Banana endophyte compound agent and its preparation method and application

Abstract

The present invention belongs to the field of microorganisms, and specifically relates to a banana endophyte compound agent, a preparation method, and an application thereof. The present invention isolates a novel endophytic Bacillus Velez JDB15 and an endophytic Trichoderma harzianum JDL4 from banana plants. The Trichoderma harzianum JDL4 can inhibit Botrytis cinerea, Fusarium graminearum, Rhizoctonia solani, Colletotrichum syringae prunellae, Peach anthracnose, Peach brown rot, and Alternaria alternata, and has a good broad-spectrum antibacterial effect. At the same time, the filtrate of the fermentation broth of Trichoderma harzianum JDL4 is compounded with Bacillus Velez JDB15 to significantly enhance the antibacterial effect, and the control effect against banana wilt pathogen, rice blast pathogen, tomato wilt, and corn leaf spot pathogen is also significantly enhanced. The compound agent has a wide range of biocontrol activities and can be further developed in the future to provide a sustainable and green solution for the control of banana wilt and other plant diseases.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and particularly relates to a banana endophyte compound agent, a preparation method and an application thereof. Background Art

[0002] banana( Musa spp As an important economic crop in the world, its sustainable production is seriously threatened by soil-borne pathogenic fungi, among which Fusarium oxysporum Cubanum ( Fusarium oxysporum f. sp. cubense , Foc ) is particularly prominent. This pathogen can infect the vascular system through the root system, causing the plant to wilt and die, and its physiological species 4 ( Foc TR4 has posed a devastating threat to mainstream cultivated varieties, including Cavendish banana. Traditional control strategies, which rely on chemical fungicides, have limitations, including environmental residues, increased pathogen resistance, and disruption to the soil microbiome. The development of green and sustainable control technologies is urgently needed.

[0003] Endophytes are an ideal resource for biocontrol because they can colonize host tissues and directly inhibit pathogens through multiple mechanisms, including nutrient competition, spatial occupation, induction of systemic resistance, and secretion of antimicrobial metabolites. The rich endophytic microbial communities within banana plants, particularly those in the rhizosphere and vascular bundles, offer unique advantages for targeted control of soil-borne diseases. However, the effectiveness of a single strain of biocontrol agent is often limited by its environmental adaptability, making it difficult to achieve stable and effective field control.

[0004] The design of compound microbial agents based on the synergistic interaction of microorganisms is a core strategy to improve the effectiveness of biocontrol. Bacillus velezensis ) as a Gram-positive biocontrol bacterium, can synthesize lipopeptide antibiotics (such as Surfactin, Iturin) and lysozyme, directly lysing the cell wall of pathogens; Trichoderma harzianum ( Trichoderma harzianum ) exerts broad-spectrum antibacterial activity through hyphal parasitism, chitinase secretion, and induction of plant ISR (systemic acquired resistance). Their mechanisms of action demonstrate the potential for spatial niche complementarity and metabolic synergy, but existing technologies still face bottlenecks such as poor strain compatibility, conflicting fermentation processes, and insufficient field colonization stability.

[0005] Currently available banana biocontrol agents mostly focus on single strains (such as Bacillus subtilis or Trichoderma species) or compound preparations of non-endophytic bacteria, and there is a lack of research on compound systems with strong adaptability to banana tissue endophytes. Foc-TR4, and existing formulations have significant deficiencies in understanding the mechanisms of bacterial interactions, compatibility with large-scale fermentation processes, and persistent colonization of the rhizosphere microbiome. Therefore, developing a compound bacterial agent based on banana endophytes that combines high antibacterial efficacy with ecological adaptability is of urgent industrial value in overcoming the challenges of banana wilt disease control. Summary of the Invention

[0006] The present invention provides a banana endophyte compounded bacterial agent, a preparation method, and an application thereof. The compounded banana endophyte Bacillus Velezii JDB15 and the banana endophyte Trichoderma harzianum JDL4 are used synergistically to exhibit significant antibacterial activity.

[0007] The technical solution of the present invention is achieved as follows:

[0008] The first aspect of the present invention is a banana endophytic Trichoderma harzianum JDL4, named: Trichoderma harzianum , registered and deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 66430.

[0009] The second aspect of the present invention is to provide the fermentation broth or the filtrate of the fermentation broth of the banana endophytic Trichoderma harzianum JDL4 as described in the first aspect of the present invention.

[0010] Furthermore, the preparation method of the filtrate is as follows: Trichoderma harzianum JDL4 is inoculated into PDB culture medium to obtain a fermentation broth; the fermentation broth is filtered in series using two layers of filters with a pore size of 0.22 μm to obtain the filtrate.

[0011] The third aspect of the present invention is to provide a composite bacterial agent comprising the filtrate of the fermentation broth of Trichoderma harzianum JDL4 described in the second aspect of the present invention and Bacillus velez JDB15, wherein the Bacillus velez JDB15 is named: Bacillus velezensis It is registered and deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 66431.

[0012] The fourth aspect of the present invention provides the use of the banana endophytic Trichoderma harzianum JDL4 described in the first aspect of the present invention, or the fermentation broth described in the second aspect of the present invention, in preparing a preparation for antagonizing plant pathogens and / or diseases caused by the plant pathogens; the plant pathogens are: Botrytis cinerea, Fusarium graminearum, Sclerotinia sclerotiorum, Rhizoctonia solani, peach anthracnose, peach brown rot and Alternaria alternata.

[0013] The fifth aspect of the present invention provides the use of the filtrate of the fermentation broth described in the second aspect of the present invention or the composite bacterial agent described in the third aspect of the present invention in the preparation of a method for preventing and controlling plant pathogens and / or diseases caused by the plant pathogens, wherein the prepared pathogens are banana wilt fungus, rice blast fungus, tomato wilt fungus and / or corn leaf blight fungus.

[0014] The sixth aspect of the present invention provides the use of the banana endophytic Trichoderma harzianum JDL4 according to the first aspect of the present invention, or the filtrate of the fermentation broth according to the second aspect of the present invention, or the composite bacterial agent according to the third aspect of the present invention in the preparation of a preparation for enhancing the inhibitory activity of Bacillus velezensis JDB15 against plant pathogens, wherein the plant pathogens are: banana wilt pathogen, rice blast pathogen, tomato wilt pathogen and / or corn leaf blight pathogen; the Bacillus velezensis JDB15 is named: Bacillus velezensis , registered and deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 66431.

