A multivalent aptamer probe for capturing Salmonella, preparation method and application thereof in detecting Salmonella
By combining multivalent aptamer probes with cerium oxide nanozyme hydrogel complexes, one-tube high-sensitivity Salmonella detection is achieved using HCR and CHA reactions, solving the problems of secondary contamination and insufficient signal amplification in existing technologies. It is suitable for food safety, environmental monitoring and clinical diagnosis.
Patent Information
- Application Number
- CN202510999962.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-21
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-07-21
AI Technical Summary
Existing Salmonella detection methods have the risk of secondary contamination and insignificant signal amplification effect, making it difficult to achieve high-sensitivity and accurate detection in complex samples.
By combining multivalent aptamer probes with cerium oxide nanozyme hydrogel complexes, one-tube detection is achieved through hybridization chain reaction (HCR) and catalytic hairpin assembly (CHA) reaction, avoiding the need for opening the lid, and improving detection sensitivity through dual signal amplification technology.
It achieves ultra-sensitive and specific detection in the range of 101 to 107 CFU/mL, simplifies the detection process, reduces environmental interference, and improves the stability and accuracy of detection. It is suitable for fields such as food safety, environmental monitoring and clinical diagnosis.
Smart Images

Figure CN120505321B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the technical field of Salmonella detection, and in particular to a multivalent aptamer probe for capturing Salmonella, a preparation method thereof, and an application thereof in detecting Salmonella. Background Art
[0002] Salmonella infection is the leading cause of food poisoning, significantly impacting society and the economy. Salmonella typhimurium is the primary serotype responsible for Salmonella infection. Its decomposition releases highly toxic endotoxins, leading to symptoms such as enteritis, diarrhea, fever, stomach discomfort, nausea, vomiting, and headaches.
[0003] The application of aptamers has been increasing in recent years. Aptamers are highly specific, short DNA or RNA sequences that precisely target their target. Compared to antibodies, aptamers have simpler structures, lower costs, and superior stability, making them a promising alternative to antibodies.
[0004] To this end, Chinese invention patent application No. 202211081913.1 discloses a method for preparing a multivalent aptamer for detecting Salmonella based on HCR and its application. In this multivalent aptamer, two hairpin DNAs are modified during HCR amplification. The resulting HCR product serves as a scaffold for the signal carrier (horseradish peroxidase), achieving signal amplification and greatly improving the sensitivity of the detection method.
[0005] For example, Chinese invention patent 202510269167.6 discloses a dual-probe detection reagent for detecting Salmonella typhimurium and its preparation method. The magnetic separation probe reagent solution can enrich Salmonella typhimurium, and then specifically bind to Salmonella typhimurium through the red fluorescent nanozyme probe, and generate Salmonella typhimurium concentration-dependent fluorescence signals and colorimetric signals, thereby mutual verification between the dual-modal signals, playing an internal proofreading role, and ensuring accurate detection results.
[0006] However, the solutions described in the above patent documents have the following disadvantages in actual application:
[0007] Detection operation part: Patent 202211081913.1 uses an enzyme-labeled plate to adsorb samples, and adds samples, aptamer solution, SA-HRP enzyme-labeled reagent, TMB colorimetric solution and stop solution in steps. Patent 202510269167.6 uses magnetic separation probes to mix with samples, magnetic separation washing, opening the lid to remove the supernatant, adding fluorescent probes for secondary incubation and adding DMSO for dissolution and detection. All of these operations require multiple opening processes, which can easily cause secondary contamination and affect the detection results; 2. Detection signal part: Patent 202211081913.1 uses HCR technology to achieve signal amplification, but only relies on the HCR skeleton as a signal carrier, and generates a colorimetric signal through the combination of streptavidin-horseradish peroxidase and biotin-labeled aptamer. The signal amplification factor is relatively low, and it mainly relies on colorimetric signals for detection. It lacks diversified detection signals and is easily affected by background interference in complex samples, affecting the accuracy of the detection results. Patent 202510269167.6 uses a combination of magnetic separation probes and red fluorescent nanozyme probes to achieve dual-modal detection through fluorescent signals and colorimetric signals, but the signal amplification effect is not obvious, making it difficult to detect low concentrations of target bacteria. Summary of the Invention
[0008] The present invention provides a multivalent aptamer probe for capturing Salmonella, a preparation method and its application in detecting Salmonella. The multivalent aptamer probe has the advantages of one-tube detection, no secondary contamination and high detection sensitivity when used in the process of detecting Salmonella.
[0009] The object of the present invention is achieved through the following technical solutions:
[0010] A multivalent aptamer probe for capturing Salmonella is prepared from a DNA sample H1, a DNA sample H2, an activation strand, an aptamer, and cDNA dry powder by hybridization chain reaction technology; wherein:
[0011] The sequence of DNA sample H1, SEQ ID NO: 1, is (hereinafter referred to as H1):
[0012] TTTCCCTTATATTCTCTCTTCCTCCTGCGGGAATGTCTAGGTGATTGAGTGGTGTGTTATCCCACTCAATCACCTAGACCATTCCGCAACAACATAC.
[0013] The sequence of DNA sample H2, SEQ ID NO: 2 (hereinafter referred to as H2), is:
[0014] GATAACACACCACTCAATCACCTAGACATTCCCGCAGTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGGCCTCTAAATTTAATTTATTAT.
[0015] The sequence of the activation chain SEQ ID NO: 3 is:
[0016] GTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGG.
[0017] The sequence of the aptamer is SEQ ID NO: 4:
[0018] GAGAGAGAATATAAGGGAAAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT.
[0019] The sequence of cDNA is SEQ ID NO: 5:
[0020] CAAACCACCGTGGTTACAGT.
[0021] The present invention also provides a method for preparing a multivalent aptamer probe for capturing Salmonella, the preparation method comprising the following steps:
[0022] S01, extract DNA sample H1, DNA sample H2, activation chain, aptamer and cDNA dry powder with a volume ratio of 1.5:1:1:1:1, add phosphate buffered saline solution to dissolve them to a concentration of 100 μmol / L, mix and centrifuge at 6000 rpm for 30 s to obtain a mixture.
