody). The second antibody (or its fragment, such as an scFv) should have sufficient affinity to avoid binding to serum IgG (e.g., with a Kd between 10 and 20). -10 M to 10 -8 M) exchange.

[0171] The second antibody can be a monoclonal antibody or a polyclonal antibody.

[0172] According to a specific embodiment, the antibody (first or second) is a monoclonal antibody (as further described below), such as a humanized monoclonal antibody.

[0173] The antibody may be of any antibody class (e.g., IgG, IgA, IgD, IgE, and IgM) or isotype. According to a specific embodiment, the antibody is selected from the group consisting of IgG1, IgG2, IgG3, and IgG4.

[0174] Antibodies can be provided as intact antibodies (eg, whole IgG) or as divalent F(ab')2 fragments and monovalent Fab fragments, although other forms of antibody fragments can be used as described below.

[0175] As used herein, the phrase "antibody fragment" refers to a functional fragment of an antibody (eg, Fab, F(ab')2, Fv, scFv, dsFv, or single domain molecules such as VH and VL) that is capable of binding to an antigenic epitope.

[0176] As the case may be, the antibody or antibody fragment comprises a constant region.

[0177] Suitable antibody fragments for practicing some embodiments of the present invention include the complementarity determining regions (CDRs) of an immunoglobulin light chain (referred to herein as a "light chain"), the complementarity determining regions of an immunoglobulin heavy chain (referred to herein as a "heavy chain"), the variable region of the light chain, the variable region of the heavy chain, the light chain, the heavy chain, an Fd fragment, and antibody fragments comprising substantially the entire variable region of the light and heavy chains, such as Fv, single-chain Fv (scFv), disulfide-stabilized Fv (dsFv), Fab, Fab', and F(ab')2.

[0178] Functional antibody fragments comprising all or substantially all of the variable regions of a light chain and a heavy chain are defined as follows:

[0179] (i) Fv, defined as a genetically engineered fragment consisting of the variable regions of the light chain (VL) and the heavy chain (VH) expressed as two chains;

[0180] (ii) Single-chain Fv ("scFv"), a genetically engineered single-chain molecule comprising the variable region of a light chain and the variable region of a heavy chain, connected by a suitable polypeptide linker, as a genetically fused single-chain molecule.

[0181] (iii) Disulfide-stabilized Fv ("dsFv"), a genetically engineered antibody comprising the variable region of a light chain and the variable region of a heavy chain linked by a genetically engineered disulfide bond.

[0182] (iv) Fab, a fragment of an antibody molecule comprising the monovalent antigen-binding portion of an antibody molecule, can be obtained by treating a whole antibody with papain to produce an intact light chain and an Fd fragment of the heavy chain consisting of its variable region and CH1 domain;

[0183] (v) Fab', a fragment of an antibody molecule containing the monovalent antigen-binding portion of an antibody molecule, which can be obtained by treating whole antibody with the enzyme pepsin followed by reduction (two Fab' fragments are obtained per antibody molecule);

[0184] (vi) F(ab')2, a fragment of an antibody molecule containing the monovalent antigen-binding portion of an antibody molecule, which can be obtained by treating whole antibodies with the enzyme pepsin (i.e., a dimer of Fab' fragments held together by two disulfide bonds); and

[0185] (vii) Single-domain antibodies, composed of a single VH or VL domain with sufficient affinity for the antigen.

[0186] In one embodiment, the fragment is a scFv.

[0187] According to one embodiment, the polypeptide sequence of the first or second antibody contains an N-terminal sequence derived from a leader peptide recognized by a bacterial lipidation system. After the leader peptide is removed during export through the inner membrane, the mature polypeptide contains an N-terminal sequence of the leader peptide (e.g., CDQSSS-SEQ ID NO: 17), which is targeted by the lipidation system, resulting in lipid acylation of cysteine. In one embodiment, the signal sequence is part of a bacterial (e.g., E. coli) inner membrane lipoprotein.

[0188] An example of an inner membrane lipoprotein is NlpA (neolipoprotein A). The first six amino acids of NlpA can be used as an N-terminal anchor (CDQSSS: SEQ ID NO: 17). Other examples of anchors that may be used in the present invention include lipoproteins, Klebsiella pneumoniae pullulanase (which has a CDNSSS (SEQ ID NO: 13) mature lipoprotein anchor), phage-encoded celB, and Escherichia coli acrE (envC).

[0189] Examples of inner membrane proteins that can be used as protein anchors include: AraH, MglC, MalF, MalG, Mal C, MalD, RbsC, RbsC, ArtM, ArtQ, GlnP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E, Dpp B, DppC, OppB, AmiC, AmiD, BtuC, FhuB, FecC, FecD, FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC, PotH, PotI, ModB, NosY, PhnM, LacY, SecY, TolC, DsbB, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB, and Aas. Furthermore, a single transmembrane loop of any cytoplasmic protein can serve as a membrane anchor.

[0190] As described above, the N-terminus of the antibody is linked to the lipidated peptide moiety via a linker peptide.

[0191] The linker peptide is an amino acid sequence that is used to connect the antibody to the lipidated peptide portion. The linker peptide may include amino acids that encode a functional protein (e.g., a detectable protein such as a fluorescent protein), or may have no other function other than connecting the antibody and the lipidated peptide portion (i.e., a spacer).

[0192] The linker preferably has a flexibility and length that allows the lipidated peptide portion of the antibody to penetrate and associate (non-covalently) with the lipid of the particle and the antigen-binding fragment of the antibody, thereby binding its target with high affinity (as further detailed herein).

[0193] The length of the linker peptide is at least 40, 50, 60, 70, 80, 90, 100 amino acids. In one embodiment, the length of the linker peptide is 40 to 400, 40 to 300, 50 to 400, 50 to 300, 60 to 400, 60 to 300 amino acids.

[0194] In another embodiment, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the amino acids of the linker are glycine and / or serine.

[0195] In some embodiments, the linker is a combination of a functional protein, a linker, and a spacer sequence.

[0196] In order to express the antibody of this aspect of the invention, it is preferred that the polynucleotide sequence encoding the above elements is connected to a nucleic acid construct suitable for host cell expression. Such nucleic acid constructs include a promoter sequence for directing the polynucleotide sequence to be transcribed in a constitutive or inducible manner in the cell.

[0197] Exemplary constructs contemplated by the inventors are as follows Figure 1A -F, whereby the 3' end of the DNA encoding the antibody encodes the lipidated peptide portion, a linker peptide of more than 40 amino acids, and the 5' end towards the antibody itself. According to one embodiment, the antibody is encoded at the 5' end.

[0198] The nucleic acid constructs of some embodiments of the present invention (also referred to herein as "expression vectors") include additional sequences that make the vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, typical cloning vectors may also contain transcription and translation initiation sequences, transcription and translation terminators, and polyadenylation signals. As an example, such constructs typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.

[0199] The nucleic acid constructs of some embodiments of the present invention typically include a signal sequence for secretion of the fusion protein from the host cell in which it is located.

[0200] Eukaryotic promoters typically contain two types of recognition sequences: the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription start site, is believed to guide RNA polymerase to initiate RNA synthesis. Other upstream promoter elements determine the rate of transcription initiation.

[0201] Exemplary promoters contemplated by the present invention include, but are not limited to, polyoma virus, simian virus 40 (SV40), adenovirus, retrovirus, hepatitis B virus, and cytomegalovirus promoters. According to one embodiment, the promoter is a bacterial promoter.

[0202] Preferably, the nucleic acid constructs of some embodiments of the present invention utilize a promoter that is active in the specific cell population being transformed. Examples of cell type-specific and / or tissue-specific promoters include promoters such as liver-specific albumin [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid-specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular, promoters of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulins [Banerji et al., (1983) Cell 33:729-740], neuron-specific promoters such as the neurofilament promoter [Byrne et al., (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreas-specific promoters [Edlunch et al., (1985) Science 230:912-916] or a mammary gland-specific promoter, such as the whey promoter (U.S. Patent No. 4,873,316 and European Application Publication No. EP 264,166).

[0203] To improve the efficiency of mRNA translation, polyadenylation sequences can also be added to expression vectors. Accurate, efficient, and multi-functional polyadenylation requires two distinct sequence elements: a GU- or U-rich sequence downstream of the polyadenylation site and a highly conserved six-nucleotide sequence, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals suitable for use in some embodiments of the present invention include those derived from SV40.

[0204] Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 (available from Invitrogen); pCI (available from Promega, pMbac, pPbac, pBK-RSV, and pBK-CMV (available from Strategene)); pTRES (available from Clontech), and derivatives thereof.

[0205] Expression vectors containing regulatory elements from eukaryotic viruses (such as retroviruses) can also be used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein-Barr virus include pHEBO and P2O5. Other exemplary vectors include pMSG, pAV009 / A + 、pMTO10 / A + , pMAMneo-5, baculovirus pDSVE, and any other vector that allows expression of proteins under the direction of the SV-40 early promoter, the SV-40 late promoter, the metallothionein promoter, the mouse mammary tumor virus promoter, the Rous sarcoma virus promoter, the polyhedrin promoter, or other promoters that are effectively expressed in eukaryotic cells.

[0206] Various methods can be used to introduce the expression vectors of some embodiments of the present invention into stem cells. Such methods are generally described in the following literature: Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989); Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995); Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988); and Gilboa et al. [Biotechniques 4(6):504-512, 1986], including, for example, stable or transient transfection, lipofection, electroporation, and infection with recombinant viral vectors. In addition, for positive-negative selection methods, see US Pat. Nos. 5,464,764 and 5,487,992.

[0207] Examples of bacterial constructs include the pET series of E. coli expression vectors [Studier et al. (1990) Methods in Enzymol. 185: 60-89].

[0208] Other bacterial systems contemplated by the present invention include, but are not limited to, Lactoccocus lactis, Pseudomonas, Streptomyces, coryneform bacteria, and halophilic bacteria.

[0209] In yeast, a variety of vectors containing constitutive or inducible promoters can be used, as disclosed in US Patent Application No. 4,739,047. Alternatively, vectors that promote integration of foreign DNA sequences into the yeast chromosome can be used.

[0210] In the case of using plant expression vectors, expression of the coding sequence can be driven by a variety of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al., (1984) Nature 310:511-514], or the coat protein promoter of TMV [Takamatsu et al., (1987) EMBO J. 6:307-311] can be used. Alternatively, plant promoters such as the small subunit of RUBISCO [Coruzzi et al., (1984) EMBO J. 3:1671-1680 and Brogli et al., (1984) Science 224:838-843] or heat shock promoters such as soybean hsp17.5-E or hsp17.3-B [Gurley et al., (1986) Mol. Cell. Biol. 6:559-565] can be used. These constructs can be introduced into plant cells via Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and other techniques well known to those skilled in the art. See, for example, Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463.

[0211] Other expression systems, such as insect and mammalian host cell systems, are also useful in some embodiments of the present invention and are well known in the art and described further below.

[0212] Since the antibody is lipidated, it is inserted into the membranes of the expressing cells. The membrane fraction can be separated (e.g., by centrifugation) and the lipidated antibody can be extracted from the membrane using a detergent and then optionally further purified (e.g., using nickel affinity chromatography).

[0213] Following separation, the lipidated antibodies described herein can be contacted with particles to produce immune particles.

[0214] The contacting is carried out for a period of time (e.g., 6 to 72 hours) under conditions (e.g., temperature) that allow the lipidated portion of the protein (e.g., a second antibody) to be incorporated into the immunoparticles. It will be understood that the lipidated antibody is thus non-covalently linked to the particles via its lipidated portion.

[0215] The lipidated antibodies of the present invention are coupled to the outer surface of the particles. Measures are taken to couple the antibodies without significantly affecting their functionality in binding to their targets (i.e., greater than 80%, 90% or 95% of the antibodies on the particles are available for binding to their targets and the particle's loadability or loading with agents).

[0216] As used herein, the term "immunoparticle" refers to a particle, typically used as a drug or diagnostic carrier, having antibodies coupled to its surface.

[0217] As used herein, "particle" refers to a nanometer to micrometer structure that is not a biological cell.

[0218] The particles can be synthetic carriers, gels or other objects or materials having an outer surface capable of loading (eg, encapsulating) a pharmaceutical agent. The particles can be polymeric or non-polymeric preparations.

[0219] Exemplary particles that can be used according to this aspect of the invention include, but are not limited to, polymeric particles, microcapsules, liposomes, microspheres, microemulsions, nanoparticles, nanocapsules, nanospheres, nanoliposomes, nanoemulsions, and nanotubes.

[0220] In one embodiment, the particle is a biological particle - such as a red blood cell or a ghost cell.

[0221] In another embodiment, the particles are non-biological particles, ie, not cells.

[0222] According to one embodiment, the particles are nanoparticles.

[0223] As used herein, the term "nanoparticle" refers to one or more particles having a size between a single atom and a macroscopic bulk solid. Typically, nanoparticles have a characteristic size in the submicron range (e.g., the diameter of a generally spherical nanoparticle, or the length of a generally elongated nanoparticle), for example, from about 1 nm to about 500 nm, or from about 1 nm to about 200 nm, or the magnitude of 10 nm, for example, from about 1 nm to about 100 nm. Nanoparticles can be any shape, including but not limited to elongated particle shapes (e.g., nanowires) or irregular shapes, and more regular shapes, such as nanoparticles that are generally spherical, hexagonal, and cubic. According to one embodiment, nanoparticles are generally spherical.

[0224] The particles of this aspect of the invention may have a charged surface (ie positively or negatively charged) or a neutral surface.

[0225] The agent used to make the particles can be selected based on the desired charge on the external surface of the particles.

[0226] Thus, for example, if a negatively charged surface is desired, the particles can be made from negatively charged lipids (ie, anionic phospholipids), as described below.

[0227] When a positively charged surface is desired, particles can be made from positively charged lipids (ie, cationic phospholipids), as described below.

[0228] As mentioned above, the present invention also contemplates uncharged particles. Such particles can be made from neutral lipids such as phosphatidylethanolamine or dioleophosphatidylethanolamine (DOPE).

[0229] It should be understood that combinations of different lipids can be used to make particles of the present invention, including mixtures of multiple cationic lipids, mixtures of multiple anionic lipids, mixtures of multiple neutral lipids, mixtures of at least one cationic lipid and at least one anionic lipid, mixtures of at least one cationic lipid and at least one neutral lipid, mixtures of at least one anionic lipid and at least one neutral lipid, and other combinations of the above. In addition, polymer-lipid based formulations can also be used.