[0015] The seventh aspect of the present invention provides the use of the banana endophytic Trichoderma harzianum JDL4 described in the first aspect of the present invention, or the filtrate of the fermentation broth described in the second aspect of the present invention, or the composite bacterial agent described in the third aspect of the present invention in the preparation of a preparation for improving the resistance of banana plants to banana wilt disease, inhibiting the mycelial growth of banana wilt pathogens and / or inhibiting the spore germination of banana wilt pathogens.

[0016] The eighth aspect of the present invention provides the use of the filtrate of the fermentation broth according to the second aspect of the present invention, or the composite bacterial agent according to the third aspect of the present invention, in the preparation of a preparation for enhancing the ability of Bacillus Velez JDB15 to improve the resistance of banana plants to banana wilt disease, inhibit the mycelial growth of banana wilt pathogens, and / or inhibit the spore germination of banana wilt pathogens. The Bacillus Velez JDB15 is named: Bacillus velezensis , registered and deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 66431.

[0017] The ninth aspect of the present invention provides the use of the banana endophytic Trichoderma harzianum JDL4 as described in the first aspect of the present invention, or the filtrate of the fermentation broth as described in the second aspect of the present invention, in the preparation of a preparation that secretes protease, produces siderophores and / or parasitizes the hyphae of banana wilt pathogens, causing the hyphae of banana wilt pathogens to break.

[0018] Beneficial effects of the present invention:

[0019] The present invention isolates a novel endophytic Bacillus velez JDB15 and an endophytic Trichoderma harzianum JDL4 from banana plants. The Trichoderma harzianum JDL4 can inhibit gray mold, Fusarium graminearum, Rhizoctonia solani, peach anthracnose, peach brown rot and Alternaria alternifolia, and has a good broad-spectrum antibacterial effect. At the same time, the filtrate of the fermentation broth of Trichoderma harzianum JDL4 is compounded with Bacillus velez JDB15 to significantly improve the antibacterial effect, and the control effect on banana wilt fungus, rice blast fungus, tomato wilt fungus and corn leaf spot fungus is also significantly improved. The composite bacterial agent is effective against Fusarium oxysporum Cuban special type 4 physiological subspecies ( Foc TR4, hereinafter referred to as Foc 4) The control effect of the banana wilt disease caused by this product is significant, and it has a wide range of biocontrol activities. It can be further developed in the future to provide a sustainable and green solution for the control of banana wilt and other plant diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 For strains JDB15 and JDL4 Foc 4. Results of mycelial antagonism experiment.

[0022] Figure 2 This is the 16s amplification result of strain JDB15.

[0023] Figure 3 This is the phylogenetic tree of strain JDB15.

[0024] Figure 4 These are the culture characteristics of strain JDB15 on seven culture media.

[0025] Figure 5 This is the Gram staining result of strain JDB15.

[0026] Figure 6 Shown are the amplification results of ITS and tef1 of strain JDL4.

[0027] Figure 7 This is the phylogenetic tree of strain JDL4.

[0028] Figure 8 This is the mycelial spore morphology of strain JDL4.

[0029] Figure 9The culture characteristics of strain JDL4 on four culture media were analyzed.

[0030] Figure 10 The results of physiological activity tests of strain JDB15 (upper panel) and strain JDL4 (lower panel) are shown.

[0031] Figure 11 Results of NaCl tolerance experiments of strain JDB15 (top) and strain JDL14 (bottom).

[0032] Figure 12 Experiment on different carbon source utilization by strain JDL14.

[0033] Figure 13 Observation of the parasitic characteristics of strain JDL14.

[0034] Figure 14 This is the result of the broad-spectrum antifungal activity test of strain JDL4.

[0035] Figure 15 Effects of strain JDL4 (above) and compound bacterial agent (below) on Foc 4's inhibitory activity.

[0036] Figure 16 The control effect of compound fungal agent on banana wilt.

[0037] Figure 17 The control effect of compound bacterial agents on rice blast in barley (top and middle pictures) and rice (bottom picture).

[0038] Figure 18 The control effect of compound microbial agents on corn leaf spot.

[0039] Figure 19 The control effect of compound microbial agent on tomato wilt.

[0040] The banana endophytic Trichoderma harzianum JDL4 of the present invention is named: Trichoderma harzianum It is registered and deposited in the Guangdong Provincial Microbial Culture Collection Center with the deposit number GDMCC No: 66430 and the deposit date is May 28, 2025. The deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0041] The banana endophytic Bacillus Velez subtilis JDB15 of the present invention is named: Bacillus velezensis It is registered and deposited in the Guangdong Provincial Microbial Culture Collection Center with the deposit number GDMCC No: 66431 and the deposit date is May 28, 2025. The deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. DETAILED DESCRIPTION

[0042] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0043] Example 1 Isolation and Identification of Strain JDB15 and Strain JDL4

[0044] 1. Isolation of JDB15 and JDL4 and Analysis of Antagonistic Properties

[0045] First, some endophytic strains were isolated from banana roots using the relevant endophyte isolation procedures.Banana root samples were collected from the greenhouse of Huazhong Agricultural University, No. 1 Shizishan Street, Hongshan District, Wuhan, Hubei Province (Longitude: 114.3E Latitude: 30.4N).