[0023] S02. The mixture is dissolved in phosphate buffered saline to obtain a 100 μmol / L aptamer stock solution.
[0024] S03. Extract DNA samples H1 and H2 (H1 and H2 are the same as above, 2H1 and 2H2 are H1 and H2 in the CHA reaction) and aptamer stock solution, heat them in a 95°C water bath for 10 minutes, and then cool them for 10 minutes to obtain DNA secondary structure samples.
[0025] S04. Mix the activated strand, DNA sample H1, and DNA sample H2 at a volume ratio of 1:1.5:1, place on a 37°C constant temperature shaker, and incubate overnight at 110 rpm to obtain an HCR reaction product.
[0026] S05, HCR reaction products were mixed with aptamers and cDNA, and the mixture was shaken at 37°C and 130 rpm for 2 h to synthesize multivalent aptamer probes.
[0027] The present invention also discloses a method for detecting Salmonella by combining a multivalent aptamer probe with a cerium oxide nanozyme hydrogel complex, the method comprising the following steps:
[0028] (1) After homogenizing the sample to be tested, filter it, and centrifuge the filtrate at 2000-6000 rpm for 10 minutes to obtain the detection matrix.
[0029] (2) The multivalent aptamer probe and the cerium oxide nanozyme hydrogel complex are mixed and placed in a centrifuge tube.
[0030] (2) Add the detection matrix into the centrifuge tube and react for 30 minutes.
[0031] (3) Use a microplate reader to measure the relative fluorescence intensity and absorbance to achieve simultaneous fluorescence and colorimetric detection of Salmonella in the sample to be tested. (DNA sample H1 and DNA sample H2 are hereinafter referred to as H1 and H2)
[0032] In the above scheme, HCR hairpins (H1 and H2) are used to construct the HCR scaffold, where DNA sample H1 and DNA sample H2 have overhangs to hybridize cDNA and aptamer double strands. In the presence of the activation strand, HCR will form a multivalent aptamer probe.
[0033] When Salmonella is present, the multivalent aptamer probe specifically recognizes Salmonella and releases cDNA, which is used to trigger catalytic hairpin self-assembly. In the presence of cDNA, the fluorescent-group-carrying hairpin DNA samples 2H1 and 2H2 on the CeO2 nanozyme hydrogel undergo a CHA reaction with the cDNA, releasing the hairpins of DNA samples 2H1 and 2H2. The fluorescent group on DNA sample 2H1 separates from the nanozyme, generating a corresponding fluorescent signal. Simultaneously, due to the release of the active site on the CeO2 nanozyme, a colorimetric signal is generated upon addition of TMB. Therefore, this design enables simultaneous fluorescent and colorimetric detection of Salmonella. The multivalent aptamer probe exhibits high binding affinity for the target bacteria, and signal amplification and readout are achieved through the CHA reaction and the oxidase-like activity of the CeO2 nanozyme hydrogel.
[0034] Preferably, in step (2), the concentration of the multivalent aptamer probe is 0.1 mM to 1 mM.
[0035] Preferably, in step (2), the concentration of cerium oxide nanozyme is 100 μg / mL~300 μg / mL, the concentration of hydrogel is 0.5~10 mmol / L, and the mass ratio of cerium oxide nanozyme to hydrogel is 1:9.
[0036] Preferably, in step (2), the preparation method of the cerium oxide nanozyme hydrogel complex is:
[0037] Cerium nitrate and sodium hydroxide are measured, mixed, and the pH is adjusted to 7-8 to obtain a mixture containing cerium oxide nanoparticle precipitates.
[0038] The mixed solution was subjected to hydrothermal conversion at a temperature of 60° C. for 4 hours. After the reaction was completed, the mixed solution was cooled to room temperature and centrifuged to obtain the cerium oxide nanozyme.
[0039] Mix agarose with PBS buffer, heat in a water bath at 80-90°C, and stir until the agarose is completely dissolved and becomes colorless to obtain an agarose solution.
[0040] The agarose solution was cooled to 45-55°C, TMB solution was added, and the solution was stirred in the dark until dissolved to obtain TMB agarose solution.
[0041] The TMB agarose solution and the ceria nanozyme were mixed to obtain a ceria nanozyme hydrogel mixture;
[0042] DNA sample 2H1 and DNA sample 2H2 are added to the cerium oxide nanozyme hydrogel mixture, and the cerium oxide nanozyme hydrogel complex is obtained after mixing.
[0043] Among them, the sequence of DNA sample 2H1 (hereinafter referred to as 2H1) is SEQ ID NO:6:
[0044] ACCGTGGTTACAGTCCATGTGTAGAACTGTAACCACGGTGGTT.
[0045] The sequence of DNA sample 2H2, SEQ ID NO: 7 (hereinafter referred to as 2H2):
[0046] TGGTTACAGTTCTACACATGGACTGTAACCACGGTAGTCCATGTGTAGA
[0047] Preferably, the mass ratio of TMB agarose solution to cerium oxide nanoparticles is 9:1.
[0048] Preferably, in step (3), the excitation wavelength is 492 nm and the emission wavelength is 518 nm.
[0049] Compared with the prior art, the advantages or beneficial effects of the technical solution of this application include:
[0050] 1. This scheme is a universal and reconstruction-free detection platform that uses aptamer probes to combine CHA amplification technology with nanozyme hydrogels to achieve ultra-sensitive detection of Salmonella. Due to the high binding affinity and specificity of multivalency, as well as the tandem signal amplification of numerous repeating units in the long HCR scaffold and enzyme-free signal amplification technology, the system can be used in 10 1 to 10 7 The assay is within the linear range of 8 CFU / mL, achieving ultrasensitive and specific detection with an LOD of 8 CFU / mL without the need for nucleic acid amplification.
[0051] 2. This method has outstanding performance in terms of sensitivity and specificity, and has good stability and practicality. The addition of nanozyme hydrogel improves the signal amplification efficiency, avoids the complicated operation steps of traditional nucleic acid amplification methods, and simplifies the detection process. Based on this, the platform can also achieve accurate detection in complex sample matrices, showing excellent anti-interference ability and stable detection performance.