[0230] There are many polymers that can be connected to the polymer on the lipid. Polymers commonly used as lipid modifiers include but are not limited to: polyethylene glycol (PEG), polysialic acid, polylactic acid (also referred to as polylactide), polyglycolic acid (also referred to as polyglycolide), polylactic-polyglycolic acid, polyvinyl alcohol, polyvinyl pyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxyethyloxazolidine, polyhydroxypropyloxazoline, polyasparagine, polyhydroxypropylmethacrylamide, polymethacrylamide, polydimethylacrylamide, polyvinyl methyl ether, polyhydroxyethyl acrylate, derivatized cellulose, for example hydroxymethyl cellulose or hydroxyethyl cellulose.

[0231] The polymers can be used in the form of homopolymers or block or random copolymers.

[0232] Particle can also comprise other components.The example of this type of other components includes but is not limited to fatty alcohol, fatty acid and / or cholesterol ester or any other pharmaceutically acceptable excipient, which can affect surface charge, membrane fluidity and help to incorporate bioactive lipids in the lipid assembly.The example of sterol comprises cholesterol, cholesterol hemisuccinate, cholesterol sulfate or any other cholesterol derivative.According to the present invention, preferred lipid assembly comprises the lipid assembly that forms micelle (usually when there is no assembly in the lipid matrix) or the lipid assembly that forms liposome (usually when there is lipid matrix).

[0233] In one embodiment, the particle is a lipid-based nanoparticle. The core of the particle can be hydrophilic or hydrophobic. The core of the lipid-based nanoparticle can contain some lipids so that it is not completely hydrophilic.

[0234] In one embodiment, the particle is a liposome. As used herein and as recognized in the art, liposomes include any synthetic (i.e., non-naturally occurring) structure consisting of a lipid bilayer that encloses a certain volume. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers, etc. Liposomes can be prepared by any method known in the art [Monkkonen, J et al., 1994, J. Drug Target, 2: 299-308; Monkkonen, J et al., 1993, Calcif. Tissue Int., 53: 139-145; Lasic DD., Liposomes Technology Inc., Elsevier, 1993, 63-105. (Chapter 3); Winterhalter M, Lasic DD, Chem Phys Lipids, 1993 September; 64 (1-3): 35-43].

[0235] Liposomes can be unilamellar or multilamellar. In some cases, unilamellar liposomes may be preferred because they represent a larger surface area per unit lipid mass. Suitable liposomes according to the present invention are preferably non-toxic. Liposomes can be made from a single phospholipid or a mixture of phospholipids. Liposomes can also contain other lipid materials, such as cholesterol. In order to prepare liposomes with a negative surface potential, acidic phospholipids or sphingolipids or other synthetic lipids can be used. Preferably, the lipid has a high partition coefficient in the lipid bilayer and a low rate of desorption from the lipid assembly. Exemplary phospholipids that can be used to prepare liposomes with a negative surface potential include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylcholine and phosphatidylglycerol.

[0236] Other negatively charged lipids that can be used instead of liposome-forming lipids are sphingolipids, such as sulfatides and the various gangliosides.

[0237] The most commonly used and commercially available lipids derivatized into lipopolymers are those based on phosphatidylethanolamines (PEs), typically distearoylphosphatidylethanolamine (DSPE).

[0238] The lipid phase of liposome can comprise the combination of the physiologically acceptable liposome-forming lipid or the physiologically acceptable liposome-forming lipid for medical or veterinary application.Liposome-forming lipid is normally those lipids with glycerol main chain, and wherein at least one hydrowing group is by acyl chain, phosphate group, their combination or derivative replace, and can contain chemical reactive group (for example amine imines, acid ester, aldehyde or alcohol) at head group.Usually, the length of acyl chain is between 12 to about 24 carbon atoms, and has different saturation, is complete, part or unhydrogenated lipid.In addition, lipid matrix can be natural origin, semisynthetic or fully synthetic lipid, also can be neutral, negatively charged or positively charged.

[0239] According to one embodiment, the lipid phase comprises phospholipids.

[0240] The phospholipid may be a glycerophospholipid. Examples of glycerophospholipids include, but are not limited to, phosphatidylglycerol (PG), including dimyristoylphosphatidylglycerol (DMPG); phosphatidylcholine (PC), including egg yolk phosphatidylcholine and dimyristoylphosphatidylcholine (DMPC), phosphatidic acid (PA), phosphatidylinositol (PI), phosphatidylserine (PS), and sphingomyelin (SM) and its derivatives.

[0241] According to the present invention, another group of lipid matrices employed includes cationic lipids (monocationic or polycationic lipids). Cationic lipids are generally composed of a lipophilic moiety, such as a sterol or identical glycerol backbone, to which two acyl groups or two alkyl groups, or an acyl group and an alkyl chain contribute a hydrophobic region of amphipathic molecules, thereby forming an overall net positively charged lipid.

[0242] Preferably, the head group of the lipid carries a positive charge. Monocationic lipids may include, for example, 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2-dioleoyloxy-3-(trimethylamino)propane (DOTAP), N-[-1-(2,3,-ditetradecyloxy)propyl]-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N-[1-(2,3,-dioleoyloxy)propyl]-N,N-dimethyl-N-hydroxyethylammonium bromide (DORIE), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 3; N-(N',N'-dimethylaminoethane)carbamoyl]; cholesterol (DC-Chol) and dimethyldioctadecyl ammonium (DDAB).

[0243] Examples of polycationic lipids include lipid moieties similar to monocationic lipids to which spermine or spermidine is attached. These include, but are not limited to, N-[2-[[2,5-bis[(3-aminopropyl)amino]-1-oxopentyl]amino]ethyl]N,N-dimethyl-2,3-bis(1-oxo-9-octadecenyl)oxy]-1-propanium (DOSPA) and ceramide carbamoylspermidine (CCS).

[0244] Cationic lipids can be used alone or in combination with cholesterol, neutral phospholipids or other known lipid assembly components. In addition, cationic lipids can form part of a derivatized phospholipid, such as the neutral lipid dioleoylphosphatidylethanolamine (DOPE) derivatized with polylysine, to form a cationic lipid polymer.

[0245] The diameter range of used liposome is preferably 50 to 200nM, more preferably 20 to 100nM. In order to determine the size of liposome, extrusion, homogenization or ultrasonic irradiation can be used. The homogenizer that can be used conveniently includes microfluidizer (produced by Microfluidics, Inc., Boston, Massachusetts, USA) or microfluidic micromixer (Precision NanoSystems, Inc., Vancouver, British Columbia, Canada). In a typical homogenization process, liposome is recycled by a standard emulsion homogenizer until selected liposome size is observed. Particle size distribution can be monitored by conventional laser beam particle size identification. Liposome is extruded by a small pore polycarbonate membrane or an asymmetric ceramic membrane, which is an effective method for reducing liposome size to a relatively well-defined size distribution. Usually, the suspension is circulated once or repeatedly by the membrane until required liposome size distribution is obtained. Liposome can be extruded by a membrane that gradually reduces in pore size to realize the gradual reduction of liposome size.

[0246] According to another embodiment, the particle is a nanoparticle. Preferably, the diameter of the nanoparticle is less than 100nm, can be spherical, non-spherical or polymer particles. In a preferred embodiment, the polymer used to prepare the nanoparticle is biocompatible and biodegradable, for example poly (DL-lactide-co-glycolide) polymer (PLGA). Yet, other polymers that can be used for making nanoparticle include but are not limited to PLA (polylactic acid) and copolymers thereof, polyanhydrides, polyalkylene-cyanoacrylate (such as polyisobutyl cyanoacrylate), polyethylene glycol, polyethylene oxide and derivatives thereof, chitosan, albumin, gelatin etc.

[0247] The particles of the present invention can be modified. They can be modified to extend their circulation half-life (e.g., by PEGylation), thereby reducing their clearance rate, extending their clearance time, and allowing antibody binding. The PEG incorporated into the particles can be characterized by any of a variety of chemical compositions and / or molecular weights, depending on the application and purpose.

[0248] It will be appreciated that once the antibody is attached to the particle (and loaded with its cargo), it can be packaged in a container and identified as a universal kit for the delivery of pharmaceutical agents in vivo.

[0249] Drugs or therapeutic agents that can be loaded into the particles include, but are not limited to, anticancer agents (e.g., chemotherapy, radioisotopes, immunotherapy), antibiotics, enzymes, antioxidants, lipid uptake inhibitors, hormones, anti-inflammatory drugs, steroids, vasodilators, angiotensin-converting enzyme inhibitors, angiotensin receptor antagonists, inhibitors for smooth muscle cell growth and migration, platelet aggregation inhibitors, anticoagulants, inhibitors for the release of chemical mediators, promoters or inhibitors for endothelial cell growth, aldose reductase inhibitors, inhibitors for mesangial cell growth, lipoxygenase inhibitors, immunosuppressants, immunostimulants, antiviral agents, Maillard reaction inhibitors, amyloidosis inhibitors, nitric oxide synthesis inhibitors, AGE (advanced glycation end products) inhibitors, free radical scavengers, proteins, peptides; glycosaminoglycans and their derivatives; and oligosaccharides, polysaccharides and their derivatives.

[0250] In another embodiment, the particles are loaded with a diagnostic agent.

[0251] Exemplary diagnostic drugs include in vivo diagnostic agents such as X-ray contrast agents, ultrasound diagnostic agents, isotope-labeled agents for diagnosis by nuclear medicine, and agents for diagnosis by nuclear magnetic resonance.

[0252] The loading of the pharmaceutical agent into the particles can be performed simultaneously with the assembly of the particles or after the assembly of the particles.

[0253] Therefore, in a preferred embodiment, for example, when medicament is nucleic acid, such as DNA, RNA, siRNA, plasmid DNA, short hairpin RNA, sequential small RNA (stRNA), microRNA (miRNA), RNA mimics or heterochromatin siRNA, target nucleic acid agent has charged main chain, which hinders it from being packaged in lipid granules effectively. Therefore, before being encapsulated in lipid granules, target nucleic acid agent can be condensed with cationic polymer (such as PEI, polyamine spermidine and spermine) or cationic peptide (such as protamine and polylysine).In one embodiment, agent is not condensed with cationic polymer.

[0254] In another embodiment, the target agent is packaged in lipid particles in the following manner: The immune particles are provided in a lyophilized form. The target agent is in an aqueous solution. The target agent in the aqueous solution rehydrates the lyophilized lipid particles. Thus, the target agent is packaged in the rehydrated lipid particles.

[0255] In one embodiment, the immune particles of this aspect of the invention (e.g., lipid-based particles) can deliver a variety of target agents. For example, two or more agents can be delivered, wherein both (or all) agents are hydrophilic. In another example, two or more agents can be delivered, wherein both (or all) agents are hydrophobic.

[0256] In one embodiment, immune particles (e.g., lipid-based particles) can deliver two target cargo agents. One cargo agent can be hydrophobic and the other hydrophilic. A hydrophobic agent can be added to the lipid particles during the lipid particle formation process. The hydrophobic agent binds to the lipid portion of the lipid particles. The hydrophilic agent is added to the aqueous solution and the lyophilized lipid particles are rehydrated. In an exemplary embodiment of two-agent delivery, the concentrated siRNA is packaged in liposomes and a drug that is poorly soluble in aqueous solution is bound to the lipid portion of the lipid particles. As used herein, "poorly soluble in aqueous solution" means that the solubility of the composition in water is less than 10%.

[0257] The present invention contemplates any effective suitable lipid to agent ratio.Preferred lipid to agent molar ratios include about 2:1 to about 30:1, about 5:1 to about 100:1, about 10:1 to about 40:1, about 15:1 to about 25:1.

[0258] According to a specific embodiment, the weight ratio of fusion protein to siRNA is about 1:20, 1:30, 1:36 or even 1:50.

[0259] In one embodiment, the loading efficiency of hydrophilic agent is 50% to 100%.The preferred loading efficiency of medicament is about 50%, about 60%, about 70% or higher encapsulation agent percentage ratio.In one embodiment, the loading efficiency of hydrophilic agent is 50% to 100%.The preferred loading efficiency of the medicament relevant to the lipid part of lipid granule (for example, the medicament that is insoluble in the aqueous solution) is about 50%, about 60%, about 70%, about 80%, about 90%, about 100% loading percentage ratio.In one embodiment, the loading efficiency of hydrophobic agent in lipid layer is 80% value 100%.

[0260] As used herein, "loading" means encapsulating or absorbing.

[0261] As used herein, the term "encapsulated" refers to the distribution of the pharmaceutical agent within the interior of the particle. Preferably, the pharmaceutical agent is uniformly distributed. Uniform distribution of the pharmaceutical agent within the polymer particle is referred to as matrix encapsulation. However, due to manufacturing process reasons, it is foreseeable that a small amount of the pharmaceutical agent may also be present on the exterior of the particle and / or mixed with the polymer constituting the particle shell.

[0262] As used herein, "absorbed" refers to the association of the agent with the outer surface of the particle.

[0263] The required amount of the drug loaded in the particles varies depending on the type of drug. However, it is preferred that the drug can be loaded in the particles with high loading efficiency.

[0264] The present invention further contemplates contacting the immune particle with the primary antibody if the lipidated secondary antibody is coupled to the particle via the lipidated peptide moiety.

[0265] According to a specific embodiment, the immune complex of the first antibody and the second antibody refers to an interaction based on antibody (i.e., second antibody)-antigen (i.e., first antibody). Antibody-antigen binding is a non-covalent, reversible interaction (specific binding is generally in the range of 1 μM to 0.1 nM) that fully retains the function of the first antibody to bind to its epitope. According to a specific embodiment, the immune complex reaction is performed in vitro.

[0266] The weight ratio of the second antibody to the first antibody is typically 1:1, but other ratios, such as 1:2, 2:1, 1:3, 3:1, are also contemplated.

[0267] Conditions for performing immunocomplexation are well known in the art and require physiological conditions while avoiding high salt concentrations and extreme pH values, as these conditions can disrupt antigen-antibody binding by weakening electrostatic interactions and / or hydrogen bonding.

[0268] Methods for producing polyclonal and monoclonal antibodies (primary or secondary antibodies described herein) and fragments thereof are well known in the art (see, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).