[0046] Endophytic bacteria from bananas were isolated using the tissue dilution method. Banana plants with good growth and no lesions were selected for isolation. Prior to the experiment, forceps, blades, filter paper, a coating rod, a 2ml centrifuge tube, and small steel balls were sterilized with high-temperature steam. A solution of 50% glycerol, 75% ethanol, and 1% hypochlorous acid was prepared for use. Surface disinfection: First, the banana roots were rinsed with tap water and cut into small pieces. Surface disinfection was performed in a sterile operating hood: first, rinsed with running water, allowed to dry, and then transferred to a clean bench. Rinse with 75% ethanol for 1 minute, rinsed once with sterile water, then rinsed with 1% sodium hypochlorite for 30 seconds, and rinsed three times with sterile water. Surface moisture was then blotted dry with filter paper. 100 µL of the supernatant from the final sterile water wash was spread onto PDA and LB medium. Three blank controls were incubated at 28°C and 30°C for 1-5 days. No bacterial growth was observed, indicating that the banana root surface was thoroughly disinfected. Set up a concentration gradient: Place 0.1 g of banana root tissue in a 2 ml EP tube with steel balls, shake it thoroughly with a vortex shaker, dilute the supernatant with ultrapure water, and set up 4 concentration gradients of 10 -1 -10 -4 . Dilution plate culture: Repeat each gradient three times, take 0.1 ml and spread it on the LB plate, place it in a 30℃ incubator and culture it for 1-2 days, and observe the number of colonies during this period. Purification culture: When colonies of various morphologies grow on the plate, use a sterilized toothpick to select strains with obviously different morphologies and activate them on LB. Preservation of endophytic bacteria: Pick a single colony and place it in an EP tube containing LB liquid culture medium, shake it at 28℃, 180 r / min for 12 hours, add the bacterial solution and 50% glycerol in a 1:1 ratio, mix well and freeze at -70℃ (can be stored at -20℃ for half a year) for the next experiment.

[0047] Endophytic fungi in bananas were isolated using the tissue cutting method. Banana plants were grown to maturity, and healthy, lesion-free plants were selected for isolation. Prior to the experiment, forceps, blades, beakers, and mortars were sterilized with high-temperature steam. A solution of 50% glycerol, 75% ethanol, and 1% hypochlorous acid was prepared. Material disinfection: 10 g of banana plant was washed under running water, air-dried, and then transferred to a laminar flow hood and cut into 1 cm x 1 cm pieces. The pieces were then rinsed in 75% ethanol for 30 seconds, then three times with sterile water, followed by three rinses in 1% sodium hypochlorite for 30 seconds, followed by six rinses in sterile water. Surface moisture was then blotted dry with filter paper. Each piece was placed directly on a PDA plate containing ampicillin (a control was performed by smearing the sterilized tissue directly onto the PDA plate to verify thorough disinfection). The pieces were incubated at 28°C for 2-3 days, during which time bacterial colonies were observed. Purification: When hyphae begin to grow at the edges of the tissue block, select hyphae with distinct morphological characteristics and place them on PDA plates. Culture in a 28°C incubator for 2-3 days, and purify for three generations. Strain preservation: Use glycerol storage. Use a microporator to create a microparticle, select a microparticle, place it in a culture tube containing 20% ​​glycerol, and freeze at -70°C for future experiments.

[0048] JDB15 antagonism Foc 4: Pour 10 mL of PDA medium into a 6 cm culture dish and set aside. Take fresh purified bacterial strains and draw lines perpendicular to the diameter of the plate at 1.5 cm from the center on both sides of the plate. Incubate at 30°C for 1 day. After the colonies grow, use a 5 mm diameter punch to punch the plate in fresh water. Foc Punch a hole at the edge of the hyphae of the 4 strains and inoculate the hyphae block in the center of the PDA plate. Incubate at 25℃ and observe the confrontation. Sterile water was used as a control. Foc 4. When the strains are fully grown on the PDA plate, observe whether there is an antagonistic band. If there is antagonism, measure the width of the antagonistic band and identify it. Select the strong antagonistic strains for the next test. The inhibition rate is calculated as follows:

[0049] Inhibition rate (%) = (control colony diameter - treated colony diameter) / control colony diameter × 100%

[0050] JDL4 antagonism Foc 4: A plate standoff test was performed in a 9 cm culture dish, using the target bacteria Fusarium oxysporum from the laboratory. Foc4. Activate the target and test bacteria: 5 mm diameter bacterial cakes were harvested from the edges of the hyphae of each target and test bacteria. Activate the cakes on PDA plates and incubate at 28°C for three generations. Inoculate the target bacterial cakes onto PDA medium in advance. The target bacteria and the different test fungi were inoculated at two points 2.5 cm from the center of the plate. A control plate inoculated with only the target bacteria was used. Repeat three times for each group. Incubate the plates in an inverted manner at 28°C for 2-7 days. Observe the morphology of the colonies. When a clear zone of inhibition appears, measure the size of the zone using the cross-hatch method and calculate the inhibition rate.

[0051] During the experiment, it was found that the endophytes numbered JDB15 and JDL4 Foc 4 Mycelial growth showed obvious antagonism ( Figure 1 ), the inhibition rates were 80.34% and 74.8% respectively.

[0052] 2. Growth Characteristics Analysis of JDB15 and JDL4

[0053] Genomic DNA from strain JDB15 was extracted using the Omega Becterial DNA Kit, and genomic DNA from strain JDL4 was extracted using the CTAB method. PCR amplification of the target fragment was performed using the bacterial 16S rDNA gene primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGACTT). PCR amplification was performed using the universal fungal primers ITS1 (GGAAGTAAAAGTCGTAACAAG) and ITS4 (TCCTCCGCTTATTGATATGC) and the Trichoderma housekeeping gene tef1 (CACATTAACTTGGTCGTTATCG) and (CATCCTTGGAGATACCAGC).

[0054] The PCR reaction system is as follows:

[0055] PCR amplification conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, and extension at 72°C for 30 sec, for 32 cycles; extension at 72°C for 8 min, and stop at 12°C.

[0056] (1) JDB15 strain

[0057] The bacterial JDB15 was amplified by PCR to obtain a sequence of about 1500 bp ( Figure 2). The unpurified PCR was sequenced. The sequencing results were compared with the 16S RNA sequence in the GenBank database, and it was found that it had the highest similarity with Bacillus velez. By comparing with the local database, based on 31 housekeeping genes (dnaG, frr, infC, nusA, pgk, pyrG, rplA, rplB, rplC, rplD, rplE, rplF, rplK, rplL, rplM, rplN, rplP, rplS, rplT, rpmA, rpoB, rpsB, rpsC, rpsE, rpsI, rpsJ, rpsK, rpsM, rpsS, smpB, tsf), the 19 closest strains at the species level were selected, and the phylogenetic tree was constructed using the NJ (Neighbor-Joining) method using MEGA 6.0 software (Meiji Biotech Whole Genome Sequencing) ( Figure 3 ).