[0052] 3. The platform is highly versatile and can flexibly replace aptamer probes based on the target pathogen, expanding its application potential in areas such as food safety, environmental monitoring, and clinical diagnosis. Future research can optimize the stability and convenience of the system to promote its widespread application in actual detection.
[0053] 4. The closed one-tube detection system pre-embeds the TMB chromogenic substrate in agarose hydrogel and solidifies it on the wall of the centrifuge tube, combined with the cerium oxide nanozyme-HCR aptamer complex, to achieve zero-opening operation throughout the entire process, eliminating aerosol contamination, liquid splashing, and environmental microbial interference caused by multiple openings and reagent additions in traditional testing.
[0054] 5. A two-stage signal amplification system, HCR and CHA, was constructed, significantly improving sensitivity. HCR generates a DNA scaffold through a trigger chain, forming a high-affinity probe to achieve target capture amplification. The cDNA released during capture acts as a catalyst to drive a secondary CHA reaction, prompting the repeated assembly and release of fluorescent hairpins fixed to the surface of the enzyme-like CeO2 nanozyme. This process generates a cascade of dual signal amplification, combining HCR capture amplification with CHA. BRIEF DESCRIPTION OF THE DRAWINGS
[0055] Figure 1 Flowchart of the fluorescence / colorimetric dual-mode detection platform based on aptamers and ceria nanozymes;
[0056] Figure 2 Figure 1 is the agarose gel electrophoresis result of the multivalent aptamer probe;
[0057] Figure 3 is the absorbance comparison diagram of single multivalent aptamer probes;
[0058] Figure 4 Agarose gel electrophoresis results of the ability of HCR multivalent aptamer probe to capture Salmonella;
[0059] Figure 5 Transmission electron microscopy (TEM) images show that CeO2 nanozymes have a spherical structure;
[0060] Figure 6 is the rate curve diagram;
[0061] Figure 7 The Lineweaver-Burk double reciprocal curve shows a good linear relationship between 1 / V and 1 / S;
[0062] Figure 8 is the absorbance of enzyme simulated activity;
[0063] Figure 9 It is a fluorescent signal that simulates enzyme activity;
[0064] Figure 10 The CHA reaction on the nanozyme surface can simultaneously generate fluorescence and colorimetric signal images;
[0065] Figure 11 It is a statistical graph of reaction time;
[0066] Figure 12 is a statistical graph of TMB concentration;
[0067] Figure 13 is the probe concentration map;
[0068] Figure 14 is the linear relationship between the colorimetric signal reading and the Salmonella concentration (n = 3);
[0069] Figure 15 The concentration for Salmonella and non-target bacteria was 10 5 CFU / mL, NTC, negative control; error bars indicate standard deviation (n=3), absorbance statistics;
[0070] Figure 16 The concentration for Salmonella and non-target bacteria was 10 5 CFU / mL. NTC, negative control. Error bars represent standard deviation (n = 3). Fluorescence intensity statistics.
[0071] Figure 17 is the colorimetric detection stability diagram;
[0072] Figure 18 is the fluorescence detection stability diagram;
[0073] Figure 19 This is the colorimetric detection result diagram of the actual sample;
[0074] Figure 20 This is the fluorescence detection result of the actual sample. DETAILED DESCRIPTION
[0075] The following will describe the implementation methods of this application in detail with reference to the accompanying drawings and examples, so that the application can fully understand how technical means are used to solve technical problems and achieve corresponding technical effects, and implement them accordingly. The embodiments of this application and the various features therein can be combined with each other without conflict, and the resulting technical solutions are all within the scope of protection of this application.
[0076] It should be clear that the embodiments described below are only some of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without making any creative work are within the scope of protection of this application.
[0077] Example 1: This example describes in detail the multivalent aptamer probe and its preparation method:
[0078] 1. Experimental strains
[0079] In this study, Salmonella typhimurium ( Salmonella typhimurium), Salmonella Enteritidis ( Salmonella enteritidis), Listeria monocytogenes ( Listeria monocytogenes), Staphylococcus aureus ( Staphylococcus aureus), Vibrio parahaemolyticus ( Vibrio parahaemolyticus), Escherichia coli O157:H7 ( Escherichiacoli O157:H7), Vibrio alginolyticus ( Vibrio alginolyticus), Vibrio vulnificus ( Vibrio vulnificus) was used as the experimental strain, and the source and information of the strain are shown in Table 1.
[0080] Table 1 Sources and information of experimental strains
[0081]
[0082] 2. Main culture medium
[0083] The culture media used in this study are as follows: brain heart infusion broth (BHI) was produced by Haibo Biotechnology Co., Ltd.; xylose lysine deoxycholate agar (XLD agar) was produced by Haibo Biotechnology Co., Ltd.; LB broth was produced by Hangzhou Microbiological Reagent Co., Ltd.; and LB agar was produced by Hangzhou Microbiological Reagent Co., Ltd.
[0084] 3. Main reagents: The main reagents used in the experiments in this chapter are as follows:
[0085] Sybrgreen I (Dalian Meilun Biotechnology Co., Ltd.); bovine serum albumin (BSA) (Sangon Biotechnology (Shanghai) Co., Ltd.); tetramethylbenzidine hydrochloride (TMB) (Zhongke Ruitai (Beijing) Biotechnology Co., Ltd.); PBS buffer powder (Beijing Solebao Reagent Co., Ltd.); 20bp DNA ladder (Sangon Biotechnology (Shanghai) Co., Ltd.); sodium carbonate (Na2CO3, 98%) (Sinopharm Chemical Reagent Co., Ltd.); Tween-20 (Shanghai Aladdin Biochemical Technology Co., Ltd.); agarose (Sangon Biotechnology (Shanghai) Co., Ltd.); 50× TAE electrode buffer (Sangon Biotechnology (Shanghai) Co., Ltd.); DNA marker (100–2000bp) (Qingke Biotechnology); 4SGelRed nucleic acid dye (Sangon Biotechnology (Shanghai) Co., Ltd.); DNA loading buffer (Sangon Biotechnology (Shanghai) Co., Ltd.); 3-aminopropyltriethoxysilane (Sinopharm Chemical Reagent Co., Ltd.); thiourea (98%) (Sinopharm Chemical Reagent Co., Ltd.); 96-well ELISA plate (Costar, USA).