[0269] According to some embodiments of the present invention, antibody fragments can be prepared by proteolysis of antibodies or by expressing DNA encoding the fragment in Escherichia coli or mammalian cells (e.g., Chinese hamster ovary cell culture or other protein expression systems). Antibody fragments can be obtained by digesting the entire antibody with pepsin or papain using conventional methods. For example, antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to obtain 5S fragments, referred to as F(ab')2. The fragment can be further cleaved using a thiol reducing agent and an optional blocking group of the sulfhydryl groups produced by the cleavage of disulfide bonds to produce a 3.5S Fab' monovalent fragment. Alternatively, enzymatic cleavage using pepsin can directly produce two monovalent Fab' fragments and an Fc fragment. These methods are described in the following literature: for example, U.S. Patent Nos. US4,036,945 and US4,331,647 of Goldenberg, and the references contained therein, which are incorporated herein by reference in their entirety. See also Porter, RR [Biochem.J.73:119-126 (1959)]. Other methods of cleaving antibodies, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of the fragments, or other enzymatic, chemical, or genetic techniques, may also be used, so long as the fragments bind to the antigen recognized by the whole antibody.

[0270] The Fv fragment comprises a combination of VH and VL chains. This association can be non-covalent, as described by Inbar et al. [Proc. Nat'l Acad. Sci. USA 69:2659-62 (19720]. Alternatively, the variable chains can be linked by intermolecular disulfide bonds or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragment comprises a VH and a VL chain connected by a peptide linker. These single-chain antigen binding proteins (sFv) are prepared by constructing a structural gene comprising DNA sequences encoding the VH and VL domains connected by oligonucleotides. The structural gene is inserted into an expression vector, which is then introduced into a host cell such as E. coli. The recombinant host cell synthesizes a single polypeptide chain in which the linker peptide bridges the two V domains. Methods for producing sFv are described in the following literature: for example [Whitlow and Filpula, Methods 2:97-105 (1991); Bird et al., Science 242:423-426 (1988); Pack et al., Bio / Technology 11: 1271-77 (1993); and U.S. Patent No. 4,946,778, which are incorporated herein by reference in their entirety.

[0271] Another form of antibody fragment is a peptide encoding a single complementary determining region (CDR). CDR peptides ("minimal recognition units") can be obtained by constructing genes encoding the CDRs of the target antibody. For example, such genes are prepared by synthesizing variable regions from RNA of antibody-producing cells using polymerase chain reaction. See, for example, Larrick and Fry [Methods, 2:106-10 (1991)].

[0272] The humanized form of non-human (e.g., mouse) antibodies is an immunoglobulin, an immunoglobulin chain, or a fragment thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of an antibody) containing a minimal sequence derived from a non-human immunoglobulin. Humanized antibodies include human immunoglobulins (receptor antibodies), wherein the residues forming the complementary determining regions (CDRs) of the receptor are replaced by residues from the CDRs of non-human species (donor antibodies) such as mice, rats, or rabbits, and the non-human species has desired specificity, affinity, and ability. In some cases, the Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies can also include residues that are neither present in the receptor antibody nor in the CDR or framework sequences of the importing antibody. Generally speaking, humanized antibodies will include substantially all at least one, usually two variable domains, wherein all or substantially all of the CDR regions correspond to the CDR regions of non-human immunoglobulins, and all or substantially all of the FR regions are FR regions of a human immunoglobulin consensus sequence. The humanized antibody optimally also comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].

[0273] Methods for humanizing non-human antibodies are well known in the art. Typically, humanized antibodies introduce one or more amino acid residues from non-human sources. These non-human amino acid residues are generally referred to as import residues and are typically taken from the input variable domain. Humanization can essentially be performed according to the method of Winter and colleagues [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)], replacing the corresponding sequence of a human antibody with a rodent CDR or CDR sequence. Therefore, such humanized antibodies are chimeric antibodies (U.S. Patent No. 5,189,047). Wherein a portion substantially less than the complete human variable region is replaced by a corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies, in which some CDR residues and possibly some FR residues are replaced by residues from similar sites in rodent antibodies.

[0274] Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991)]. The techniques of Cole et al. and Boerner et al. can also be used to prepare human monoclonal antibodies [Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147 (1): 86-95 (1991)]. Similarly, human antibodies can be prepared by introducing human immunoglobulin loci into transgenic animals (e.g., mice in which endogenous immunoglobulin genes have been partially or completely inactivated). Upon challenge, production of human antibodies can be observed that are very similar to those observed in humans in all aspects, including gene rearrangement, assembly, and antibody repertoire. This method is described in the following literature: for example, U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al., Bio / Technology 10,:779-783 (1992); Lonberg et al., Nature 368:856-859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14:826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13, 65-93 (1995).

[0275] Since the immunoparticles of the invention are typically used in pharmaceutical applications, they are generally non-immunogenic to the subject being treated.

[0276] The particles of the present invention can be administered to a subject by themselves or as part of a pharmaceutical composition to treat a disease. As used herein, "pharmaceutical composition" refers to a particle preparation that encapsulates the active ingredients described herein with other chemical components (such as physiologically suitable carriers and excipients).

[0277] According to a specific embodiment, the pharmaceutical agent is a therapeutic agent, as further described above.

[0278] The purpose of a pharmaceutical composition is to facilitate administration of an active ingredient to a subject.

[0279] The term "active ingredient" as used herein refers to a pharmaceutical agent.

[0280] Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" are used interchangeably to refer to a carrier or diluent that does not cause significant irritation to the subject and does not abrogate the biological activity and properties of the administered active ingredient. Adjuvants are included in these phrases.

[0281] As used herein, the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of the active ingredient of the present invention. Examples of excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polymers such as polyethylene glycol. The pharmaceutical composition may advantageously be in the form of a foam or gel.

[0282] Suitable routes of administration may include, for example, inhalation, oral, buccal, rectal, transmucosal, topical, transdermal, intradermal, nasal, enteral and / or parenteral routes; intramuscular, subcutaneous and / or intramedullary injection routes; intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal and / or intraocular injection routes.

[0283] The pharmaceutical compositions can be manufactured by processes well known in the art, such as by conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0284] Thus, pharmaceutical compositions for use according to the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active ingredients into preparations which can be used pharmaceutically. Appropriate formulation depends on the route of administration chosen.

[0285] For injection, the active ingredients of the pharmaceutical compositions may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer.

[0286] For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0287] For oral administration, pharmaceutical compositions can be easily prepared by combining active ingredients with pharmaceutically acceptable carriers known in the art. Such carriers enable pharmaceutical compositions to be formulated into tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc., for oral intake by patients. Pharmaceutical preparations for oral use can be prepared using solid excipients, optionally grinding the resulting mixture, and if necessary, after adding suitable adjuvants, processing the granular mixture to obtain tablets or dragee cores. Suitable excipients, particularly fillers, such as sugars, include lactose, sucrose, mannitol, or sorbitol; Cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose; and / or physiologically acceptable polymers, such as polyvinyl pyrrolidone (PVP). If necessary, disintegrants such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or its salt, such as sodium alginate, can be added.

[0288] Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyes or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

[0289] Pharmaceutical compositions that can be used orally include push-fit capsules made of gelatin and sealed soft capsules made of gelatin and a plasticizer (e.g., glycerol or sorbitol). Push-fit capsules can contain the active ingredient mixed with a filler (e.g., lactose), a binder (e.g., starch), a lubricant (e.g., talc or magnesium stearate), and an optional stabilizer. In soft capsules, the active ingredient can be dissolved or suspended in a suitable liquid, such as a fatty oil, liquid paraffin, or liquid polyethylene glycol. In addition, stabilizers can be added. The dosage of all formulations for oral administration should be suitable for the selected route of administration.

[0290] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0291] For administration via inhalation, the active ingredient for use according to the present invention can be delivered in the form of an aerosol / spray from a pressurized pack or nebulizer using a suitable propellant, for example a fluorochlorocarbon, for example dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane; carbon dioxide; or a volatile hydrocarbon, for example butane, propane, isobutane or a mixture thereof. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges, for example, of gelatin, for use in a dispenser can be formulated to contain a powder mix of the active ingredient and a suitable powder base, such as lactose or starch.

[0292] The pharmaceutical composition can be formulated for parenteral administration, for example by bolus injection or continuous infusion. Preparations for injection can be in unit dosage form, for example in ampoules or multidose containers, optionally with the addition of preservatives. The composition can be a suspension, solution or emulsion in an oily or aqueous vehicle and can contain preparatons, such as suspending agents, stabilizers and / or dispersants.

[0293] The pharmaceutical composition for parenteral administration can include an aqueous solution of the active ingredient in a water-soluble form. In addition, the suspension of the active ingredient can be prepared into a suitable oil-based or water-based injection suspension. Suitable lipophilic solvents or carriers include fatty oils (such as sesame oil), or synthetic fatty acid esters (such as ethyl oleate), triglycerides or liposomes. Aqueous injection suspensions can contain materials that increase suspension viscosity, such as sodium carboxymethyl cellulose, sorbitol or dextran. Alternatively, the suspension can also contain a suitable stabilizer or an agent that increases the solubility of the active ingredient, to allow the preparation of highly concentrated solutions.

[0294] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, eg, a sterile, pyrogen-free, water based solution, before use.

[0295] The pharmaceutical compositions may also be formulated in rectal compositions such as suppositories or retention enemas, using, eg, conventional suppository bases such as cocoa butter or other glycerides.

[0296] The pharmaceutical composition should contain an effective amount of active ingredients to achieve disease treatment.

[0297] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0298] For any formulation used in the methods of the present invention, a therapeutically effective amount or dose can be initially estimated from in vitro and cell culture assays. For example, lysosome-containing particles can be tested for in vitro activity in plasma or other plasma-simulating environments. For example, a dose can be formulated in an animal model to achieve a desired tissue concentration or titer. This information can be used to more accurately determine a useful dose in humans.

[0299] The toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, cell culture or experimental animals. The data obtained from these activity assays and animal studies can be used to formulate a dosage range for use in humans. The dosage can vary depending on the dosage form used and the route of administration used. The exact formulation, route of administration and dosage can be selected by each physician in view of the patient's condition. (See, for example, Fingl et al., 1975, "The Pharmacological Basis of Therapeutics," Ch. 1 p. 1).

[0300] Dosage amount and interval can be adjusted individually to provide plasma levels of the active ingredient sufficient to achieve the desired therapeutic effect, known as the minimum effective concentration (MEC). The MEC will vary for each formulation but can be estimated from in vitro data. The dose required to achieve the MEC depends on individual characteristics and route of administration. Detection assays can be used to measure plasma concentrations.

[0301] Depending on the severity and responsiveness of the condition to be treated, administration may be single or multiple administrations, with the course of treatment lasting from several days to several weeks, or until a cure is achieved, or a diminution of the disease state is achieved.

[0302] The amount of the composition to be administered will depend on the subject to be treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, and the like.

[0303] If desired, the compositions of the present invention may be presented in a packaging or dispenser device, such as an FDA-approved kit, which may contain one or more unit dosage forms containing the active ingredient. The packaging may, for example, comprise metal or plastic foil, such as a blister pack. The packaging or dispenser may be accompanied by instructions for administration. The packaging or dispenser may also be accompanied by a notice associated with the container that the container is in a form prescribed by the governmental agency for use or sale, the notice reflecting approval of the composition for human or veterinary use by that agency. For example, such a notice may be prescription drug labeling approved by the U.S. Food and Drug Administration, or an approved product insert.

[0304] The immunoparticles of the invention can be used to deliver pharmaceutical agents to a subject in need thereof.Both therapeutic and diagnostic applications are contemplated herein.

[0305] A subject that can be treated according to the methods described herein is typically a mammalian subject, such as a human.

[0306] The present teachings can be used in a variety of clinical applications that would benefit from the implementation of such a simple and cost-effective platform.

[0307] It is expected that many related particles will be developed before the expiration of the present patent, and the scope of the term immunoparticle is intended to include a priori all such new technologies.

[0308] As used herein, the term "about" refers to ±10%.

[0309] The terms "comprises," "comprising," "includes," "including," "having," and their cognates mean "including but not limited to."

[0310] The term "consisting of" means "including and limited to."

[0311] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially change the basic and novel characteristics of the claimed composition, method or structure.

[0312] As used herein, the singular forms "a," "an," and "the" include plural forms unless the context clearly indicates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0313] Throughout the application, various embodiments of the present invention may be presented in the form of ranges. It should be understood that the description in range form is merely for convenience and brevity and should not be interpreted as an immutable limitation on the scope of the present invention. Therefore, the description of a range should be considered to have specifically disclosed all possible sub-ranges and individual numerical values within the range. For example, the description of a range such as 1 to 6 should be considered to have specifically disclosed sub-ranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within the range, such as 1, 2, 3, 4, 5, and 6. Regardless of the width of the range, this applies.

[0314] Whenever a numerical range is indicated herein, it is intended to include any cited numeral (fractional or integer) within the indicated range. The expressions "a range between a first indicated number and a second indicated number" and "a range from a first indicated number to a second indicated number" are used interchangeably herein and are intended to include the first indicated number and the second indicated number and all numbers and integers therebetween.

[0315] As used herein, the term "method" refers to manners, means, techniques and procedures for accomplishing a given task, including but not limited to those manners, means, techniques and procedures known to practitioners in the fields of chemistry, pharmacology, biology, biochemistry and medicine or readily developed from known manners, means, techniques and procedures.

[0316] As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing or reversing the progression of a disorder, substantially ameliorating clinical or aesthetic symptoms of a disorder, or substantially preventing the appearance of clinical or aesthetic symptoms of a disorder.

[0317] It should be understood that certain features of the invention described in the context of separate embodiments for the sake of clarity may also be provided in combination in a single embodiment. Conversely, various features of the invention described in the context of a single embodiment for the sake of brevity may also be provided individually, or in any suitable subcombination, or in any suitable manner in any other described embodiment of the invention. Certain features described in the context of individual embodiments should not be considered essential features of those embodiments unless the embodiment will not function without those elements.

[0318] In order to more fully illustrate some embodiments of the present invention, the following examples are provided. However, they should never be construed as limiting the broad scope of the present invention. Without departing from the scope of the present invention, those skilled in the art can easily design many variations and modifications of the principles disclosed herein.