[0058] The above results confirm that JDB15 is Bacillus velezensis. To further examine its morphological changes, scanning electron microscopy revealed that the cells ranged from 1.20 to 1.80 μm in length and 0.5 to 0.75 μm in width. The cells had a smooth surface and were accompanied by filaments. Bacillus velezensis can secrete extracellular polymers (such as polysaccharides, proteins, or DNA) that may form filamentous networks, connecting multiple cells or encapsulating bacterial colonies to form biofilms. It can also secrete antimicrobial substances (such as lipopeptides) and extracellular polymers (EPS) that form filamentous structures that encapsulate the cells.

[0059] The strain JDB15 was cultured on seven different media, including LB, PDA, TSA, NA, R2A, Gause's No. 1, King B medium ( Figure 4 ).

[0060] LB medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, and 15 g agar.

[0061] PDA medium: 200 g potatoes, 20 g glucose, 15 g agar.

[0062] TSA medium: 15 g tryptone, 5 g soytone, 5 g sodium chloride, 15 g agar.

[0063] NA medium: peptone 10 g, beef powder 3 g, sodium chloride 5 g, agar 15 g.

[0064] R2A medium: yeast extract powder 0.5 g, peptone 0.5 g, casein hydrolysate 0.5 g, glucose 0.5 g, soluble starch 0.5 g, dipotassium hydrogen phosphate 0.3 g, sodium pyruvate 0.3 g, magnesium sulfate 0.024 g, agar 15 g.

[0065] Gause's medium No. 1: soluble starch 20g, potassium nitrate 1g, dipotassium hydrogen phosphate 0.5g, magnesium sulfate 0.5g, sodium chloride 0.5g, ferrous sulfate 0.01g, agar 15g.

[0066] King B medium: peptone 20.0 g, dipotassium hydrogen phosphate 1.5 g, sulfuric acid heptahydrate 1.5 g, agar 15 g.

[0067] On PDA, LB, TSA, NA, and King B media, the colonies appear light yellow, on R2A medium they appear beige, and on Gause's No. 1 medium they appear white. A pungent odor and biofilm are produced on LB medium, and the diameter of the colony ridges is the largest. A large amount of bacterial metabolites are also observed, appearing as mucus-like and translucent water-soaked products. A special odor can be smelled on all media, and multiple notches on the edges of the colonies, irregular growth, rough appearance, opacity, and wrinkled surfaces are observed, which can be used as identification criteria for the genus Bacillus. By gram staining, the bacterial cells of JDB15 were found to be purple, and were identified as Gram-positive strains ( Figure 5 ). Therefore, based on the above, strain JDB15 was identified as Bacillus velezensis and named: Bacillus velezensis It is registered and deposited in the Guangdong Provincial Microbial Culture Collection Center with the deposit number GDMCC No: 66431 and the deposit date is May 28, 2025. The deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0068] (2) JDL4 strain

[0069] JDL4 was identified and sequenced using ITS and tef1, obtaining sequences of approximately 500 bp and 1200 bp ( Figure 6 ). Using the sequencing results of tef1, we compared the rDNA sequences in the GenBank database and found that it had the highest similarity with Trichoderma harzianum. Then, using MEGA 11 to construct a phylogenetic tree, we found that JDL4 was most similar to Trichoderma harzianum, so we determined that JDL4 was Trichoderma harzianum ( Figure 7 ).

[0070] To observe the mycelial morphology of JDL4, we used SEM to observe the microstructure of mycelium and spores of JDL4 on PDA medium in detail. We observed that JDL4 produced a large number of aerial mycelium and began to produce spores from the inoculation point, which were green in color. Conidia were smooth, spherical, and clustered, and the mycelium was well developed ( Figure 8 ).

[0071] To further observe the morphological characteristics of JDL4, we prepared four culture media (PDA, Czapek, SNA, and OTA) and observed the morphological characteristics of JDL4 on different culture media. JDL4 produced green pigment on some culture media. It grew well on PDA, Czapek, and OTA culture media. On PDA and OTA culture media, it mainly produced spores with green spores. Mycelial growth on SNA was weak. Mycelial growth on Czapek culture media was good but produced yellow pigment ( Figure 9 and Table 1).

[0072] Czapek medium composition: 1 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate, 0.5 g potassium chloride, 0.01 g ferrous sulfate, 30 g sucrose, 15-20 g agar, 1000 mL distilled water, pH 7.0-7.2.

[0073] SNA medium composition: potassium dihydrogen phosphate 1.0 g, potassium nitrate 0.5 g, magnesium sulfate 0.5 g, sucrose 1.0 g, agar 15-20 g, distilled water 1 L.

[0074] OTA culture medium composition: 30.0 g oatmeal, 7.5 g tomato extract (equivalent to 150 mL tomato juice), and 20.0 g agar.

[0075] Table 1 Growth of strain JDL4 in different culture media

[0076]

[0077] 3. Physiological, biochemical and growth-promoting properties

[0078] Cellulose Congo red medium: 1 g potassium dihydrogen phosphate, 2 g ammonium sulfate, 0.5 g magnesium sulfate heptahydrate, 2 g CMC-Na, 0.5 g sodium chloride, 0.4 g Congo red, 15 g agar, and 1000 mL distilled water.

[0079] Amylase detection medium: 2 g soluble starch, 10 g beef extract, 10 g glucose, 7 g peptone, 18 g agar, and 1000 mL deionized water.

[0080] Pectinase detection medium: Glucose: 20g, pectin 5g, agar powder 15g, potato extract 200g. Cut the potatoes into pieces and boil them for 30 minutes. Filter the juice and add water to 1L.

[0081] Protease assay medium: 5 g peptone, 3 g beef extract, 5 g sodium chloride, 15 g agar, 10 g skim milk powder, 1 L distilled water.