[0086] All nucleic acids used in this study were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai).
[0087] 4. Main instruments and equipment: The main instruments and equipment used in this study are shown in Table 2.
[0088] Table 2 Instruments and equipment
[0089]
[0090] 5. Experimental methods
[0091] (1) Bacterial culture and counting
[0092] Bacterial Culture: First, an aliquot of a representative Salmonella strain stored at -80°C was inoculated into BHI liquid medium and incubated at 37°C on a shaker at 130 rpm for 20 hours to allow for complete recovery. Other bacteria (e.g., Staphylococcus aureus (ATCC25923), Escherichia coli O157:H7 (ATCC43889), Vibrio parahaemolyticus (CICC21617), Listeria monocytogenes (CICC21540), Vibrio alginolyticus (ATCC17749), and Vibrio vulnificus (ATCC33866)) were recovered by incubation in LB medium overnight at 37°C. Prior to use, 1 mL of each bacterial suspension was centrifuged at 6000 rpm for 8 minutes, then washed twice with PBST buffer (0.01 M phosphate buffer + 0.01% Tween-20). Finally, the aliquot was resuspended in 1 mL of PBS and stored at 4°C for short-term use.
[0093] Plate count and preparation of bacterial suspension: dilute the bacterial suspension with PBS according to the 10-fold gradient dilution method, take 200 μL of the diluted bacterial solution and spread it on XLD agar medium, and incubate it in an inverted incubator at 37°C overnight. Repeat each concentration three times, and finally count the number of colonies. The results are expressed as CFU / mL. 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL and 10 7 All containers that come into contact with bacteria must be sterilized in an autoclave at 121°C for 15 minutes before and after use.
[0094] (2) Construction of multivalent aptamer probes based on HCR
[0095] Initially, two hairpin DNA samples (H1 and H2), the activation strand, the aptamer, and cDNA powder were extracted and centrifuged at 6000 rpm for 30 seconds. After centrifugation, the mixture was dissolved in phosphate-buffered saline to obtain a 100 μmol / L stock solution. A certain amount of the hairpin DNA samples (H1 and H2) and the aptamer stock solution were heated in a 95°C water bath for 10 minutes, then quickly removed and cooled on ice for 10 minutes to stabilize the DNA secondary structure. Subsequently, 0.02 μmol of the activation strand was mixed with 1 μmol of the hairpin DNA (H1 and H2) and incubated overnight in a 37°C shaker at 110 rpm. The HCR reaction product was successfully prepared. Subsequently, 1 micromole of aptamer was extracted and mixed with cDNA. The experimental process was carried out in a constant temperature oscillator at 37°C and an oscillation speed of 130 rpm. It took two hours to successfully synthesize a multivalent aptamer probe derived from HCR technology.
[0096] (3) Preparation of cerium oxide nanozyme complex
[0097] Measure 1 ml of 0.1 mol / L cerium nitrate and sodium hydroxide and mix the two liquids in a beaker. The pH of the solution is then adjusted to the appropriate range of 7 to 8, successfully completing the precipitation of cerium oxide nanoparticles. After precipitation, the mixture is poured into a polytetrafluoroethylene reaction vessel and subjected to a hydrothermal conversion process at 60°C. The experiment takes a total of 4 hours. After the experiment is completed, the solution is cooled to room temperature and centrifuged (8000 rpm), and the supernatant is discarded. The precipitate is then washed three times with deionized water to remove unreacted starting materials and residual impurities. The cleaned precipitate is then introduced into a vacuum dryer and dried at 60°C to obtain the cerium oxide nanoenzyme powder product.
[0098] (4) Preparation of hydrogel
[0099] Weigh 0.02g of agarose and mix it with PBS buffer. While operating a magnetic stirrer, heat and stir while placing the beaker in a water bath set to 80-90°C. Continue heating until the agarose is completely dissolved and becomes colorless, and the liquid becomes colorless and transparent. When the agarose solution cools to approximately 50°C, slowly inject 3,3',5,5'-tetramethylbenzidine solution (hereinafter referred to as TMB solution) and gently stir in a dark room until TMB is evenly distributed in the agarose solution. Then, slowly inject the TMB agarose solution, which has been stirred until uniform, into the side wall of the centrifuge tube. Once it cools to ambient temperature, the hydrogel will gradually harden and solidify. The gel solidification step is complete, and subsequent experimental steps can be carried out seamlessly.
[0100] This study constructed an integrated dual-mode sensor based on a multivalent aptamer probe and a cerium oxide nanozyme hydrogel, which achieved highly sensitive detection of Salmonella through a cascade signal amplification mechanism. When the target bacteria are present, the multivalent aptamer probe specifically captures Salmonella and releases cDNA, triggering a catalytic hairpin self-assembly (CHA) reaction, causing the hairpin (2H1-2H2) labeled with a fluorescent group to dissociate from the surface of the cerium oxide nanozyme. This process simultaneously activates dual signal outputs: on the one hand, the dissociated 2H1 escapes from the nanozyme quenching environment to produce a fluorescence recovery signal; on the other hand, the exposed nanozyme active site oxidizes the chromogenic substrate in the TMB hydrogel to produce a blue colorimetric response. The detection uses a SpectraMaxi3 microplate reader to synchronously read the fluorescence intensity and the 450nm absorbance value at 10 1 –10 7 It shows excellent linearity in the CFU / mL range. The technology has a specific recognition rate of >95% for 7 non-target bacteria. The nanoenzyme complex is stable at room temperature for more than 10 days, and the recovery rate in complex matrices such as milk and chicken is 86-112%. The entire process from recognition to signal output can be completed within 30 minutes.