[0319] Example

[0320] Example 1

[0321] Inflammatory bowel disease (IBD) is a general classification that includes several forms of inflammatory diseases and conditions that affect various parts of the gastrointestinal (GI) tract. Despite decades of research in animals and humans, current treatments remain disappointing and incurable. Although novel therapies such as anti-TNF-α antibodies have revolutionized IBD treatment, not all patients respond to treatment, and patients who initially respond may lose their response to treatment over time due to the development of antibody-drug antibody (ADA) reactions (Dammes et al., Nature Nanotech. 16: 1030-1038, 2021).

[0322] To find a fundamental treatment for inflammatory bowel disease (IBD), blocking cytokines or receptors with antibodies alone is often insufficient and only provides temporary relief of symptoms. Changing the expression of specific genes in inflammatory leukocytes, and thereby altering their behavior, may help restore the balance of the intestinal immune response in the long term. Recently, it was demonstrated that in a mouse model of colitis, siRNAs were specifically delivered to activation-sensitive receptors expressed on gut-homing leukocytes. This was achieved by using a targeting moiety that only recognizes a specific protein conformation, namely the high-affinity (HA) conformation of integrin α4β7. Gut-homing leukocytes use this key gut-homing receptor to adhere to the intestinal endothelium.

[0323] The function of integrins depends on their conformational state (Yu et al., J. Cell Bio. 196(1):131-146, 2012). When stimulated, integrins change conformation, resulting in a significant increase in affinity for their ligands. Integrin α4β7 can bind to both vascular cell adhesion molecule 1 (VCAM-1) to home to peripheral tissues and mucosal addressin cell adhesion molecule 1 (MAdCAM-1) to home to intestinal tissues, but not both at the same time. Whether integrin α4β7 has affinity for VCAM-1 or MAdCAM-1 depends on the specific stimulus, subsequent signal transduction, and the type of conformational change. Since only leukocytes that actively home to intestinal tissues have α4β7-integrin in HA confirmation, it is desirable to target cells expressing integrin α4β7 in a conformation-dependent manner, rather than being conformation-insensitive like commercially available monoclonal antibodies such as natalizumab and vedolizumab (anti-α4β7-integrin).

[0324] To this end, a recombinant fusion protein containing two domains of the intestinal endothelial ligand MAdCAM-1 was generated. MAdCAM-1 has an increased affinity for the integrin α4β7 in its HA conformation and can therefore be used to design LNP targeting moieties. MAdCAM-1 is a multidomain protein that is naturally involved in the initial binding and firm adhesion of leukocytes to the intestinal endothelium. To maximize specificity, only the integrin-binding domains D1 and D2 were used. To protect the integrin-binding domains while attaching the protein to the LNP, a monoclonal secondary antibody raised against rat IgG2a (referred to herein as RG7) was used as a linker between the LNP and the MAdCAM-D1D2 protein. The RG7 linker was chemically coupled to the LNP using maleimide / thiol chemistry, and the MAdCAM-D1D2 protein was recombinantly fused to the Fc region of rat IgG2a. In this way, the RG7 antibody binds to the MAdCAM-1 protein through its affinity for the rat IgG2a domain, leaving domains D1 and D2 free for binding to the α4β7 integrin. This conjugation strategy was compared with two other conjugation methods, namely using reduced cysteine residues in the D1D2 protein or by directly conjugating the D1D2 recombinant protein to DSPE-PEG-maleimide lipids using ASSET.

[0325] While chemical conjugation of RG7 IgG to LNPs was effective in delivering siRNA to leukocytes, RG7-ASSET-mediated delivery was less effective. To overcome the challenges of successfully delivering siRNA to leukocytes using LNPs incorporating lipidated RG7 scFv and conjugated to D1D2-Fc, a novel siRNA-based Figure 1B The LAND primary IgG LAND (with a secondary scFv LAND targeting the primary IgG) of the construct shown, in which the MAdCAM-D1D2 protein was recombinantly fused to the Fc region of rat IgG2a, replacing the primary IgG targeting moiety. In the original ASSET design, the scFv was immediately followed by the NLPA lipidation sequence (lipidated peptide portion - SEQ ID NO: 17) and the first 11 amino acid linker (Linker #1; SEQ ID NO: 18), and was located before the second 11 amino acid linker (Linker #2; SEQ ID NO: 21), followed by the functional protein (mCherry - SEQ ID NO: 22). In the LAND, the order of the scFv and mCherry was swapped, resulting in a new linker containing 13 amino acids (Linker 3: ASGGSGGGKASGG, SEQ ID No: 1).

[0326] Molecular cloningThe original plasmid for expressing the original ASSET-RG7 protein in E. coli was constructed as described by Kedmi et al. (Nat. Nanotechnol. 13(3):214-219, 2018). All other plasmids described herein were constructed in a similar manner using PCR amplification and Gibson assembly (Gibson et al., Nat Methods 6(5):343-345 2009). For verification, the nucleotide sequences of all plasmids (before protein production) were determined using an ABI 3500XL Genetic Analyzer (Applied Biosystems, USA) according to the supplier's recommendations.

[0327] The coding sequences for all components were cloned into the pET30a plasmid backbone, which carries kanamycin resistance. Expression was performed in E. coli strain Lemo21(DE3) from New England Biolabs. Lemo21(DE3) is an E. coli strain suitable for expressing challenging recombinant proteins under the control of a regulatable T7 promoter. The sequence of the RG7-LAND open reading frame is shown in SEQ ID No. 2 (DNA sequence) and SEQ ID No. 3 (amino acid sequence).

[0328] The expression and purification of lipidated RG7-LAND protein were performed as described by Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018) and are described in detail below.

[0329] Materials for the production of lipidated scFv micelles

[0330] Buffer A1 (40 ml per 500 ml culture): 20 mM Tris pH 8.0 (1 M stock solution diluted 50 times), 10 mM EDTA (0.5 M stock solution diluted 50 times), 4 mg lysozyme (100 μg / ml), protease inhibitor cocktail (cOmplete, Roche).

[0331] Buffer A2 (20 ml per insoluble pellet from a 500 ml culture volume): 20 mM Tris pH 8.0 (1 M stock solution diluted 50-fold), 1% Triton X-100 detergent (25% stock solution) and

[0332] 25 150 mM NaCl (5 M stock solution).

[0333] Buffer A3 150 mM NaCl, 20 mM Tris pH 8.0, 1.4% octylglucoside detergent (OG, Sigma (now Roche), Israel).

[0334] Preparation of lipidated scFv:

[0335] Day 1: Lemo21 / pET30a-RA-RG7 cells were grown in 500 ml LB + 50 μg / ml kanamycin in a 2 L shake flask at 37° C. with shaking at 240 RPM. When the cells reached OD600 = 0.9, the cells were induced overnight (ON) with 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) at 18° C.

[0336] Day 2: The induced cells were collected by centrifugation at 4,000 RPM for 20 min at 4°C in a SLC3000 Sorvall rotor. The pellet was frozen and kept at -80°C. After 2 hours or more at -80°C, the cell pellet was thawed on ice and suspended in 40 ml of buffer A1 using a cell diffuser. After intermittent shaking at room temperature for 30 minutes, the cells were disrupted by homogenization with a large probe of a Tissueemizer (stainless steel blade electric tissue homogenizer) for 20 seconds. Next, the cells were sonicated on ice water using a large ultrasonic probe for 3 cycles of 30 seconds each, with at least 1 minute between each cycle. To remove soluble proteins from the lysate, the lysate was centrifuged at 16,000 RPM for 30 minutes at 4°C in a Sorvall SS34 rotor using a Sorvall SS34 tube. The pellet (containing the lysed E. coli cell membrane fraction and other insoluble proteins) was homogenized with a Tissueemizer probe in 20 ml of buffer A2 and triturated at maximum speed for 1 minute. Next, to completely extract the lipidated scFv from the cell membranes, the extract was sonicated for 1 minute using a sonicator probe at 50% power (power level approximately 5) over ice water. The extract was further incubated at room temperature (RT), rotated for 30 minutes, and then centrifuged at 16,000 RPM for 30 minutes at 4°C using a Sorvall SS34 tube. The supernatant was designated the Triton fraction (TF). The pellet, containing other insoluble proteins (e.g., inclusion bodies), was discarded. The Triton fraction was adjusted to 5 mM imidazole (ID). A 1 ml His-Trap column (GE Healthcare Life Sciences) was equilibrated with 10 column volumes (CV) of buffer A1 adjusted to 5 mM ID (column loading buffer), and TF was loaded at 0.5 ml / min. The column was washed and eluted at 1 ml / min. The unbound fraction (Ni-FT, e.g. Figure 2The column (shown at the bottom) contained nearly identical amounts of total protein, but lacked LAND protein. The column was washed with 10 CV of 5 mM id Buffer A2. The column was washed with 10 CV of 5 mM id Buffer A3. The latter wash used OG detergent instead of Triton X-100 detergent. The column was washed with 10 CV of 20 mM id Buffer A3. The column was eluted with 2 x 5 ml of 250 mM id Buffer A3.

[0337] 10 ml of the combined eluate was concentrated to approximately 2.5 ml using a Centricon 10000 (Centrifugal Filter Unit, Merck, Israel) at 3,000 RPM at 18°C. For desalting (buffer exchange to buffer A3 without ID), a 10 ml Zeba desalting column (Thermo Fisher Scientific, USA) was equilibrated with buffer A3 (×3). The concentrated LAND protein was then loaded and recovered by centrifugation. All centrifugations were performed at 1000×g and 4°C for 2 minutes. Protein concentration was determined using a protein assay kit (e.g., Bradford). The reliability of measurements at 280 nm using a Nanodrop was found to be low in this step. The protein concentration was adjusted to 0.5 mg / ml using buffer A3.

[0338] Cholesterol (Avanti Polar lipids, USA) was added to 250 mM (from a 38.7 mM ethanol stock solution), and the OG micelles were further spun at 100 RPM for 30 minutes at room temperature. 100 μl aliquots were prepared and stored at -80°C. The final product obtained was lipoprotein bound to OG detergent micelles, which were stabilized by cholesterol. When these micelles were mixed with LNPs, they were incorporated into the LNPs, becoming a permanent component of the LNPs. Figure 2 A representative purified aliquot analyzed by SDS / PAGE is shown.

[0339] Preparation of LNPs

[0340] LNPs were prepared essentially as described by Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018). Two types of ionizable lipids were used: Dlin-MC3-DMA (MC3) was synthesized according to the method of Cohen et al. (ACS Nano 9(2): 1581-1591, 2015). EA-PIP (lipid 10) was synthesized according to the method of Ramishetti et al. (Adv Mater 32(12): e1906128, 2020). All other lipids were obtained from Avanti Polar lipids. Briefly, one volume of an ethanolic lipid mixture (ionizable lipid, DSPC, cholesterol, DMG-PEG, molar ratio of 50:10.5:38.5:1.4) and three volumes of acetate buffered siRNA (1:16 w / w ratio to lipid) were injected into a microfluidic mixing device Nanoassemblr (Precision Nanosystems, VanCouver, BC) at a combined flow rate of 12 ml / min.

[0341] The resulting mixture was dialyzed against phosphate-buffered saline (PBS) (pH 7.4) for 16 hours to remove ethanol and residual unincorporated lipids. Cy5-labeled particles were prepared with scrambled control siRNA (siNC)) and Cy5-labeled siNC in a 1: 1 ratio. Targeted LNPs or isotype control LNPs were prepared using ASSET technology. Briefly, ASSET or LAND OG micelles were incubated with LNPs at 4°C for 48 hours to allow their incorporation into LNPs (ASSET or LAND protein: siRNA weight ratio of 1: 36). Typically, 40 ng of purified lipidated scFv in OG micelles was mixed per 1 microliter of LNP. The lipidated scFv incorporated into the LNP was measured by mCherry fluorescence and ELISA.

[0342] To evaluate the cell targeting of original ASSET compared to LAND, a set of experiments was performed. First, RG7-ASSET and RG7-LAND were compared for antigen binding to rat IgG2a by ELISA and FACS. Next, the targeting ability of RG7-ASSET and RG7-LAND to TK-1 cells (which express α4β7 integrin on their surface) via D1D2-Fc was compared.

[0343] Materials used in flow cytometry experiments

[0344] Cell line: TK-1 (or other cells described in the Examples). Targeting moiety: D1D2-Fc (MAdCAM fused to rat IgG2a Fc as described by Dammes (Nature Nanotech. 16:1030–1038, 2021). Isotype control: rat IgG2a, which does not bind to TK1 cells. LNP: Mc3 lipid (+Cy5 fluorescently labeled siRNA).

[0345] FACS samples:

[0346] 1. Unstained cells (US in all flow cytometry images)

[0347] 2. [TK-1 + isotype control] + LNPs-RG7 ASSET

[0348] 3.[TK-1+D1D2-Fc]+LNPs-RG7 ASSET

[0349] 4. [TK-1 + isotype control] + LNPs-RG7 LAND

[0350] 5.[TK-1+D1D2-Fc]+LNPs-RG7 LAND

[0351] Flow cytometry protocol:

[0352] Day 0: ASSET and LAND proteins were added to MC3 / Cy5 LNPs at 40 ng / ml.

[0353] Proteins tested:

[0354] A.RG7 ASSET

[0355] B. RG7 LAND (or other lipidated scFv as described in the Examples)

[0356] The tubes were vortexed briefly and incubated at 4°C for 48 hours.

[0357] Day 2: TK-1 cells were activated according to the method of Yang et al. (Scand J Immunol 42(2):235-247, 1995). Briefly, activation involved exposing cells to Mn 2+ ions, causing the α4β7 integrin to switch to the HA conformation (compatible with MAdCAM-1 binding). Flow cytometry experiments were performed on a CytoFLEX (Beckman Coulter, USA).