[0082] Siderophore production detection medium: 60.5 mg chrome azurol-S, 72.9 mg hexadecyltrimethylammonium bromide, 2.645 mg ferric chloride hexahydrate, 295.25 mg sodium dihydrogen phosphate dihydrate, 1213.5 mg disodium hydrogen phosphate dodecahydrate, 125 mg ammonium chloride, 37.5 mg potassium dihydrogen phosphate, 62.5 mg sodium chloride, 15 g agar, pH 6.8 ± 0.1, 1000 mL distilled water.

[0083] Ashby solid medium (nitrogen-fixing): 0.2 g potassium dihydrogen phosphate, 0.2 g magnesium sulfate, 0.2 g sodium chloride, 5 g calcium carbonate, 10 g mannitol, 0.1 g calcium sulfate dihydrate, 15 g agar, 1 L pure water, pH 7.0-7.5.

[0084] Pikovskaya medium (inorganic phosphate): glucose 10.0 g, ammonium sulfate 0.5 g, sodium chloride 0.3 g, magnesium sulfate heptahydrate 0.3 g, manganese sulfate monohydrate 0.03 g, potassium chloride 0.3 g, ferrous sulfate heptahydrate 0.03 g, tricalcium phosphate 5.0 g, yeast extract 0.5 g (optional), agar 15.0 g, purified water 1 L, pH 7.0 ± 0.2.

[0085] Montana organophosphate medium: glucose 10.0 g, ammonium sulfate 0.5 g, sodium chloride 0.3 g, magnesium sulfate heptahydrate 0.3 g, manganese sulfate monohydrate 0.03 g, potassium chloride 0.3 g, ferrous sulfate heptahydrate 0.03 g, lecithin 2.0 g, yeast extract 0.5 g (optional), agar 15.0 g, purified water 1 L, pH 7.0 ± 0.2g

[0086] Chitinase detection medium: yeast powder 5g, peptone 5g, NaCl 5g, chitin 10g, agar 15-20g, distilled water 1000ml, pH 7.0-7.2.

[0087] Dextran agar medium: 4.0 g of Poria powder, 17.9 g of disodium hydrogen phosphate, 6.8 g of potassium dihydrogen phosphate, 6.7 g of yeast powder, 0.06 g of aniline blue, 15 g of agar, dilute to 1000 mL with distilled water, pH 7.2.

[0088] Alexandrov medium: 2 g disodium hydrogen phosphate, 1 g potassium feldspar powder, 0.5 g magnesium sulfate heptahydrate, 0.1 g calcium carbonate, 0.05 g ferric chloride, 5 g sucrose, 15 g agar, and 1000 mL pure water.

[0089] (1) Starch hydrolysis test: JDB15 bacteria were inoculated into a starch-containing culture medium and cultured in a 28°C incubator for 3 days. The colonies were stained with iodine solution. If there was a clear transparent circle around the colony, it was a positive bacterium.

[0090] (2) Cellulase assay method: strain JDB15 was inoculated onto a CMC plate according to the above method. After being placed in a 28°C incubator for 3 days, an appropriate amount of Congo red solution (1 mg / mL) was poured onto the plate and stained for 15 minutes. The plate was then rinsed several times with sodium chloride solution (1 mol / L). Whether a yellow halo appeared around the colony was observed. If so, it indicated that the strain could produce cellulase. The diameter of the halo was measured and recorded.

[0091] (3) Pectinase assay method: Inoculate strain JDB15 onto a pectin culture medium plate according to the above method. After placing it in a 28°C incubator for 3 days, stain the colonies with iodine solution. If there is a clear transparent circle around the colony, it is a positive bacterium.

[0092] (4) Protease assay: Place a sterile filter paper disc in the center of a skim milk agar plate. Take 10 μL of the test strain cultured in LB for 24 h and slowly inoculate it onto the filter paper disc. Place the plate in a 28°C incubator for 3 days. If a clear zone forms around the colony, the strain can produce protease. Measure and record the diameter of the clear zone.

[0093] (5) Iron carrier determination method: CAS plates were used to detect the production of iron carriers. The strain was inoculated in the center of the CAS plate and cultured at 28°C for 3 to 5 days. The colony was observed to see whether an orange halo was formed around it. If so, it indicated that the strain could secrete iron carriers. The diameter of the halo was measured and recorded.

[0094] (6) Auxin IAA assay: The IAA production was quantitatively determined using a colorimetric method. The strain was inoculated into 4 mL of LB medium containing 40 mg of tryptophan. LB medium without the strain was used as a negative control. After incubation at 28°C for 48 h, 1.5 mL of the culture medium was taken and centrifuged at 12100 rpm for 10 min. 0.5 mL of the supernatant was mixed with 1 mL of Salkowski reagent, placed in a 1.5 mL tube, and incubated in the dark at 25°C for 30 min. The production of IAA was determined by color change.

[0095] (7) Determination of inorganic phosphorus: JDB15 was activated in LB solid medium and cultured at 28°C for 48 h. Then, a sterile toothpick was used to pick up the colonies and inoculate them in Pikovskaya medium in a clean bench.

[0096] (8) Method for determination of organophosphorus: JDB15 was activated using LB solid medium and cultured at 28°C for 48 h. Then, a sterile toothpick was used to pick up the colonies and inoculate them on Montgena organophosphorus medium in a clean bench.

[0097] (9) Nitrogen fixation determination method: JDB15 was activated using LB solid medium and cultured at 28°C for 48 h. Then, in a clean bench, a sterile toothpick was used to pick up the colony and inoculate it on Ashby solid medium.

[0098] (10) Potassium dissolution assay: JDB15 was activated in LB solid medium and cultured at 28°C for 48 h. Then, a sterile toothpick was used to pick up the colonies and inoculate them in Alexandrov medium in a clean bench.

[0099] (11) Chitinase detection method: The bacteria were first streaked on an LB plate and cultured at 28°C for 48 h. The plate was coated with about 10 ml of sterile water to prepare a bacterial suspension. 1 μl of the suspension was then aspirated and spotted on a colloidal chitin plate and cultured until a transparent circle appeared.

[0100] (12) Determination method of dextranase detection medium: Use LB solid medium to activate JDB15, culture at 28°C for 48 hours, and then use a sterile toothpick to pick up the colony and inoculate it on dextran agar medium in an ultra-clean workbench.