[0101] Example 2: Verification of the bifunctionality of HCR multivalent aptamer probes:
[0102] The high affinity compared to monovalent aptamers was verified by ELISA. 50 μL of Salmonella solution was added to a high-affinity 96-well plate and incubated at 37°C for 2 hours. After washing, 1% bovine serum albumin (BSA, 150 μL) was added to each well and incubated at 37°C for 30 minutes to block any remaining exposed areas. Subsequently, 50 μL of HCR-based multivalent aptamer amplifier (50 nM) was added and incubated at 37°C for 30 minutes to label the target. After three washes, HRP-conjugated streptavidin (SA-HRP) (50 μL) was added to each well and incubated for 25 minutes at room temperature before washing and removal. Next, 50 μL of TMB was added for color development, followed by 50 μL of MH₂SO₄ for termination. Finally, absorbance intensity at 450 nm was monitored using a SpectraMax® i3 Multimode Microplate Reader. In addition, the prepared HCR multivalent aptamer probe was added to 10 5 CFU / mL of Salmonella, and PBS was used as a control. After reacting at 37°C for 1 hour, the ability of the HCR multivalent aptamer probe to capture Salmonella was verified by agarose gel electrophoresis.
[0103] Example 3: Establishment of aptamer sensor combining HCR multivalent aptamer capture probe and cerium oxide nanozyme complex:
[0104] First, a 2% 3-aminopropyltriethoxysilane (APTES) solution was used to treat the centrifuge tube and allowed to stand overnight to activate the surface. Then, primers were added to perform HCR reaction to synthesize multivalent aptamer probes. The HCR reaction product was then mixed with the nanozyme complex and added to a 1.5 mL centrifuge tube along with the TMB hydrogel. Subsequently, 10 5 The reaction was carried out for 30 minutes with a 500 mL Salmonella solution. After the reaction, the relative fluorescence intensity (excitation wavelength 492 nm, emission wavelength 518 nm) and absorbance were measured using a microplate reader. Each experiment was repeated three times.
[0105] Example 4: Optimization of experimental conditions
[0106] To achieve optimal performance in the established detection system, key parameters such as reaction time, pH, TMB concentration, and nanozyme concentration were meticulously calibrated and fine-tuned. To determine the optimal reaction time, other conditions in the detection system remained unchanged. The absorbance values at different time points were measured after controlling the reaction time to 5, 10, 15, 20, and 25 minutes, and the strength of the detection signal was compared to determine the optimal reaction time. Each experiment was repeated three times.
[0107] (1) pH optimization: Strive to adjust the pH of the experimental system, fix the other detection indicators, and carefully calibrate the pH value of the detection system, adjusting it to pH levels from 1 to 10 in sequence. Then, use the Elisa detection technology described in Example 2 to measure the absorbance of the detection system under various pH conditions and verify the signal intensity to strive to determine the most suitable pH value. The experiment needs to be repeated three times.
[0108] (2) Optimization of TMB concentration: To enhance the TMB concentration effect, we conducted TMB concentration gradient experiments at 0.5, 1, 2, 5, and 10 mmol / L to maintain uniformity of detection parameters. We performed the ELISA assay steps described in Example 2 to complete absorbance measurement and study the effect of different TMB concentrations on the detection signal, aiming to identify the most appropriate TMB concentration. The experiment was repeated three times.
[0109] (3) Optimization of nanozyme concentration: To determine the optimal nanozyme concentration, the mass concentration of the nanozyme was set to 100 μg / mL, 150 μg / mL, 200 μg / mL, 250 μg / mL, and 300 μg / mL, respectively. Other detection conditions remained unchanged. The fluorescence intensity was measured according to the ELISA detection method in Example 2. The effect of different nanozyme concentrations on the signal was compared to determine the optimal nanozyme concentration. Each experiment was repeated three times.
[0110] (4) Optimization of probe concentration: To optimize the probe concentration, the probe concentration was set to 0.1 mM, 0.25 mM, 0.5 mM, and 1 mM, respectively. Other detection conditions remained unchanged. The fluorescence intensity was measured according to the ELISA detection method in Example 2. The detection signal intensity at different probe concentrations was compared to determine the optimal probe concentration. Each experiment was repeated three times.
[0111] (5) Optimization of the H1 / H2 concentration ratio: To optimize the H1 / H2 concentration ratio, the H1 / H2 concentration ratio was set to 1:1, 1.2:1, 1.5:1, and 1.8:1, respectively. Other detection conditions remained unchanged. Fluorescence intensity was measured using the ELISA assay described in Example 2. The detection signal intensities at different concentration ratios were compared to determine the optimal concentration ratio. Each experiment was repeated three times.
[0112] Example 5: Detection system sensitivity evaluation
[0113] Under the optimal experimental conditions, the aptamer sensor detection method of HCR multivalent aptamer capture probe combined with cerium oxide nanozyme complex in Example 2 was used to detect 10 0 CFU / mL, 10 1 CFU / mL, 10 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL and 10 7 The assay was performed using a PCR reaction with 1000 CFU / mL of Salmonella. A blank control containing sterile PBS as the target bacteria was also added. After the reaction, relative fluorescence intensity and colorimetric signal were measured using a microplate reader. The logarithm of the Salmonella concentration was plotted on the horizontal axis, while the measured fluorescence intensity or absorbance was plotted on the vertical axis. Within the range of a good linear relationship, a fitting analysis was performed to calculate the linear regression equation and detection limit. Each experiment was repeated three times.
[0114] Example 6: Study on the specificity of the detection system
[0115] In order to evaluate the specificity of the detection system, 10 5 Staphylococcus aureus, Vibrio parahaemolyticus, Listeria monocytogenes, Vibrio algae, Vibrio vulnificus, and Escherichia coli O157:H7, along with a mixture of these seven bacteria (1:1:1:1:1:1:1:1), were introduced into the assay system for comparison with Salmonella. A blank control containing sterile PBS as the target bacteria was also added. After the reaction, relative fluorescence intensity and absorbance were measured using a microplate reader. Each experiment was repeated three times.