[0358] Flow cytometry cell preparation and analysis protocol:

[0359] Cells were washed with PBS (0.5 to 1 million cells / sample) and collected by spinning at 300 × g for 5 minutes. Cells were then washed in resuspension buffer (HBSS (w / o) containing 10 mM HEPES buffer, 2 mM CaCl2, and 2 mM MgCl2) at 100 μl / sample. Cells were incubated in pre-incubation buffer (HBSS (w / o) containing 10 mM HEPES buffer and 2 mM EDTA). Cells were incubated with gentle rotation at room temperature for 30 minutes (100 μl / sample). ASSET-LNPs or LAND-LNPs were incubated with D1D2-Fc or isotype control (at a concentration of 1 μg / sample) at room temperature for 30 minutes. Cells were washed with PBS to remove EDTA. Cells were incubated in activation buffer (100 μl / sample, complete medium containing 2 mM CaCl2 and 2 mM MnCl2) to convert cell surface 47 integrins to an active conformation that binds to MAdCAM. ASSET-LNP or LAND-LNP were immediately added to the cells and placed on ice for 20 minutes. The cells were washed with PBS and analyzed by flow cytometry (Cy5 channel) on a CytoFLEX (Beckman Coulter, USA).

[0360] Methods using anti-EGFR antibodies

[0361] These experiments were performed in an almost identical manner, except that the target cells were OVCAR8 (EGFR + The primary antibody was a commercially available rat IgG2a anti-human EGFR (anti-hEGFR, clone 30-F11, Bio-Rad).

[0362] result:

[0363] First, the binding of purified OG micelles of RG7-ASSET and RG7-LAND to Fib504 rat IgG2a was directly compared. Figure 3A As shown, RG7-LAND and RG7-ASSET bind with similar (but not identical) affinities, with RG7-LAND having a higher apparent affinity (IC50) of 18 nM compared to RG7-ASSET with an IC50 of 36 nM. Similar results were obtained when purified OG micelles of RG7-ASSET and RG7-LAND were directly compared for binding to anti-human EGFR rat IgG2a ( Figure 4A RG7 LAND binds to anti-human EGFR rat IgG2a with a higher apparent affinity (IC50) of approximately 80 nM compared to RG7-ASSET, which has an IC50 of approximately 100 nM.

[0364] Next, MC3 nanoparticles incorporating scFv lipidated with RG7-LAND or RG7-ASSET were prepared and their performance in directing Fib504 rat IgG2a-mediated binding to cells was compared. Flow cytometry experiments were performed as described above. Figure 3B As shown, the binding of the RG7-LAND configuration to TK-1 cells was improved in the presence of the primary antibody Fib504 compared to the RG7-ASSET configuration.

[0365] A similar experiment was subsequently performed in which the primary antibody was anti-human EGFR rat IgG2a. The target cells were EGFR + Mc3 nanoparticles incorporating RG7-LAND or RG7-ASSET proteins were prepared and evaluated for their performance in directing rat IgG2a-mediated binding to OVCAR8 cells. Flow cytometry results are shown in Figure 2. Figure 4B As shown in the figure, the binding of the RG7-LAND configuration to cells was improved compared to the RG7-ASSET configuration in the presence of an anti-human EGFR targeting primary antibody.

[0366] The performance of MAdCAM-1D1-D2-Fc-mediated cell binding was further compared by flow cytometry. Figure 5 As shown, D1D2-Fc incorporated into LNPs via RG7-LAND was able to bind to activated TK-1 cells, whereas that incorporated via RG7-ASSET was unable to do so.

[0367] Example 2

[0368] "LAND with primary scFv targeting" based on the anti-EGFR antibody Erbitux

[0369] Prepared as Figure 1C The lipidated scFv derived from the cell-binding antibody shown (with LAND as the primary scFv targeting) was used. First, Erbitux (cetuximab), a therapeutic chimeric monoclonal antibody based on binding to human epidermal growth receptor (EGFR), was used. By replacing the coding sequence of the scFv of Erbitux with Figure 1B The expression vector was constructed by combining the RG7 scFv sequence of the LAND plasmid in the PCR product. The sequence of the Erbitux-LAND open reading frame is shown in SEQ ID No. 4 (DNA sequence) and SEQ ID No. 5 (amino acid sequence). It is worth noting that in the configuration with primary scFv targeting, the "Linker #3" (e.g. Figure 1BExample 2 is Figure 1C Representative.

[0370] Erbitux-LAND protein was prepared and purified according to the general protocol described above, and its functionality was tested by flow cytometry.

[0371] SEQ ID No. 4: DNA sequence encoding Erbitux-LAND (anti-human EGFR) (with primary scFv targeting LAND):

[0372] SEQ ID No. 5: Erbitux-LAND (anti-human EGFR) (LAND with primary scFv targeting) amino acid sequence:

[0373] method: Flow cytometry experiments were performed essentially as described in Example 1, except that OVCAR8 cells (EGFR-positive ovarian cancer cell line) were used. 2+ Activation. Instead, cells were incubated with LNPs or OG micelles in complete medium (containing 10% FBS). Binding of Erbitux-LAND OG micelles to cells was monitored by measuring mCherry fluorescence. Binding of LAND-containing LNPs was monitored by measuring Cy5 fluorescence of labeled siRNA encapsulated in the LNPs.

[0374] result:

[0375] As shown in Figure 6, LAND ("LAND with primary scFv targeting") protein micelles and lipid nanoparticles (LNPs) prepared from two different lipids (EA-PIP and MC3) bound to OVCAR8 cells. These results indicate that lipidated Erbitux scFv is functional and effective in cell targeting. In addition, the binding specificity of Erbitux-targeted LNPs was further verified by competition, in which Erbitux mAb was used as a competitor in flow cytometry experiments. The competition of Erbitux-LAND-targeted LNPs for binding to OVCAR8 cells was confirmed. Figure 7 As shown, the binding signal of Erbitux-LAND-targeted LNPs to OVCAR8 cells was inhibited (leftward shift) in the presence of Erbitux mAb compared to the signal obtained in the presence of anti-VEGF mAb Avastin (as an isotype control) that did not bind to OVCAR8 cells.

[0376] To further evaluate the potential efficacy of Erbitux-LAND (NLPA-Erb = Erbitux "LAND with primary scFv targeting") in killing tumor cells compared to Erbitux-ASSET (Erbitux ASSET with primary IgG targeting), a cell viability assay was performed comparing different EGFR-targeted and isotype control LNPs. The LNPs contained siRNA PLK1 (PLK1 is a kinase required for mitosis) or a negative control siRNA. When PLK1 function is inhibited, G2-M cell cycle arrest and cell death occur in dividing cells (Rosenblum et al., Sci. Adv. 6: eabc9450, 2020). The efficacy of LAND was compared with ASSET under conditions that minimize nonspecific internalization of LNPs (4°C) and standard conditions (37°C). OVCAR8 cells were treated in vitro with 2 μg / ml EA-PIP LNPs (where nonspecific LNP internalization was minimized) for 1 h at 4°C, washed to remove uninternalized LNPs, supplemented with fresh medium and cultured for 72 h before assessing cell viability using the XTT assay.

[0377] The results are shown in Figure 8. Figure 8A In the present study, treatment of OVCAR8 cells with LNPs for 1 hour at 4°C reduced the nonspecific uptake of LNPs, which mainly reflected the antibody-mediated internalization of the LNPs. Under these conditions, LNPs targeted by Erbitux-LAND and encapsulated siPLK1 were more effective than LNPs targeted by RG7-LAND (as a negative control). More importantly, LNPs targeted by Erbitux-LAND were statistically more effective than LNPs targeted by RG7-LAND in combination with an anti-EGFR primary antibody (ASSET primary IgG targeting). This suggests that the "LAND with primary scFv targeting" approach using Erbitux-LAND is more efficient in achieving antibody-mediated LNP internalization than the original mAb targeting primary IgG. This result was most unexpected, as intact IgG molecules are known to have higher avidity than their corresponding scFv fragments (or, as in this case, scFv derived from IgG with similar affinity and specificity). As Figure 8B As shown in Figure 3, under standard conditions (37°C), Erbitux-LAND (NlpA-Erb) had statistically higher efficacy than Erbitux-ASSET. Unexpectedly, under both conditions ( Figure 8A of 4℃) and standard conditions ( Figure 8BAt 37°C (400 nmol / L), LAND-targeted LNPs (NlpA-Erb) exhibited statistically significant increased efficacy compared to ASSET-targeted LNPs (ASSET-EGFR) (*p<0.05; **p<0.01; ***p<0.005; ****p<0.001).

[0378] Statistically better efficacy of primary scFv LAND with primary scFv targeting compared to previous ASSET compositions (see Figure 1G ) was surprising, since the intact IgG molecule with two antigen-binding sites used in ASSET was known to have higher avidity than the scFv fragment used in LAND with primary scFv targeting.

[0379] To investigate the potential of Erbitux-LAND for the treatment of cancer models in vivo, the OVCAR8 xenograft model in nude mice was used. Female athymic nude mice aged 8 to 10 weeks were injected intraperitoneally with 3 × 10 6 OVCAR8 cells expressing mCherry were used to induce xenografts.

[0380] On day 14, mice were imaged by in vivo imaging system IVIS-Lumina III (Perkin Elmer, USA) and divided into groups so that the tumor burden based on mCherry signal was evenly distributed among the groups.

[0381] For cellular uptake studies, EA-PIP LNPs encapsulating Cy5-labeled siNC (negative control, siRNA did not silence any genes in these cells) were injected intraperitoneally at 0.75 mg / kg in a total volume of 200 μl / mouse. Mice were given a single dose on day 18, and tumors were recovered 4 hours after injection, and LNP uptake was analyzed by flow cytometry. The gating strategy and cellular uptake ratios are shown in Figure 9.

[0382] Analyze flow cytometry data to identify Cy5-positive mCherry + The ratio of cells (tumor cells that took up LNP) and Cy5-positive CD45 + As shown in Figure 9 , there were no statistically significant differences between the groups. However, a trend of preferential uptake by tumor cells was observed in the Erbitux-LAND group (labeled as NlpA-Erb in Figure 9 ) compared to the control group (NlpA-RG7) and the ASSET-EGFR group.

[0383] The ability of different EGFR-targeted LNPs to induce gene silencing in tumors in vivo was evaluated. LNPs encapsulating siPLK1 or control siRNA were injected intraperitoneally at a dose of 0.75 mg / kg in a total volume of 200 μl per mouse. Mice were given a single dose on day 16. The extent of PLK1 silencing in tumors was determined by RT-PCR. Tumors were harvested on day 18 for RNA extraction.

[0384] like Figure 10 As shown in Figure 2, the “original ASSET” approach showed enhanced tumor uptake selectivity compared to the isotype control in this model. Compared to the control NlpA-RG7, siPLK1 LNPs targeted with Erbitux-LAND (in Figure 10 Tumors from mice treated with LNPs targeting the RG7 ASSET protein (labeled as NlpA-Erb in Figure 8) had lower PLK1 mRNA levels. This selectivity was not observed in mice treated with LNPs targeting the RG7 ASSET protein in combination with rat IgG2a anti-human EGFR or an isotype control. Consistent with the in vitro results shown in Figure 8, Figure 10 The in vivo data in were also surprising, as intact IgG molecules are known to have higher avidity than monovalent scFv fragments. Only the Erbitux-LAND construct, but not the ASSET-EGFR construct, showed statistically significant efficacy compared to their controls.

[0385] In summary, the experiments demonstrated that LAND with primary scFv antigen targeting exhibited statistically superior efficacy compared to the original ASSET LNPs, which utilize lipidated secondary scFvs and primary IgG antigen targeting. In addition to its superior efficacy, LAND is simpler in configuration compared to ASSET, which requires a lipidated scFv (secondary) to bind to the primary IgG, making it an attractive approach for LNP targeting with lipidated primary scFvs. Importantly, the superior efficacy results of LAND with primary scFv targeting are surprising, as intact IgG molecules are known to have higher affinity than the monovalent scFv fragments (or, in this case, scFvs derived from IgGs of similar affinity and specificity) used in LAND with primary scFv targeting. The ability to achieve superior or equivalent efficacy with primary scFv targeting (LAND) compared to secondary scFv targeting (ASSET) is significant, as secondary scFv targeting requires the production and conjugation of an additional targeting IgG antibody, which significantly increases the complexity and cost of manufacturing the final product.

[0386] Example 3

[0387] "LAND with primary scFv targeting" based on the anti-CD38 antibody THB-7

[0388] To further evaluate the general applicability of LAND with primary scFv targeting, a LAND scFv primary targeting construct based on the anti-CD38 antibody THB-7 was tested. Figure 1C Another example of a composition type "C" is shown, which contains a functional protein and a "primary" scFv sequence specific for an antigen expressed on the cell type to be targeted for therapy. CD38 is expressed on the surface of immature hematopoietic cells, including immature B cells. Its expression is tightly regulated during B cell ontogeny. It is expressed on myeloid precursors but not on mature B cells. In addition, CD38 is overexpressed in many B cell malignancies, including mantle cell lymphoma (MCL) and multiple myeloma (MM) cells. CD38 has been shown to be a suitable target for antibody-mediated delivery of therapeutic siRNA to MCL. siRNA-LNPs coated with an anti-CD38 monoclonal antibody (anti-CD38 mAb THB-7) showed specific MCL binding both in vitro (in MCL cell lines and MCL primary lymphomas) and in vivo (in mice xenografted with human MCL cell lines) (Weinstein et al., PNAS 113(1):E16-22, 2016), where the THB-7 mAb was chemically coupled to the MC3 LNPs.

[0389] The preparation of THB-7-based lipidated scFv (THB-7-LAND) with “LAND with primary scFv targeting” is similar to that based on Figure 1C The sequences of the THB-7LAND open reading frames are shown in SEQ ID No. 7 (DNA sequence) and SEQ ID No. 8 (amino acid sequence), respectively. Lipidated THB-7scFv was incorporated into EA-PIP LNPs, and their binding to CD38 was evaluated by flow cytometry. + Combination of Z138 (MCL) and CAG (MM) cells.

[0390] SEQ ID No. 7: THB-7-LAND (anti-CD38) (LAND with primary scFv targeting) encoding DNA sequence:

[0391] SEQ ID No. 8: THB-7-LAND (anti-CD38) (LAND with primary scFv targeting) amino acid sequence:

[0392] Methods: Flow cytometry experiments were performed as follows:

[0393] Materials used for flow cytometry experiments:

[0394] Cell lines: CAG and Z138

[0395] Targeting moiety: THB-7LAND Isotype control: RG7 LAND

[0396] LNP: EA-PIP lipid (+Cy5 fluorescently labeled siRNA)

[0397] FACS samples:

[0398] 1. Unstained (US);

[0399] 2. CAG / Z138+LNP with RG7-LAND;

[0400] 3. CAG / Z138+LNP with THB-7-LAND;

[0401] 4. CAG / Z138+RG7-LAND OG micelles (+ anti-His-PE antibody for detecting LAND protein contained in OG micelles);

[0402] 5. CAG / Z138+THB-7-LAND OG micelles (+ anti-His-PE antibody).