[0101] The results of the test are shown in Figure 10 As shown in Table 2, strain JDB15 has a strong protease secretion capacity, a clear zone diameter of 25.6 mm, cellulase secretion capacity, a halo diameter of 40.5 mm, and strong amylase (diameter 30.4 mm) and pectinase (diameter 35.5 mm) secretion activities. It also produces IAA but lacks the ability to produce siderophores. It also has the ability to fix nitrogen, dissolve potassium, and solubilize inorganic phosphate, but lacks the ability to solubilize organic phosphate. Strain JDL4 secretes protease activity but does not secrete IAA and has no ability to produce siderophores.

[0102] Table 2 Physiological and biochemical test results of strains JDB15 and JDL4

[0103] Physiology and Biochemistry JDB15 JDL4 Growth promoting properties JDB15 JDL4 amylase + IAA + - Cellulase + Solution of inorganic phosphorus + Pectinase + Organic phosphorus solution - Protease + + Nitrogen fixation + Siderophore-producing - - Potassium + Chitinase + β1,3-glucanase -

[0104] (13) NaCl tolerance experiment: In order to explore the tolerance of the strain to NaCl, LB culture medium containing different NaCl concentrations (0%, 2%, 4%, 6%, 8%, 10%) was prepared to ensure that other nutritional conditions were consistent. The strains were inoculated into the culture medium and placed at 28°C for 3 days. After the culture was completed, the growth of the strains was observed and their growth ability at different NaCl concentrations was recorded to determine the upper and lower limits of the strain's tolerance to NaCl. The results are shown in Figure 2. Figure 11 and as shown in Table 3.

[0105] Table 3 NaCl tolerance test results

[0106] NaCl concentration JDB15 NaCl concentration JDL4 0 + 0 + 2% + 0.25M + 4% + 0.5M + 6% + 0.75M + 8% + 1M + 10% +

[0107] (14) Six carbon sources, including glycerol, sodium acetate, glucose, galactose, sucrose, and ethanol, were used to replace the carbon source in the basal culture medium. PDA culture medium was used as a control. The uniformly growing Trichoderma JDL4 cake was inoculated in the middle of each carbon source culture medium and placed in a constant temperature incubator at 28°C for 5 days. The growth status was observed and recorded.

[0108] The results are as follows Figure 12 JDL4 produced almost no aerial hyphae and no pigment in nitrogen-deficient (-N) and sodium acetate media, but grew well and produced yellow-green pigment in other media.

[0109] Analysis of the parasitic characteristics of JDL4: The experimental method adopted the JDL4 antagonism in "1" Foc 4. The control group Foc 4. Cut the edge of the block and put it into the electron microscope fixative. Foc 4. Cut the hyphae that have been in contact with JDL4 into pieces and place them in electron microscope fixative, dehydrate them in ethanol gradient, and observe them by spraying gold ( Figure 13 The experimental group antagonist plate Foc 4. Mycelia in contact with JDL4 were directly cut into pieces and observed under a microscope ( Figure 13 JDL4 can parasitize Foc 4. Mycelium leads to Foc 4. Mycelium breaks and dies, thus blocking the fungus. Foc 4. Growth of mycelium.

[0110] 4. Determination of the broad-spectrum antifungal activity of JDL4

[0111] Six common fungal pathogens were tested: Botrytis cinerea, Fusarium graminearum, Rhizoctonia solani, Colletotrichum spp., Peach brown rot, and Alternaria alternata. Botrytis cinerea, Fusarium graminearum, and Alternaria alternata were deposited by Chen Xiaolin's group at Huazhong Agricultural University. Rhizoctonia solani was provided by Professor Yang Long of the College of Plant Science and Technology at Huazhong Agricultural University, while Colletotrichum spp. and Peach brown rot were provided by Professor Luo Chaoxi of the College of Plant Science and Technology at Huazhong Agricultural University.

[0112] Broad spectrum fungal antagonism: Foc TR4 was used as the target bacteria, and the antagonistic activity of the isolated Trichoderma was screened by dual culture test. Foc A TR4 bacterial cake (Φ=5mm) was placed on one edge of each PDA plate, and a purified Trichoderma strain bacterial cake (Φ=5mm) was inoculated on the other edge of the PDA medium. The two points were located on the same straight line, 5.5cm apart, and cultured at 28℃. Foc TR4 plates served as controls. After 96 hours, the colony radii of the pathogens and Trichoderma were measured and the inhibition rate was calculated. Inhibition rate (%) = (control colony diameter - treated colony diameter) / control colony diameter × 100%. Five replicates were performed per group, with three biological replicates.

[0113] The results are shown in Table 4 and Figure 14 Strain JDL4 showed inhibitory activity against all six tested pathogenic fungi, with the highest inhibition rate of 75.1% against Fusarium graminearum and the lowest inhibition rate of 68.1% against Colletotrichum syringae pv.

[0114] Table 4 Results of broad-spectrum antifungal activity assay of JDL4

[0115] pathogens Inhibition rate Botrytis cinerea 73.5±2.6% Fusarium graminearum 75.1±1.2% Rhizoctonia solani 71.7±2.1% Peach brown rot 74.7±1.9% Peach Anthracnose 68.1±1.6% Alternaria alternata 70.3±2.7%

[0116] 5. Determination of the antibacterial activity of antagonistic bacterial fermentation broth and its filtrate against banana wilt

[0117] Preparation of fermentation broth of strain JDL4: Select a well-growing JDL4 mycelial tip and inoculate it into a 250 mL Erlenmeyer flask containing 100 mL of PDB medium. Incubate the flask in a constant-temperature shaking incubator at 180 rpm and 28°C for 2 days. Inoculate 0.5% of the prepared seed solution into PDB medium and shake at 180 rpm and 28°C for 7 days to obtain JDL4 fermentation broth.

[0118] Preparation of fermentation broth of strain JDB15: Inoculate a single colony of the strain into 2 mL of liquid LB medium, shake at 28°C, 180 rpm for 24 h until the culture solution becomes turbid, draw 100 μL of the culture solution and add 100 mL of liquid LB medium to continue fermentation, and shake the fermentation solution until the OD 600 =1 concentration, diluted to 1×10 7 CFU / ml, set aside.