[0116] Example 7: Actual sample detection
[0117] In order to evaluate the feasibility and practicality of the detection system in actual sample detection. Milk, chicken legs and eggs purchased from the local market were selected. The sample preparation method is as follows: the milk is centrifuged at 6000rpm for 10 minutes to remove some impurities, and the supernatant layer is collected and added to the target bacteria; the chicken (25g) is added to 225mL of PBS and homogenized under sterile conditions for about 2 minutes, and then the fine meat is centrifuged at 2000rpm for 10 minutes, and the supernatant is removed as the food matrix; the egg is broken and the egg liquid is taken, filtered with sterile gauze to remove impurities, and then centrifuged at 5000rpm for 10 minutes, and the supernatant is collected as the detection matrix. Subsequently, according to the experimental needs, known concentrations of Salmonella typhimurium are added to milk, chicken legs and egg samples respectively to prepare contaminated samples with different target bacteria concentrations (10 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL and 10 7 CFU / mL). At the same time, a blank control group of the corresponding matrix was added to each sample, and all experiments were repeated 3 times. Then, according to the 3.3.5 Elisa detection method, the absorbance of the target bacteria contaminated sample was measured, with the logarithm of the target bacteria concentration as the horizontal axis and the detected fluorescence intensity and absorbance as the vertical axis. Fitting analysis was performed within the range of good linear relationship to calculate the linear regression equation and detection limit. Finally, a concentration of 10 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL and 10 7 The linear regression equation and detection limit were calculated for the CFU / mL of milk and chicken samples contaminated with the target bacteria. Each experiment was repeated three times.
[0118] Results and Analysis:
[0119] Detection System Principle: Fluorescence / colorimetric detection of aptamers and ceria nanozymes. The HCR scaffold is constructed by preparing HCR hairpins (H1 and H2), each with an overhang to hybridize the cDNA and aptamer duplex. In the presence of an activation strand, the HCR forms a multivalent aptamer probe. In the presence of Salmonella, the multivalent aptamer probe specifically recognizes Salmonella and releases the cDNA, which triggers catalytic hairpin self-assembly. In the presence of cDNA, the fluorescent-grouped hairpins H1 and H2 on the CeO2 nanozyme hydrogel react with the cDNA via a CHA reaction, releasing the 2H1 and 2H2 hairpins. The fluorescent group on H1 separates from the nanozyme, generating a corresponding fluorescent signal. Simultaneously, the release of the active site on the CeO2 nanozyme generates a colorimetric signal upon addition of TMB. Therefore, our designed platform enables simultaneous fluorescence / colorimetric detection of Salmonella. The multivalent aptamer probe exhibits high binding affinity to the target bacteria and achieves signal amplification and readout through the CHA reaction and the oxidase-like activity of the CeO2 nanozyme hydrogel. Figure 1 .
[0120] Construction and characterization of HCR multivalent aptamer probes (HCR-multiApt-cDNA)
[0121] The design and preparation of HCR multivalent aptamer probes are the main contents of the aptamer sensor of HCR multivalent aptamer capture probe combined with ceria nanozyme complex, and its construction process was characterized by agarose gel electrophoresis. Figure 2 As shown, low-molecular-weight bands appeared in lanes 1-4, indicating that the trigger strand, H1, H2, and the mixture of H1 and H2 maintained a stable structure before the reaction. After the addition of the trigger strand, multiple slow-migrating, high-molecular-weight products appeared (lane 5), indicating the formation of a larger HCR product. When the aptamer (lane 7) and cDNA (lane 8) were introduced into the HCR product, bright bands were observed at the sample inlet without any migration. The absence of bands at the aptamer and cDNA indicated that the aptamer and cDNA assembled on the HCR scaffold to form a larger complex. Meanwhile, virtually no aptamer and cDNA bands remained, indicating that the aptamer and cDNA assembled on the HCR product.
[0122] The HCR multivalent aptamer probe performs well because its multivalent property significantly improves the binding strength with Salmonella. This study focuses on testing the effectiveness of the prepared HCR multivalent aptamer probe in improving affinity. In this experiment, the HCR multivalent aptamer probe and the monovalent aptamer were labeled with horseradish peroxidase and Salmonella was detected using standardized ELISA technology. Figure 3 As shown in 10 7At a concentration of 100 CFU / mL of Salmonella, the signal intensity triggered by the monovalent aptamer was significantly lower than that triggered by the HCR multivalent aptamer probe. This phenomenon reveals that the affinity of the HCR multivalent aptamer probe significantly exceeds that of the monovalent aptamer. The Salmonella capture ability of the HCR multivalent aptamer probe was verified by agarose gel electrophoresis technology. Figure 4 As shown in the figure, in the absence of Salmonella, several high-molecular-weight molecules with slow migration were identified. However, in the presence of Salmonella, significant streaks were observed at the sample entrance, and no migration was observed in the lane 2 region. This finding fully demonstrates the excellent recognition and targeting capabilities of the HCR multivalent aptamer probe for Salmonella detection.