[0403] Day 0: RG7-LAND and THB-7-LAND proteins were added to EA-PIP / Cy5 LNPs at 40 ng / ml (for Z138 cells) and 60 ng / ml (for CAG cells). The tubes were vortexed briefly and incubated at 4°C for 48 hours.

[0404] Day 2: Flow cytometry experiments were performed on a CytoFLEX (Beckman Coulter, USA).

[0405] FACS protocol:

[0406] The cells were washed with PBS (0.5 to 1 million cells / sample) and centrifuged at 300 × g for 5 minutes. The cells were then incubated on ice for 20 minutes with complete medium containing any of the following components: RG7-LAND-LNP, THB-7-LAND-LNP, or LAND micelles. The cells were washed with PBS. 1 μg of anti-His-PE antibody diluted in FACS buffer (1% BSA + PBS) was added to the cells incubated with LAND micelles and incubated on ice for 30 minutes. The cells were washed with PBS and analyzed by flow cytometry (reading the Cy5 channel).

[0407] result: As shown in Figure 11, similar to Erbitux-LAND, THB-7-LAND (in Figure 11A and11C Protein micelles and EA-PIP LNPs (labeled as ASSET-THB7 in the Figure 5) bound to Z138 (MCL) and CAG (MM) cells, whereas control RG7 OG micelles or LNPs (labeled as ASSET-THB7 in the Figure 5) did not bind to Z138 (MCL) and CAG (MM) cells. Figure 11A and 11C These results demonstrate the functionality and effectiveness of lipidated THB-7 scFv in targeting hematopoietic cell subsets, particularly malignant B cells.

[0408] Example 4

[0409] Example 4 evaluates additional LAND constructs in which the linker does not encode a separate functional protein (eg, a detectable protein) and their potential for therapeutic use. Example 4 is representative of Figures "1D" and "1E."

[0410] These LAND expression vectors were constructed by replacing the mCherry coding sequence of the pET30a RG7 expression plasmid with the coding sequence of a 45-amino acid-long linker, e.g. Figure 1D and 1E The sequence of the 69 amino acid RG7-LAND "long linker" spans the lipidated peptide and the scFv ( Figure 1D and 1E Linker #5 in ); (SEQ ID No.10 protein sequence, SEQ ID NO:9 DNA sequence).

[0411] Figure 1E The example of a construct shown in includes a long linker with a scFv specific for the EGFR antigen recognized by Erbitux:

[0412] SEQ ID No. 15 is an exemplary Erbitux-LAND "long linker" (anti-human EGFR) encoding DNA sequence.

[0413] SEQ ID No. 16 is an exemplary amino acid sequence of Erbitux-LAND "long linker" (anti-human EGFR).

[0414] The following provides Figure 1E Another example of a construct including a long linker with scFv specificity for the CD38 antigen recognized by THB-7 is shown in:

[0415] SEQ ID No 17. THB-7-LAND "long linker" (anti-CD38) encoding DNA sequence.

[0416] SEQ ID No 18. THB-7-LAND "long linker" (anti-CD38) amino acid sequence.

[0417] In a representative experiment, the RG7-LAND "long linker" protein was expressed in E. coli and purified by His-Trap Ni-NTA chromatography as described above and applicable to other LAND proteins. The binding of purified RG7-LAND and RG7-LAND "long linker" in OG micelles to Fib504 (rat IgG2a anti-human β7 integrin, to which RG7 scF binds) was evaluated by ELISA. The ELISA was performed as follows: 96-well ELISA plates (Nunc, Sweden) were coated with 5 μg / ml antigen (Fib504 rat IgG2a, to which RG7 binds) diluted in PBS at 4°C overnight. After washing once with PBS containing 0.05% Tween 20 (PBST), the plates were blocked with 3% skim milk in PBS at 37°C for 1 hour. After washing again with PBST, a high initial concentration (50 nM) of purified LAND protein was added to the plates in a serial 3-fold dilution of the OG micelle solution. The plate was incubated at room temperature for 1 hour. Next, the plate was washed 3 times with PBST and the appropriate HRP-conjugated secondary Ab (HRP-conjugated anti-His tag antibody) diluted 5000-fold in PBST was added and incubated at room temperature for 1 hour. After washing 3 more times with PBST, ELISA was performed using TMB peroxidase-substrate solution until color was developed. 1M H2SO4 was added to stop color development and the plate was incubated by The absorbance was measured at 450 nm using a ELISA Plus microplate reader (Molecular Devices, USA).

[0418] The results are shown in Figure 12. As shown in the figure, the RG7-LAND "long linker" (IC50 of 4 nM) binds better to rat IgG2a than RG7-LAND (IC50 of 8 nM), indicating that the long linker was successfully designed in terms of the antigen binding function of the LAND protein.

[0419] Next, EA-PIP LNPs were prepared with RG7-LAND or with RG7-LAND "long linker". Their binding to TK-1 cells (expressing β7 integrin) was assessed by flow cytometry in the presence of Fib504 (anti-β7 integrin) rat IgG2 or in the presence of an isotype control. Flow cytometry was performed as described in Example 1 above, with the following exceptions: cells were not treated with Mn 2+ Instead, cells were incubated with LNP or OG micelles in complete medium (containing 10% FBS). Figure 13 As shown in the figure, with RG7-LAND ( Figure 13Compared with RG7-LAND "long linker" ( Figure 13 This further demonstrates that the design of the long linker was successful in terms of the function of LAND with the “long linker” protein in antigen binding.

[0420] In summary, the results show that LNPs prepared with the RG7-LAND "long linker" bind better to cells than LNPs prepared with the original (mCherry-containing) RG7-LAND. Therefore, the design of the long linker is successful in terms of the functionality of the LAND protein in antigen binding.

[0421] Example 5

[0422] To demonstrate the potential of LAND primary scFv targeting for gene editing applications, a cell viability experiment similar to that described in Example 2 was performed comparing tumor-targeted primary scFvs and isotype control LNPs. Tumor cells expressing one of the primary scFVs listed in Table 1 were used for targeting, but instead of carrying PLK1 siRNA and controls, they were delivered with mRNA encoding the CRISPR base editor BE3 and a guide RNA for a region of PLK1 that converts CAA, CAG, CGA, and TGG codons to STOP codons when the targeted base is at the correct distance from the protospacer adjacent motif (PAM) (13 to 17 bps). The following guide RNAs, genomic coordinates, and target codons for PLK1 were used—lowercase bases in the PAM:NGG column indicate the target base for editing:

[0423] Table 8

[0424] Gene name Genomic coordinates Target codon PAM:NGG PLK1 23687522 CGA SEQ ID No.31GGTTcGAGAGACAGGTGAGG PLK1 23687621 CAA SEQ ID No.32TCAGGcAAGGTGGGTACTGC PLK1 23688704 TGG SEQ ID No.33GACCcAGAAGATGGGGATGC PLK1 23688705 TGG SEQ ID No.34GACcCAGAAGATGGGGATGC PLK1 23689321 CAG SEQ ID No.35CTGcAGTACATAGAGCGTGA PLK1 23689609 TGG SEQ ID No.36CGGAACcAGGTCCCGTAGGTA PLK1 23689610 TGG SEQ ID No.37CGGAAcCAGGTCCGTAGGTA

[0425] Control groups included LNPs that omitted or contained an irrelevant guide LNP or uncoated LNP or LNP with a lipidated isotype control scFV. Methods for preparing anti-tumor scFV LAND LNPs are described in Examples 1 to 4, and methods for performing cell viability assays are described in Example 2. Consistent with the experiments in Example 2, LAND with primary scFv targeting showed statistically significant increased efficacy compared to controls, demonstrating the utility of LAND for gene editing applications incorporating inactivated CRISPR / Cas systems (e.g., base editors).

[0426] To further demonstrate the potential of LAND primary scFv targeting for gene editing applications, cell viability experiments similar to those described in Examples 2 and 5 were performed to evaluate tumor-targeted primary scFv LAND LNPs that deliver mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) and guide RNA to inhibit the function of genes that promote tumor growth. + To investigate the ability of anti-CD38 scFV LAND LNPs to target hematopoietic cancers, we used a representative CD38-expressing mantle cell lymphoma (MCL Z138) tumor model. In these studies, MCL Z138 tumor cell viability was assayed using anti-CD38 scFV LAND LNPs carrying mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) with a single guide RNA for SOX11, a cancer-promoting gene in MCL. A control group consisted of untreated MCL Z138 cells treated with similarly prepared anti-CD38 scFV LAND LNPs but with single guide RNAs for unrelated target genes (GFP and HPRT). The following single guide RNAs were used:

[0427] i.SOX11-SEQ ID No.38GGCGGTGCCAAGACCTCCAA

[0428] ii.PLK1-SEQ ID No.39ACCTCGGGAGCTATGTAATT

[0429] iii.EGFP–SEQ ID No. 40GACCAGGAUGGGCACCACCC and SEQ ID No. 41CCGGCAAGCTGCCCGTGCCC

[0430] iv.HPRT–SEQ ID No.42AATTATGGGGATTACTAGGA

[0431] The method for preparing anti-CD38 scFv LAND LNPs is described in Example 3, and the method for performing the cell viability assay is described in Example 2. Figure 14As shown, analysis of variance showed that the viability of MCL tumor cells treated with CD38-LNP (sgSOX11) was statistically significantly reduced compared to all control treatments (p < 0.05). In the CD38-LNP (sgSOX11)-treated group, cell viability was less than 10%, while cell viability was greater than 90% in the control CD38-LNP (sgGFP), CD38-LNP (sgHPRT) and untreated groups. These results indicate that LAND primary scFv-targeted LNPs can deliver CRISPR / Cas gene editing components to inhibit the function of genes that promote tumor growth, thereby performing effective tumor treatment. To demonstrate the efficacy of LAND for CD33-positive conditions, including but not limited to acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS), similar experiments were performed in hematopoietic cells expressing CD33, such as HL60 and MV4-11. In these studies, HL60 or MV4-11 tumor cell viability assays were performed using anti-CD33 scFv LAND LNPs carrying mRNA encoding a CRISPR-associated (Cas) nuclease (Cas9) with a single guide RNA for PLK1, an essential gene in AML and MDS. Control groups consisted of untreated HL60 and MV4-11 cells treated with similarly prepared anti-CD33 scFv LAND LNPs, but with single guide RNAs directed against unrelated target genes (GFP and HPRT). The method for preparing anti-CD33 scFv LAND LNPs is described in Example 3, and the method for performing the cell viability assay is described in Example 2. Analysis of variance showed that the viability of CD33-expressing tumor cells treated with CD33-LNPs (sgPLK1) was statistically significantly reduced compared to all control treatments.

[0432] Example 6

[0433] To further demonstrate the potential of LAND primary scFv targeting for gene editing applications, in vivo experiments were performed comparing tumor-targeted and isotype control LNPs that delivered mRNA encoding CRISPR-associated (Cas) nuclease (Cas9) and guide RNA to inhibit the function of genes that promote tumor growth. The same single guide RNA sequence described in Example 6 was also used in the in vivo experiments described in Example 7. + To investigate the hematopoietic capacity of hematopoietic cancer, we used the representative CD38-expressing mantle cell lymphoma animal model MCL Z138. Z138 tumor cells (approximately 1×10 6Cells (cells) were injected intravenously into SCID mice (n = 8 to 10 animals / group). In these studies, intravenous treatment began after tumor establishment, 10 and 15 days after tumor inoculation with LAND LNPs prepared as described in Example 3 at a dose of 0.5 mg / kg containing Cas9 mRNA and a single guide RNA, SOX11-CD38-LNP (sgSOX11). Control groups included mock treatment and LNP vectors with irrelevant scFv specificity or irrelevant sgRNA. Specifically, the control LNP vectors are CD38-targeted LNPs containing Cas9 mRNA and a single guide RNA for green fluorescent protein (GFP)--CD38-LNP (sgGFP); isotype control scFv LNPs containing Cas9 mRNA and a single guide RNA for SOX11--Iso-LNP (sgSOX11); and isotype control scFv LNPs containing Cas9 mRNA and a single guide RNA for GFP--Iso-LNP (sgGFP). To demonstrate the efficacy of LAND against CD33-positive diseases (including but not limited to acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS)), similar experiments were performed using representative CD33-expressing hematopoietic animal tumor models (such as HL60 and MV4-11). HL60 and MV4-11 tumor cells (approximately 1 to 5×10 6 Cells were injected intravenously or subcutaneously into immunodeficient mice (n = 8 to 10 animals / group). In these studies, intravenous treatment began after tumor establishment, 10 and 15 days after tumor inoculation with LANDLNPs prepared as described in Example 3 at a dose of 0.5 mg / kg containing Cas9 mRNA and a single guide RNA, PLK1-CD33-LNP (sgPLK1). Control groups included mock treatment and LNP vectors with irrelevant scFv specificity or irrelevant sgRNA. Specifically, the control LNP vectors are CD33-targeted LNPs containing Cas9 mRNA and a single guide RNA for green fluorescent protein (GFP) -- CD33-LNP (sgGFP); isotype control scFv LNPs containing Cas9 mRNA and a single guide RNA for PLK1 -- Iso-LNP (sgPLK1); and isotype control scFv LNPs containing Cas9 mRNA and a single guide RNA for GFP -- Iso-LNP (sgGFP).

[0434] Kaplan-Meier curves and log-rank tests showed that the survival rate of the group treated with LAND tumor-targeted LNPs (sgSOX11) was statistically significantly increased compared with all control treatments. Figure 15 As shown, Kaplan-Meier curves and log-rank tests showed that the survival rate of the group treated with CD38-LNP (sgSOX11) was statistically significantly increased compared to all control treatments (p < 0.0001). In the CD38-LNP (sgSOX11) group, 90% of the animals were alive on day 50, while all animals in the control group died before day 40. These in vivo results are consistent with the in vitro data shown in Example 6, further indicating that LAND primary scFv-targeted LNPs can deliver CRISPR / Cas gene editing components to inhibit the function of genes that promote tumor growth, thereby performing effective tumor treatment.