[0119] (1) Experimental method: Control group ( Foc 4) PDA culture medium, treatment group ( Foc (4+JDL4) The fermentation supernatant was added to cooled PDA medium at ratios of 10%, 15%, and 20% of the culture volume. After solidification, the banana wilt pathogen Foc4 was inoculated into the center of the PDA using a 5mm borer. The culture was then placed in a 25°C incubator. After the control group had grown to full growth, the growth of the treated groups was observed and the inhibition rate was calculated. Inhibition rate (%) = (control colony diameter - treated colony diameter) / control colony diameter × 100%.

[0120] The results showed that ( Figure 15 (above), the fermentation broth of strains with different added volumes Foc 4 had inhibitory effects, with inhibition rates of 19.67%, 29.4% and 40.19% respectively.

[0121] (2) Experimental method: Take JDL4 fermentation broth and JBD15 fermentation broth respectively, filter and sterilize them with two layers of 0.22μm pore size filters, and take the filtrate. Foc 4 spore suspension (10 6 CFU / mL) and the filtrate of the fermentation broth of the strain with a suspension volume of 10% were fully mixed and three combinations were set: ( Foc 4+JDB15), ( Foc 4+JDL4), ( Foc 4+JDB15+JDL4), and an equal volume of sterile water was used as a control (CK). Foc The fermentation filtrates of the two strains (JDL4, JDB15, and JDL4) were mixed in a 1:1 volume ratio. The mixture was dripped onto a hydrophobic glass slide, placed in a glass dish containing moistened filter paper, and incubated in a 28°C incubator for 12 hours. Three biological replicates were set up for each treatment. Spore germination was counted, and the germination rate was calculated as follows: Germination rate (%) = number of germinated spores / total number of spores × 100%.

[0122] Experimental results ( Figure 15 The germination rate of the control group was about 71%, and the germination rate of the JDB15-treated group was about 10%. FocThe spore germination rate of strain 4 was only 22.56%, and the germination rate of the treatment group of strain JDL4 was about 30%. The combination of the two strains could reduce the spore germination rate to 12%, which was significantly lower than that of the control group, indicating that the filtrate of the combined fermentation broth could significantly inhibit the growth of Foc 4 spores germinated, and the inhibitory effect was more obvious than that of a single fermentation broth. At the same time, no spore germination of other microorganisms was observed during the experiment, indicating that there were no other microorganisms remaining in the two filtrates.

[0123] 6. Banana seedling pot inoculation test

[0124] The fermentation broth of strains JDB15 and JDL4 was prepared in the same manner as in step 5. The JDL4 fermentation broth was sterilized by filtration using two layers of 0.22 μm pore size filters, and the filtrate was collected.

[0125] The effectiveness of the antagonistic bacterial fermentation liquid against banana wilt was further verified in a greenhouse at an average temperature of 28°C and a relative humidity of 70%. When banana seedlings grew in seedling bags and had 3 to 4 true leaves, they were transplanted into 50ml centrifuge tubes. Three treatments were set up: a negative control consisting of H2O (sterile deionized water), Foc TR4 (positive control 1.0 × 10 7 CFU / ml), antagonistic strain JDB15 (1.0 × 10 7 CFU / ml)+ Foc TR4 (1.0 × 10 7 CFU / ml), antagonistic strain JDL4+ Foc TR4 (1.0 × 10 7 CFU / ml), antagonistic strain JDB15 (1.0 × 10 7 CFU / ml) + antagonistic strain JDL4 + Foc TR4 (1.0 × 10 7 CFU / ml). First, apply the antagonistic bacteria fermentation liquid to the roots of the damaged banana plants for soaking treatment, and then add 20ml of Foc TR4 spore suspension was applied to the roots of banana plants and 20 ml of antagonistic bacteria fermentation liquid was added. 10 plants ( Figure 16 According to Himaman et al. (2016), each group of banana seedlings was divided into five grades, calculated based on the percentage of diseased leaves in a plant: Grade 0: healthy plants, Grade 1: 1-25% diseased leaves, Grade 2: 26-50% diseased leaves, Grade 3: 51-75% diseased leaves, and Grade 4: more than 75% diseased leaves. The disease index (DI) for banana wilt is calculated as follows:

[0126]

[0127] Compared with the control group, the groups treated with the antagonistic strain JDB15, the antagonistic strain JDL4, and the antagonistic strain JDB15 + antagonistic strain JDL4 significantly reduced leaf wilting and bulb rot, and the disease index was significantly lower. Furthermore, the efficacy of the JDB15 + JDL4 combination was significantly higher than that of the individual bacterial solutions / fermentation solutions. Therefore, JDB15 and JDL4 have a certain inhibitory effect on banana Fusarium wilt, and the efficacy of the JDB15 + JDL4 combination was significantly higher than that of the individual bacterial solutions / fermentation solutions.

[0128] 7. The effect of compound microbial agents on the prevention and control of other fungal diseases

[0129] The fermentation broths of strains JDB15 and JDL4 were prepared in the same manner as in step 5. The fermentation broth of strain JDB15 was used directly, and the fermentation broth of strain JDL4 was filtered through two layers of 0.22 μm pore size filters to obtain the filtrate for use in the experiment.

[0130] (1) Rice blast (barley, rice)

[0131] The spore suspension was prepared with 0.05% (v / v) Tween 20 and the spore concentration was adjusted to 1.0 × 10 5 CFU / ml. This spore solution was mixed with water, JDB15, JDL4, and JDB15 + JDL4 (1:1 volume ratio) at a 1:1 volume ratio. A negative control was treated with pure water. The spore solution was then sprayed onto the front of 7-day-old barley leaves. Seal with plastic wrap and leave in the dark at 28°C for 24 hours before exposure to light. After 48 days, the plastic wrap was removed for ventilation, ensuring moisture retention. After 5 days, the inoculation results were observed and photographed.

[0132] Cut barley leaves of appropriate size with scissors, and use a 10μl gun to draw up the above spore mixture and inoculate it on the front of the barley leaves. Keep them in the dark at 28℃ for 24 hours and then expose them to light. After 48 days, remove the plastic wrap and ventilate them, paying attention to moisture retention. After 5 days, observe the inoculation results and take pictures.