[0123] Construction and characterization of ceria nanozyme complexes:
[0124] Transmission electron microscopy (TEM) was used to study the morphology and particle structure of CeO2 nanozyme (NZ). Figure 5 As shown in Figure 2, CeO2 nanozymes are spherical in structure with an average diameter of about 200 nm. In addition, the catalytic kinetics of CeO2 nanozymes were further studied. Under different concentrations of TMB, the reaction rate V was measured and the relationship between the rate and substrate concentration was plotted. Figure 6 As shown in the figure, with the increase of TMB concentration, the reaction rate V gradually increases and tends to be stable when the TMB concentration reaches above 10mM. This shows that the catalytic reaction of CeO2 nanozyme to TMB follows the Michaelis-Menten kinetic law. In order to further determine the kinetic parameters of CeO2 nanozyme, the reaction system was analyzed by Lineweaver-Burk double reciprocal curve, and the relationship between 1 / V and 1 / S (the reciprocal of the substrate concentration) was plotted. Figure 7 As shown, there is a good linear relationship, indicating that the oxidase activity of CeO2 nanozyme conforms to the Michaelis-Menten kinetic model. The regression equation obtained from the figure shows that CeO2 nanozyme has a high affinity for TMB and a high catalytic efficiency. In order to study its enzyme mimicking activity, the absorbance changes and fluorescence intensity changes of TMB were observed in the presence or absence of CeO2 nanozyme. Figure 8 and Figure 9As shown in the figure, when cDNA was introduced into the CeO2 complex (CeO2-H1-H2) and TMB, no significant changes in absorbance and fluorescence intensity were observed. This is because in the absence of Salmonella, the catalytic sites on the CeO2 complex were occupied by hairpins 2H1 and 2H2, resulting in almost no oxidation reaction of the TMB molecule, and thus no significant color change and fluorescence intensity change. However, in the presence of Salmonella, the cDNA fell off to undergo a CHA reaction, and 2H1 and 2H2 fell off the surface of the nanozyme, resulting in strong fluorescence. The addition of TMB triggered the TMB oxidation reaction, resulting in a color change. Figure 10 As shown in the figure, when cDNA, cDNA+H2 and CeO2 are mixed, the absorbance at 450nm is low, which means that the adsorption of DNA inhibits the peroxidase-like activity of CeO2. When cDNA is mixed with 2H1 and CeO2, the absorbance increases, which may be due to the formation of cDNA-2H1 chains, which partially exposes the active sites of CeO2. When cDNA is added to the CeO2-2H1-2H2 mixture, the colorimetric signal increases. It is speculated that this may be due to the formation of cDNA-2H1 and 2H1-2H2 double chains, which desorbs them from the nanozyme surface and exposes the active sites of CeO2. The CHA reaction on the nanozyme surface can simultaneously generate fluorescence and colorimetric signals.
[0125] Optimization of experimental conditions: In order to achieve the best performance of the established detection system, the reaction time, pH, TMB concentration, nanozyme concentration, HCR multivalent aptamer probe concentration, and the ratio of H1 and H2 were optimized.
[0126] First, the reaction time has a significant effect on the absorbance of the detection system, such as Figure 11 As shown in the figure, the signal gradually increased as the reaction time increased from 5 minutes to 25 minutes, and stabilized after 20 minutes, so 20 minutes was selected as the optimal reaction time. In the pH optimization, considering the significant effect of pH on enzyme activity and reaction stability, the changes in absorbance values within different pH ranges were tested. The absorbance value reached a maximum at pH 6, indicating that the CeO2 nanozyme complex had the best catalytic activity under weakly acidic conditions. Subsequently, for the optimization of TMB concentration, the changes in absorbance values within the range of 0.5mM to 10mM were tested. Figure 12 As shown in the figure, as the TMB concentration increases, the absorbance value gradually increases and tends to saturate at 5mM, which indicates that the high TMB concentration is no longer a limiting factor for the reaction. Therefore, 5mM is selected as the optimal TMB concentration. As for the concentration of nanozyme, by studying the effect of different concentrations from 100μg / mL to 300μg / mL on the fluorescence intensity, it was found that the fluorescence signal is close to the plateau at 200μg / mL. Further increasing the concentration has limited effect on the signal enhancement. Therefore, 200μg / mL is selected as the optimal concentration. The optimization of the probe concentration is shown in the figure. Figure 13 The results showed that as the probe concentration increased from 0.1mM to 1mM, the fluorescence signal gradually increased and reached a stable state at 0.5mM, indicating that this concentration was sufficient to meet the requirements of the detection system. Therefore, 0.5mM was selected as the optimal probe concentration. Finally, to ensure that the ratio of H1 to H2 could maximize the detection signal, the effect of different H1 to H2 concentration ratios on the fluorescence intensity was studied. The results showed that when the ratio of H1 to H2 was 1.5:1, the fluorescence signal was the strongest and most stable, indicating that a slightly higher H1 concentration can better promote the connection and signal transmission of the system. Therefore, 1.5:1 was selected as the optimal ratio.
[0127] Under the optimal detection conditions, in order to evaluate the linear range and sensitivity of the detection system, 10 1 to 10 7 CFU / mL gradient dilution of Salmonella, and PBS was used as blank control group. Figure 14 As shown, when the concentration of Salmonella increased from 10 1 to 10 7 When CFU / mL increases, the absorbance intensity gradually increases. The data are fitted and the corresponding regression equation is y=0.0721x+0.0928 (R 2 =0.9797), where x is the logarithm of the Salmonella concentration and y is the absorbance intensity. The lower limit of detection (LOD, defined as the Salmonella concentration calculated using the formula D=3N / S, where N is the standard deviation of the blank value and S is the slope of the standard curve) of the detection system was calculated to be 8 CFU / mL. Similarly, we found an enhancement effect in the fluorescence output similar to that of the colorimetric method. The enhanced fluorescence intensity is proportional to the logarithm of the Salmonella concentration. When the Salmonella concentration is 10 1 to 10 7 When CFU / mL increases, the fluorescence intensity gradually increases, and the corresponding regression equation is y=410879x+144136 (R 2 =0.994). The lower detection limit of the detection system was calculated to be 8 CFU / mL, demonstrating the potential of our proposed method for ultrasensitive analysis of foodborne pathogens. Furthermore, fluorescence detection demonstrated higher sensitivity than colorimetric methods, consistent with previous reports. Therefore, it is confident that the colorimetric / fluorescence dual-mode method based on the HCR multivalent aptamer probe and nanozyme complex has relatively high sensitivity for the detection of Salmonella.
[0128] Compared with other colorimetric and fluorescence detection methods shown in Table 3, this dual-signal detection method has comparable linear range and detection limit, or even better, due to the affinity of the multivalent aptamer probes.