[0435] To further demonstrate the potential of LAND primary scFv targeting for safe and effective gene editing, the percentage of gene editing in sorted tumor cells extracted from tumors and normal liver (hepatocytes and macrophages) was assessed after in vivo treatment in the same representative hematopoietic tumor model used in Example 3. In these studies, after tumor establishment, intravenous injection of 2.0 mg / kg doses of LAND LNP containing Cas9 mRNA prepared as described in Example 3 and a single guide RNA for SOX11--CD38-LNP (sgSOX11) was initiated. Control groups included mock treatment and LNP vectors with irrelevant scFv specificity or irrelevant sgRNA, such as Figure 15 As an additional control, mice (N=5 / group) received a single intravenous injection of doxorubicin at a dose of 1 mg / kg or 2.5 mg / kg. Following treatment, genomic DNA was extracted from MCL tumor cells and normal hepatocytes, and INDELs were analyzed by next-generation sequencing (NGS).

[0436] QuickExtract DNA extraction solution (Lucigen Inc.) was used according to the manufacturer's protocol to extract MCL (GFP +Genomic DNA was extracted from single-cell suspension sections of 1000 cells and amplified using locus-specific primers containing universal tails. Sample-specific P5 and P7 indices were increased through two rounds of polymerase chain reaction (PCR) for Illumina sequencing. After PCR, the DNA was purified using 1× SPRI (solid-phase reversible immobilization) magnetic beads before sequencing. The library was quantified by quantitative PCR and then sequenced. PCR amplicons were sequenced on an Illumina MiSeq instrument (v2 chemistry; 150 base pair (bp) paired-end read length; Illumina, San Diego, CA, USA). Data analysis was performed using a custom protocol. The data were demultiplexed (Picard tools v2.9; githubdotcom / broadinstitute / picard); forward and reverse reads were merged into extended amplicons (flash v1.2.11); reads were aligned to the GRCh38 genome reference (bwa mem v0.7.15) and assigned to targets (bedtools tags v2.25). For reads containing more than 30% bases with high-quality targets, custom Python identified INDELs based on gap alignments between the reads and the target, and edits were calculated as the percentage of total reads containing an INDEL within an 8-bp window of the cut site. Results are shown in Figure 2. Figure 16A The results were published in the journal Cell Biology and revealed that 95% of tumor cells were edited by treatment with a single guide RNA, SOX11-CD38-LNP (sgSOX11), compared to 0 to 4% of tumor cells in controls, which included untreated animals or treated with similarly prepared LNP vectors with an unrelated sgRNA. Figure 15 These differences were statistically significant by analysis of variance (ANOVA) with Tukey's multiple comparison test. **P<0.001.

[0437] The advantages of LAND in in vivo gene editing treatments were also demonstrated compared to standard chemically conjugated antibody LNP targeting methods. In these evaluations, an additional treatment group was tested using anti-CD38-targeted LNPs prepared using the chemical conjugation method. Chemically conjugated CD38-targeted LNPs (chemical CD38-LNPs-sgSOX11) utilized the same lipids, Cas9 mRNA, and SOX11 sgRNA as Figure 16A The chemical conjugation of anti-CD38 to LNPs was previously performed as described by Tarab-Ravski et al. (2023). Briefly, at room temperature, 1×10 3 m dithiothreitol (Sigma-Aldrich) and 5×10 3Anti-human CD38 IgG antibody (clone THB-7, BioXcell) was reduced with mEDTA (Sigma-Aldrich) for 1 hour. Subsequently, dithiothreitol was removed using a 7K Zeba spin desalting column (ThermoFischer Scientific) according to the manufacturer's instructions, and the reduced antibody was immediately added to the LNP at a ratio of 1:40.7 antibody to LNP (mg / mg), incubated with gentle shaking at room temperature for 2 hours and at 4°C overnight. To remove free uncoupled mAbs, the LNP was loaded onto CL4B agarose beads (Sigma-Aldrich) and purified by gravity feed gel filtration chromatography column (BioRad Laboratories) using PBS as the mobile phase. Fractions were collected using an FC-203B fraction collector (Gilson), and anti-CD38 LNP fractions were collected using 100K Amicon tubes (Millipore) and concentrated to the original volume. After tumor formation, intravenous injection of chemical CD38-LNPs-sgSOX11 was similarly initiated at a dose of 2.0 mg / kg, and the results were compared with those of Figure 16A The results of the same treatment groups described in were compared. Figure 16B As shown, LAND CD38-LNPs-sgSOX11 achieved significantly higher tumor gene editing rates than chemical CD38-LNPs-sgSOX11 (>95% vs <40%). In addition, LAND significantly reduced "off-tumor" gene editing in normal liver cells (hepatocytes and macrophages) compared to chemically conjugated LNP treatment (<4% vs >40%). These differences were statistically significant (p < 0.0005) using analysis of variance (ANOVA) with Tukey's multiple comparison test. The significantly superior results of LAND over chemically conjugated antibody-targeted LNPs were unexpected because the lipidated scFv antibody used in LAND has only one binding site, compared to the two binding sites of the antibody used for chemically conjugated LNPs.

[0438] like Figure 16B As shown in Figure 2, the advantages of LAND compared to standard chemically conjugated antibody LNP targeting in therapeutic applications have been demonstrated. In these evaluations, an additional treatment group was tested using anti-CD38 LNPs prepared using the chemical conjugation method. Chemically conjugated CD38-targeted LNPs (chemical CD38-LNPs-sgSOX11) utilized the same lipids, Cas9 mRNA, and SOX11 sgRNA as Figure 16AAs shown. Chemical conjugation of anti-CD38 to LNPs was performed as previously described by Tarab-Ravski et al. (2023). Similarly, 10 days after tumor formation, intravenous injection of chemical CD38-LNPs-sgSOX11 was similarly started at a dose of 2.0 mg / kg, and the results were compared with those of the Figure 16A The results of the same treatment groups described in were compared. Figure 16B As shown, LAND CD38-LNPs-sgSOX11 achieved significantly higher tumor gene editing rates than chemical CD38-LNPs-sgSOX11 (>95% vs <40%). In addition, LAND significantly reduced "off-tumor" gene editing in normal liver cells (hepatocytes and macrophages) compared to chemically conjugated LNP treatment (<4% vs >40%). These differences were statistically significant (p < 0.0005) using analysis of variance (ANOVA) with Tukey's multiple comparison test. The significantly superior results of LAND over chemically conjugated antibody-targeted LNPs were unexpected because the lipidated scFv antibody used in LAND has only one binding site, compared to the two binding sites of the antibody used for chemically conjugated LNPs.

[0439] like Figure 16C As shown, LAND has a better safety profile than standard chemotherapy. In these evaluations, an additional control group (N=5 / group) received a single intravenous injection of doxorubicin (DOX) at a dose of 1 mg / Kg or 2.5 mg / Kg. These doses are generally within the range of clinical use. After treatment, genomic DNA was extracted from normal hepatocytes and INDELs were analyzed by next generation sequencing (NGS). Surprisingly, the INDELs that cause INDELs ( Figure 16C , doxorubicin 2.5mg / Kg)>50% of standard chemotherapy, compared to "non-tumor" gene editing for LAND in normal liver cells (<4%, Figure 16B ) is an order of magnitude less.

[0440] Example 7

[0441] To further demonstrate the safety of LAND primary scFv treatment, hepatotoxicity and the percentage of gene editing were assessed in normal hepatocytes after administration in normal mice. In these studies, anti-EGFR LAND LNPs containing Cas9 mRNA and a single guide RNA for PLK1, EGFR-LNP (sgPLK1), were injected intravenously at a dose of 2.0 mg / kg. Control groups included untreated animals and LNP vectors with an unrelated GFP sgRNA, such as Figure 15 Serum liver enzyme levels and the percentages of gene-edited hepatocytes and macrophages were determined as shown in FIG16 . Figure 17As shown in Figure 16, the percentage of liver edited cells was low and there was no significant difference between the anti-EGFR LAND LNP group containing a single guide RNA for PLK1--EGFR-LNP (sgPLK1) and the control group using the anti-EGFR LAND LNP group containing a single guide RNA for an unrelated sgRNA for GFP, as shown in Figure 16. Serum liver enzymes in all treated groups were not negatively affected compared to untreated animals. Example 7 (Figure 16) and Example 8 ( Figure 17 ) using LAND constructs against very different antibody targets revealed extremely high levels of gene editing specificity with minimal effects on normal tissues, supporting the general applicability of this technology.

[0442] Overview: Cell and disease models are representative of clinical tissue and cell targets suitable for LAND therapy. In particular, in vivo disease models are highly invasive and are known to be resistant to conventional therapies. The statistically superior efficacy of LAND antibody-targeted LNP compositions and methods (which have one antigen binding site per targeting molecule) is unexpected compared to ASSET, which has two antigen binding sites per targeting molecule, and chemically coupled antibody-targeted LNPs. LAND has shown statistically superior efficacy against a wide range of RNAs, including but not limited to siRNA, mRNA, and gene editing therapies for a variety of antigen targets and diseases.

[0443] Example 8

[0444] Primary Fab LAND (with Primary Fab-targeted LAND - Erbitux-Fab-LAND)

[0445] The ASSET and LAND proteins described to date all contain a secondary or primary scFv. To further demonstrate the robustness and flexibility of LAND, we prepared and evaluated LAND proteins in which Fab's were used for cell targeting. These are referred to as "primary Fab LAND (LAND with primary Fab targeting)."

[0446] Figure 1FThe system used in Examples 8 and 9 is described. The vector in this system contains two expression cassettes, each controlled transcriptionally by a T7 promoter, a configuration known as the "pET-Duet" configuration (biocomparedotcom / Product-Reviews / 40993-Co-expression-with-pETDuet-1-Duet-Expression-System-From-Novagen / ). When protein expression is induced (using IPTG), the two proteins are exported separately across the inner membrane. The heavy chain portion containing the lipidated peptide portion of CDQSSS (SEQ ID NO: 17) is inserted into the periplasmic side of the inner membrane. The light chain containing a C-terminal HIS tag is exported to the periplasmic space as a soluble protein and assembles with the heavy chain portion to form a Fab. Only the intact Fab, containing the lipidated heavy chain (Fd) portion assembled with the light chain, can be extracted from the membrane fraction using detergents and purified by Ni-NTA affinity chromatography. Free light chain protein is removed as part of the soluble fraction before detergent extraction, whereas free Fd does not contain a HIS tag and therefore does not bind to the Ni-NTA column.

[0447] The first expression cassette used to prepare Fab contained the protein encoding portion of the NLPA leader sequence (SEQ ID NO: 20), the lipidation sequence (SEQ ID NO: 17), the 11aa linker 1 (SEQ ID NO: 18), mCherry as the functional protein (SEQ ID NO: 22), the 28aa linker #4 (SEQ ID NO: 6), the VH of Erbitux, and the CH1 domain of the human IgG1 constant region.

[0448] The sequences of the Erbitux-Fab-LAND open reading frame of the heavy chain are shown in SEQ ID No. 23 (DNA sequence) and SEQ ID No. 24 (amino acid sequence).

[0449] The second expression cassette for Fab production contained the protein coding portion of the pelB leader sequence, followed by the open reading frame of the Erbituxk light chain and ended with a hexahistidine tag (to allow purification by Ni-NTA affinity chromatography).

[0450] The sequences of the Erbitux-Fab-LAND light chain open reading frame are shown in SEQ ID No. 26 (DNA sequence) and SEQ ID No. 27 (amino acid sequence). The Erbitux-Fab-LAND protein was prepared and purified according to the general protocol described above, and its functionality was tested by flow cytometry.

[0451] Methods: Flow cytometry experiments were performed using OVCAR8 cells, essentially as described in Example 2 (where the primary Erbitux scFv LAND was tested). Cells were incubated with OG (octylglucoside) micelles in complete medium (containing 10% FBS). Instead of tracking the mCherry fluorescence signal (as done in Example 2), binding of Erbitux-LANDOG micelles to cells was monitored by adding APC anti-His-tag secondary antibody to the cells and incubating on ice for 30 minutes. Cells were washed with PBS. Finally, cells were analyzed by flow cytometry (APC channel) on a CytoFLEX (Beckman Coulter, USA).

[0452] result:

[0453] like Figure 18 As shown, both Erbitux-based purified LAND preparations ("LAND with primary scFv targeting" and "LAND with primary Fab targeting") protein micelles bound to OVCAR8 cells. In this assay, the Fab construct outperformed the scFv construct.

[0454] These results indicate that lipidated Erbitux Fab is functional and targeting competent and is not inferior to lipidated Erbitux scFv in targeting.

[0455] Example 9

[0456] Primary Fab LAND (with primary Fab-targeted LAND--THB-7-Fab-LAND)

[0457] The first expression cassette used to prepare Fab contained the protein coding portion of the NlpA leader sequence (SEQ ID NO: 20), the lipidation sequence (SEQ ID NO: 17), the 11aa linker 1 (SEQ ID NO: 18), mCherry as the functional protein (SEQ ID NO: 22), the 28aa linker #4 (SEQ ID NO: 6), the VH of THB-7, and the CH1 domain of the human IgG1 constant region.

[0458] The sequences of the THB-7-Fab-LAND open reading frame of the heavy chain are shown in SEQ ID No. 27 (DNA sequence) and SEQ ID No. 28 (amino acid sequence).

[0459] The sequences of the Erbitux-Fab-LAND light chain open reading frame are shown in SEQ ID No. 29 (DNA sequence) and SEQ ID No. 30 (amino acid sequence). The THB-7-Fab-LAND protein was prepared and purified according to the general protocol described above, and its functionality was tested by flow cytometry.

[0460] The second expression cassette for Fab production contained the protein-coding portion of the pelB leader sequence, followed by the open reading frame of the ErbituxK light chain, and ended with a hexahistidine tag to allow purification by Ni-NTA affinity chromatography.

[0461] Methods: Flow cytometry experiments were performed using Z138 cells essentially as described in Example 3 (where the primary THB-7scFv LAND was tested). Cells were incubated with OG (octylglucoside) micelles in complete medium (containing 10% FBS). Instead of tracking the mCherry fluorescence signal (as done in Example 3), binding of THB-7-LAND OG micelles to cells was monitored by adding APC anti-His secondary antibody to the cells and incubating on ice for 30 minutes. The cells were washed with PBS. Finally, the cells were analyzed by flow cytometry (APC channel) on a CytoFLEX (Beckman Coulter, USA).