[0133] Use a needle to make three equal-length wounds on the vertical veins of the rice leaf as one inoculation point. 2-3 inoculation points can be set on each rice leaf. Use 0.05% (v / v) Tween 20 to prepare a spore suspension and adjust the spore concentration to 1.0 × 10 5 CFU / ml, and the spore solution was mixed with water, JDB15, JDL4, and JDB15 + JDL4 in a 1:1 ratio. After incubation at 28°C under light for 5 days, the disease was observed and the leaves were kept moist.

[0134] The results are as follows Figure 17As shown, a combination of JDB15 fermentation broth and JDL4 bacterial filtrate reduced rice blast by 50%. The JDB15 fermentation broth reduced the incidence of rice blast by 50%, and the JDL4 filtrate also reduced the incidence. Furthermore, the JDB15 + JDL4 combination significantly reduced pathogenicity, and the effect was more pronounced than either the fermentation broth or the filtrate alone.

[0135] (2) Corn leaf spot

[0136] After sporulation, the test strain was washed with 0.05% (v / v) Tween20 aqueous solution to prepare a suspension, and the concentration was adjusted to 1×10 4 CFU / mL. Seven-day-old corn seedlings of similar growth were selected as test subjects. The spore solution was mixed with water, JDB15, JDL4, or JDB15 + JDL4 (1:1 volume ratio) at a 1:1 volume ratio. The leaves were lightly scratched with a syringe needle. The spore solution was then applied to the scratched area with the tip of a syringe. After the disease developed, a photo was taken.

[0137] The results are as follows Figure 18 As shown, a combination of JDB15 fermentation broth and JDL4 filtrate reduced the incidence of rice blast by 50%, and of corn leaf spot by 50%. Furthermore, a JDB15 + JDL4 combination significantly reduced pathogenicity, with the combined effect being more pronounced than either fermentation broth or filtrate alone.

[0138] (3) Tomato wilt

[0139] The wild-type strain of Fusarium oxysporum was activated on a plate for 4 days, and then a cake was taken from the edge of the colony and shaken in PDB liquid medium. Conidia were collected after 20 hours. Conidia were counted using a hemocytometer and the spore concentration of tomato wilt pathogen was diluted to 1×10 7 CFU / mL. The pathogenicity test of Fusarium oxysporum was conducted by the root dipping method. Tomato seedlings with 4 new leaves of uniform growth were selected. The soil at the roots was removed and the roots were rinsed with clean water. The root tips were cut with scissors to create artificial wounds to facilitate the infection of pathogenic fungi. Ten tomato seedlings with uniform growth momentum were selected as a group. The roots were immersed in a solution of 1:1 (clean water + Fol )(WT)、(JDB15+ Fol )、(JDL4+ Fol ) 、(JDB15+ JDL4+ Fol ), (clear water) 5 combinations. (JDB15+ JDL4+ Fol) group, the volume ratio of JDB15 to JDL4 was 1:1. After soaking each group for 30 minutes, the tomato seedlings were removed and replanted in small pots filled with nutrient soil. The tomato seedlings were placed in an artificial climate chamber for cultivation. The disease status of the plants was recorded, photographed, and the disease index of the tomato seedlings was calculated. Figure 19 The addition of JDB15 fermentation broth and JDL4 filtrate significantly reduced the disease index of tomato Fusarium wilt compared to the WT group. Furthermore, as the experiment progressed, the disease index of the JDB15 fermentation broth and JDL4 filtrate treatment groups decreased to varying degrees compared to the water treatment group, with the combined bacterial solution showing a more significant decrease. This suggests that the combined bacterial solution has a significant inhibitory effect on tomato Fusarium wilt, and the inhibitory effect becomes more pronounced over time.

Claims

1. A banana endophytic Trichoderma harzianum JDL4, characterized in that Named: Trichoderma harzianum , registered and deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 66430.

2. The fermentation liquid or the filtrate of the fermentation liquid of the banana endophytic Trichoderma harzianum JDL4 as claimed in claim 1, wherein the preparation method of the filtrate comprises the following steps: inoculating Trichoderma harzianum JDL4 in PDB medium to obtain a fermentation liquid; filtering the fermentation liquid through two layers of 0.22 μm pore size filters to obtain the filtrate.

3. A composite bacterial agent, characterized in that: Contains the filtrate of the fermentation broth of Trichoderma harzianum JDL4 according to claim 2 and Bacillus velez JDB15, wherein the Bacillus velez JDB15 is named: Bacillus velezensis , registered and deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 66431.

4. Use of the Trichoderma harzianum JDL4 according to claim 1 or the fermentation broth according to claim 2 in the preparation of a preparation for antagonizing plant pathogens and / or diseases caused by said plant pathogens; said plant pathogens are: Botrytis cinerea, Fusarium graminearum, Rhizoctonia solani, Colletotrichum syringae prunellae, Peach anthracnose, Peach brown rot and / or Alternaria alternata.

5. Use of the filtrate of the fermentation broth according to claim 2 or the composite bacterial agent according to claim 3 in the preparation of a method for preventing and treating plant pathogens and / or diseases caused by said plant pathogens, wherein said plant pathogens are banana wilt pathogen, rice blast pathogen, tomato wilt pathogen and / or corn leaf blight pathogen.

6. Use of the Trichoderma harzianum JDL4 according to claim 1, or the filtrate of the fermentation broth according to claim 2, or the composite bacterial agent according to claim 3 in the preparation of a preparation for enhancing the inhibitory activity of Bacillus velez JDB15 against plant pathogens, wherein the plant pathogens are: banana wilt pathogen, rice blast pathogen, tomato wilt pathogen and / or corn leaf blight pathogen; the Bacillus velez JDB15 is named: Bacillus velezensis , registered and deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 66431.

7. Use of the filtrate of the fermentation liquid according to claim 2 or the composite bacterial agent according to claim 3 in preparing a preparation for improving the resistance of banana plants to banana wilt disease, characterized in that: The filtrate of the fermentation liquid or the composite bacterial agent inhibits banana wilt disease by inhibiting the growth of banana wilt pathogen mycelium and / or inhibiting the germination of banana wilt pathogen spores.

Images