[0129] Table 3 Comparison of currently reported dual-signal biosensors for Salmonella detection
[0130]
[0131] Specificity of the detection system: To verify the specificity of the proposed detection system, we also used this method to detect some non-target pathogens including Escherichia coli, Vibrio parahaemolyticus, Listeria monocytogenes, Vibrio alginolyticus and Vibrio vulnificus under the same monitoring conditions. Figure 15 and 16 As shown, the presence of target Salmonella or a mixed sample of Salmonella and seven bacteria at a ratio of 1:1:1:1:1:1:1 resulted in very high absorbance and fluorescence, while the signal in samples containing non-target bacteria was significantly lower, similar to that of the blank sample. Therefore, these results demonstrate that our proposed detection system has excellent specificity for Salmonella.
[0132] Stability evaluation of the detection system: The stability of the dual-mode detection system is crucial for its successful use and storage. Therefore, the dual-signal detection stability of the nanozyme complex at different storage times (0, 2, 4, 6, 8 and 10 days) was evaluated. Figure 17 and 18 As shown in the figure, as the storage time changes, the colorimetric and fluorescence signals are calculated to be P>0.05 after significance calculation, proving that the dual signal data at different times are consistent and there is no significant difference, indicating that the dual-mode detection method of Salmonella has good stability.
[0133] Detection of real samples by the detection system: The practicality of the proposed colorimetric and fluorescence dual-mode detection method was evaluated by analyzing milk, egg and chicken samples spiked with Salmonella. First, a series of known concentrations of Salmonella were prepared and contaminated with food samples. Figure 19 and Figure 20 As shown, the concentration of Salmonella in all adulterated food samples (10 1 to 10 7The absorbance and fluorescence intensity signals (CFU / mL) increased linearly, with correlation indices of the standard curves exceeding 0.95. These results demonstrate the excellent stability of our proposed method and its significant potential for application in various food samples. Furthermore, to further evaluate the application value of this method, recovery experiments were conducted using the standard curves for samples spiked with Salmonella at varying concentrations in milk, eggs, and chicken, with three replicates per group. The recoveries of Salmonella in samples with varying concentrations ranged from 112% to 86%, with an average spike recovery of 100.4%. The acceptable results for the determination of Salmonella concentrations in complex food matrices demonstrate the robustness and stability of this method for identifying Salmonella in food samples.
Claims
1. A method for preparing a multivalent aptamer probe for capturing Salmonella, characterized in that: The steps include: S01, extracting DNA sample H1, DNA sample H2, activation strand, aptamer and cDNA dry powder, adding phosphate buffered saline solution to dissolve, mixing and centrifuging to obtain a mixture; S02, adding phosphate buffered saline solution to the mixture to dissolve and dilute it to obtain a 100 μmol / L aptamer stock solution; S03, extracting DNA sample H1, DNA sample H2 and aptamer stock solution, heating them, and then cooling them for 10 minutes to obtain a DNA secondary structure sample; S04, mixing the activated chain, DNA sample H1, and DNA sample H2, and placing them on a constant temperature shaker for overnight incubation to obtain an HCR reaction product; S05, the HCR reaction product is mixed with the aptamer and cDNA, and the mixture is shaken to synthesize a multivalent aptamer probe; Wherein: the sequence of DNA sample H1 is SEQ ID NO: 1; the sequence of DNA sample H2 is SEQ ID NO: 2; the sequence of activation chain is SEQ ID NO: 3; the sequence of aptamer is SEQ ID NO: 4; the sequence of cDNA is SEQ ID NO: 5; In step S01 , the volume ratio of DNA sample H1, DNA sample H2, activation strand, adaptor, and cDNA dry powder is 1.5:1:1:1:
1.
2. The preparation method according to claim 1, characterized in that In step S01 , the concentration of the phosphate buffered saline solution is 100 μmol / L.
3. A method for detecting Salmonella using a multivalent aptamer probe combined with a cerium oxide nanozyme hydrogel complex, characterized in that: The method is not for the purpose of disease diagnosis and includes the following steps: (1) After homogenizing the sample to be tested, filtering and centrifuging to obtain the detection matrix; (2) The multivalent aptamer probe described in claim 1 and the cerium oxide nanozyme hydrogel complex are mixed and placed in a centrifuge tube, wherein the concentration of the multivalent aptamer probe is 0.1 mM to 1 mM; the concentration of the cerium oxide nanozyme is 100 μg / mL to 300 μg / mL, the concentration of the hydrogel is 0.5 to 10 mmol / L, and the mass ratio of the cerium oxide nanozyme to the hydrogel is 1:9; (3) Add the detection matrix to the centrifuge tube and react for 25-35 minutes; (4) Measure the relative fluorescence intensity and absorbance using a microplate reader to achieve simultaneous fluorescence and colorimetric detection of Salmonella in the sample to be tested; In step (2), the preparation method of the cerium oxide nanozyme hydrogel complex is: Measure cerium nitrate and sodium hydroxide, mix them, and adjust the pH to 7-8 to obtain a mixed solution containing cerium oxide nanoparticle precipitation; The mixed solution was subjected to hydrothermal conversion at 60°C. After the reaction was completed, the mixed solution was cooled to room temperature and centrifuged to obtain cerium oxide nanozyme. Mix agarose with PBS buffer, heat in a water bath at 80-90°C, and stir until the agarose is completely dissolved to obtain an agarose solution. The agarose solution was cooled to 45-55°C, TMB solution was added, and the solution was stirred in the dark until dissolved to obtain TMB agarose solution; The TMB agarose solution and the ceria nanozyme were mixed to obtain a ceria nanozyme hydrogel mixture; DNA sample 2H1 and DNA sample 2H2 were added to the cerium oxide nanozyme hydrogel mixture, and the cerium oxide nanozyme hydrogel complex was obtained after mixing, wherein the sequence of DNA sample 2H1 was SEQ ID NO: 6, and the sequence of DNA sample 2H2 was SEQ ID NO:
7.
4. The method according to claim 3, wherein in step (4), the excitation wavelength is 492 nm and the emission wavelength is 518 nm.
Citation Information
Patent Citations
Preparation method and application of multivalent aptamer for detecting salmonella based on HCR
CN116087508A
Double-probe detection reagent for detecting salmonella typhimurium and preparation method thereof
CN120121832A
Colorimetric-fluorescence dual-signal salmonella detection method based on Ag-MoS2 nano-enzyme
CN120427903A