[0462] result:

[0463] like Figure 19 As shown, both THB-7 based purified LAND preparations ("LAND with primary scFv targeting") and ("LAND with primary Fab targeting") protein micelles bound to Z138 cells.

[0464] The foregoing description of the specific embodiments will fully reveal the general nature of the invention so that others can use existing knowledge to easily modify and / or adjust these specific embodiments to adapt to various applications without excessive experimentation and without departing from their general concepts. Therefore, such adjustments and modifications should and are intended to be included within the meaning and scope of the equivalents of the disclosed embodiments. It should be understood that the words or terms used herein are for descriptive purposes only and are not limiting. Without departing from the spirit and scope of the invention as described in the appended claims, the means, materials and steps for achieving the various disclosed functions may take a variety of alternative forms.

[0465] It is the applicant's intention that all publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety, to the same extent as if each individual publication, patent, or patent application were specifically and individually incorporated herein by reference. In addition, the citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, the entire contents of any one or more priority documents of the present invention are incorporated herein by reference in their entirety.

Claims

1. A composition for delivering a therapeutic agent or a diagnostic agent to a target cell, comprising: Lipid nanoparticles encapsulating therapeutic or diagnostic agents, a first antibody non-covalently attached to the lipid nanoparticle via a lipidated peptide moiety; A peptide linker is directly attached to the first antibody at one end of the linker, and the lipidated peptide portion is attached to the other end of the linker, wherein the antibody or antibody fragment is located at the distal end of the nanoparticle and binds to the target antigen on the target cell.

2. A delivery system composition for delivering a therapeutic agent or a diagnostic agent to a target cell, wherein the delivery system comprises: A lipidated antibody comprising an antibody linked to a lipidated peptide moiety via a peptide linker, wherein the peptide linker comprises at least 40 amino acid residues; and a lipid nanoparticle comprising said therapeutic or diagnostic agent, wherein the lipidated antibody is non-covalently linked to the lipid nanoparticle via the lipidated peptide moiety.

3. The composition of claim 1 or the delivery system of claim 2, wherein the lipidated peptide moiety comprises an inner membrane lipidation signal.

4. The composition or delivery system of any one of claims 1 to 3, wherein the lipidated peptide portion of the antibody comprises the first two amino acids encoded by the E. coli NlpA gene or the first six amino acids encoded by the E. coli NlpA gene.

5. The composition or delivery system of any one of claims 1 to 3, wherein the lipidated peptide portion of the antibody is contained in an inner membrane lipoprotein or a fragment thereof selected from the group consisting of AraH, MglC, MalF, MalG, Mal C, MalD, RbsC, RbsC, ArtM, ArtQ, GliP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E, Dpp B, DppC, OppB, AmiC, AmiD, BtuC, FhuB, FecC, FecD, FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, P stC, PotB, PotC, PotH, PotI, ModB, NosY, PhnM, LacY, SecY, TolC, Dsb,B, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB and Aas.

6. The composition or delivery system composition of claim 1 or 2, wherein the peptide linker comprises 40 to 400 amino acid residues.

7. The composition or delivery system composition of claim 6, wherein the peptide linker comprises 40 to 300 amino acid residues.

8. The composition or delivery system composition according to any one of claims 1 to 7, wherein at least 30% of the amino acid residues of the peptide linker are glycine or serine.

9. The composition or delivery system composition according to claim 7, wherein the peptide linker comprises the amino acid sequence shown in SEQ ID No.

11. 10 . The composition or delivery system composition according to claim 9 , wherein the linker comprises the amino acid sequence shown in SEQ ID No.

12. 11 . The delivery system composition according to any one of claims 2 to 10 , wherein the antibody is a first antibody comprising an antigen recognition domain capable of binding to an antigen expressed by a target cell.

12. The composition of claim 1 or the delivery system composition of claim 11, wherein the primary antibody is a humanized or human primary antibody.

13. The composition of claim 1 or the delivery system composition of claim 11 or 12, wherein the first antibody is selected from the group consisting of anti-CD44, anti-CD34, anti-CD38, anti-Ly6C, anti-CD3, anti-CD4, anti-CD8, anti-CD25, anti-CD47, anti-CD117, anti-CD147, anti-EGFR, and anti-integrin beta 7 antibodies.

14. The composition of claim 1 or the delivery system composition of claim 11 or 12, wherein the first antibody is capable of binding to an antigen listed in Table 1 and Table 7.

15. The delivery system composition according to any one of claims 2 to 10, wherein the antibody is a second antibody comprising an antigen recognition domain capable of specifically binding to the Fc domain of the first antibody.

16. The delivery system composition according to any one of claims 2 to 10, wherein the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab')2, Fv, scFv, dsFv and nanobodies.

17. The delivery system composition of claim 16, wherein the Nanobody is a monovalent or multivalent Nanobody.

18. The delivery system composition according to any one of claims 1 to 10, wherein the antibody is a monoclonal antibody.

19. The composition or delivery system composition of any one of claims 1 to 18, wherein the lipidated peptide moiety is attached to the N-terminus of the antibody.

20. The composition or delivery system composition of any one of claims 1 to 19, wherein the lipid nanoparticles comprise at least one of an ionizable lipid, a stabilizing lipid, a helper lipid, and a PEG-lipid.

21. compositions or delivery system compositions according to claim 20, wherein said ionizable lipid is selected from the group consisting of: DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, N,N-dimethyl-N',N'-bis[(9Z,12Z)-octadeca-9,12-diene-1-yl]ethane-1,2-diamine, 2-(bis((9Z,12Z)-octadeca-9,12-diene-1-yl]ethane-1,2-diamine, 1-(2,3-dioleoyl)amino)ethyl 4-(4-methylpiperazin-1-yl) propionate (EA-PIP), dioleyl-succinyl-seryl-tobramycin, dioleyl-adipyl-tobramycin, dioleyl-suberoyl-tobramycin, dioleyl-sebacoyl-tobramycin, dioleyl-dithioglycoloyl-tobramycin, monocationic lipid N-[1-(2,3-dioleoyloxy)]-N,N,N-trimethylammonium propane (DOTAP), BCAT O-(2R-1,2-di-O-(1'Z,9'Z-octadecadienyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate, BGSC (bis-guanidine-spermidine-cholesterol), BGTC (bis-guanidine-triaminoethylamine-cholesterol), CDAN (N'-cholesteryloxycarbonyl-1,3,7-diazanonane-1,9-diamine), CHDTAEA (cholesteryl hemi-dithiodiol) Glycol tris(amino(ethyl)amine), DCAT (O-(1,2-di-O-(9'Z-octadecenyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate), DC-Chol (3β[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol), DLKD (O,O'-dilauryl N-lysyl aspartate), DMKD (O,O'-dimyristyl N-lysyl aspartate), DOG (glycerol diol), DOGS (dioctadecylamido glycylspermine), DOGSDSO (1,2-dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl disulfide ornithine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOSN (dioleylsuccinylethylthioneomycin), DOSP (dioleylsuccinylparomomycin), DOST (dioleylsuccinyl tobramycin), 1,2-dioleoyl-3-trimethylammonium propane, DOTMA (N'[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride), DPPES (dipalmitoylphosphatidylethanolamine spermine), DDAB and DODAP, or any combination thereof.

22. The composition or delivery system composition of claim 21, wherein the ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, 2-(bis((9Z, 12Z)-octadeca-9,12-dien-1-yl)amino)ethyl 4-(4-methylpiperazin-1-yl)propionate (EA-PIP), dioleyl-succinyl-seryl-tobramycin, dioleyl-adipoyl-tobramycin, dioleyl-suberoyl-tobramycin, dioleyl-sebacoyl-tobramycin, N,N-dimethyl-N',N'-bis[(9Z, 12Z)-octadeca-9,12-dien-1-yl]ethane-1,2-diamine, and dioleyl-dithioglycoloyl-tobramycin, or any combination thereof.

23. The composition or delivery system composition of claim 20, wherein the stabilizing lipid is selected from the group consisting of cholesterol, phospholipids (such as phosphatidylcholine (PC)), cephalins, sphingolipids and glycoglycerolipids, or a combination thereof.

24. The composition or delivery system composition of claim 20, wherein the helper lipid is selected from the group consisting of: 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dilauroyl-L-phosphatidylethanolamine (DLPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhPE), 1,3 -dipalmitoyl-sn-glycero-2-phosphoethanolamine (1,3-DPPE), 1-palmitoyl-3-oleoyl-sn-glycero-2-phosphoethanolamine (1,3-POPE), biotin-phosphatidylethanolamine, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) and dipalmitoylphosphatidylethanolamine (DPPE), or a combination thereof.

25. The composition or delivery system composition of claim 20, wherein the PEG-lipid is selected from the group consisting of DMG-PEG, PEG-cDMA, PEG-cDSA, DLPE-PEG, DSPE-PEG, 3-N-(-methoxypoly(ethylene glycol)2000)carbamoyl-1,2-dimyristyloxypropylamine, 3-N-(-methoxypoly(ethylene glycol)2000)carbamoyl-1,2-distearoyloxypropylamine, or a combination thereof.

26. The composition or delivery system composition of any one of claims 1 to 25, wherein the lipidated peptide moiety comprises a glycerolipid.

27. The composition or delivery system composition of any one of claims 1 to 26, wherein the therapeutic agent is encapsulated within the lipid nanoparticle.

28. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a nucleic acid or polynucleotide.

29. The composition or delivery system composition of claim 27, wherein the therapeutic agent is exome-encoded DNA or mRNA.

30. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a non-exome-encoded RNA.

31. The composition or delivery system composition of claim 30, wherein the non-exome-encoded RNA is a microRNA, a long non-coding RNA (IncRNA), a long non-coding intergenic RNA (lincRNA), a pseudogene, a circular RNA (circRNA), a transfer RNA (tRNA), or an interfering RNA (siRNA and shRNA).

32. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a catalytically active or inactivated gene editing nuclease.

33. The composition or delivery system composition of claim 32, wherein the catalytically active or inactivated gene editing nuclease is selected from the group consisting of: meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), transposases, integrases, mobile genetic element (MGE)-encoded recombinases, clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) nucleases and their associated guide nucleic acids and targeting moieties.

34. The composition or delivery system composition of claim 33, wherein the CRISPR-associated (Cas) nuclease is Cas9, Cas12a, Cas12b, Cas12e, Cas13, Cas13a, Cas13b, Cas14, Cas-θ, CasX, CasY, or listed in Table 6.

35. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a catalytically inactive CRISPR-associated (Cas) protein or an mRNA fused to a transcriptional modifier.

36. The composition or delivery system composition of claim 35, wherein the mRNA fused to a transcriptional modifier is a transcriptional repressor.

37. The composition or delivery system composition of claim 36, wherein the transcriptional repressor is a methyltransferase or a histone deacetylase.

38. The composition or delivery system composition of claim 36, wherein the transcriptional repressor is DNA methyltransferase 3A (DNMT3A), methyl-CpG-binding protein 2 (MeCP2), Krüppel-associated box (KRAB), MeCP2-KRAB, histone deacetylase 3 (HDAC3), Ezh2, SALL1 and / or SDS3.

39. The composition or delivery system composition of claim 35, wherein the mRNA fused to a transcriptional modifier is a transcriptional activator.

40. The composition or delivery system composition of claim 39, wherein the transcriptional activator is VP64, p65, Rta alone or in combination (VPR), the synergistically activated modulator (SAM) activation system MS2-p65-HSF1, a DNA demethylating moiety, or an acetyltransferase.

41. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a base editor, a guide editor, or a mobile genetic element gene writer.

42. A composition or delivery system composition according to claim 41, wherein the base editor is a cytosine base editor (CBE) or an adenine base editor (ABE), which comprises a catalytically inactive (dCas) or partially inactivated (Cas nickase or nCas) Cas nuclease, a cytidine deaminase or an adenosine deaminase and a guide RNA that confers target sequence specificity.

43. The composition or delivery system composition of claim 42, wherein the base editor or gene editing agent is selected from those listed in Tables 2 and 3.

44. The composition or delivery system composition of claim 41, wherein the guide editor consists of a guide editing guide RNA (pegRNA) targeting sequence and an RNA template and a fusion protein consisting of a Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme, wherein The pegRNA guide template and Cas9 nickase direct the reverse transcriptase to the target site where a new DNA strand from the RNA template is inserted.

45. The composition or delivery system composition of claim 41 , wherein the mobile genetic element gene writer incorporates a mobile genetic element for sequence targeting, combined with an engineered integrase or transposase to integrate a nucleic acid sequence at the target sequence.

46. The composition or delivery system composition of claim 45, wherein the mobile genetic element gene writer incorporates a CRISPR-Cas9 targeting element in combination with an engineered piggyBac transposase to integrate a nucleic acid sequence at the target sequence.

47. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a protein, a ribonucleoprotein, or a drug.

48. according to any one of claims 1 to 48 compositions or delivery system compositions, wherein target nucleic acid or gene for inhibition are listed in Table 4.

49. according to any one of claims 1 to 48 compositions or delivery system compositions, wherein described target nucleic acid or gene for therapeutic expression are listed in Table 5.

50. The composition or delivery system composition of any one of claims 1 to 48, wherein the target nucleic acid or gene for correction or repair is listed in Table 4, Table 5 or Table 7.

51. The composition or delivery system composition of any one of claims 1 to 48, wherein the antibody comprises the amino acid sequence shown in SEQ ID NO: 5, 8, 24, 27, 28 or 30.

52. A method of delivering a therapeutic or diagnostic agent to a subject in need thereof, the method comprising administering to the subject a composition or delivery system according to any one of claims 1 to 51, thereby delivering the therapeutic or diagnostic agent to the subject.

53. A method of treating a medical condition in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of the composition or delivery system of any one of claims 1 to 51, wherein the agent is a therapeutic agent, thereby treating the medical condition.

54. A method of diagnosing a medical condition in a subject, the method comprising administering to the subject an effective amount of the composition or delivery system of any one of claims 1 to 51, wherein the agent is a diagnostic agent, thereby diagnosing the medical condition.

55. Use of the composition or delivery system of any one of claims 1 to 51 for the diagnosis or treatment of a medical condition.

Images