A gene combination, recombinant expression vector, its construction method, and its application for increasing the stachyose content of potatoes.

By specifically overexpressing the GalE, GS, and STS genes in potato tubers and using the recombinant expression vector pNK2-GalE-STS-GS, the problem of low stachyose content in potato tubers was solved, achieving a 16-fold increase in stachyose content, thereby improving production efficiency and reducing costs.

CN120505336BActive Publication Date: 2025-10-31WUHAN BIORUN BIO TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511004320.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-21
Publication Date
2025-10-31
Estimated Expiration
2045-07-21

AI Technical Summary

Technical Problem

The low stachyose content in potato tubers in existing technologies affects the industrial production efficiency and cost of stachyose.

Method used

By specifically overexpressing the three genes GalE, GS, and STS in potato tubers, and using the recombinant expression vector pNK2-GalE-STS-GS, the efficiency of the stachyose synthesis pathway was improved.

Benefits of technology

It increased the stachyose content in potato tubers by up to 16 times, improving stachyose production efficiency and reducing production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505336B_ABST
    Figure CN120505336B_ABST
Patent Text Reader

Abstract

This invention discloses a gene combination, recombinant expression vector, construction method, and application for increasing the stachyose content of potatoes, belonging to the field of biotechnology. The gene combination includes the GalE gene, the GS gene, and the STS gene. Furthermore, this invention proposes a recombinant expression vector comprising the above gene combination. Additionally, this invention proposes a method for constructing the above recombinant expression vector, comprising: digesting the backbone vector with Eco31I enzyme, and ligating the target gene and regulatory element into the vector to form the recombinant expression vector pNK2-GalE-STS-GS. Furthermore, this invention proposes the application of the above gene combination, or the above recombinant expression vector, in increasing the stachyose content in potato tubers. The three genes GalE, GS, and STS proposed in this invention are specifically expressed in potato tubers, increasing the stachyose content in potato tubers by up to 16 times.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a gene combination, recombinant expression vector, construction method, and application for increasing the stachyose content of potatoes. Background Technology

[0002] Stachyose is a naturally occurring tetrasaccharide found in plants. Due to its stable physicochemical properties and good physiological activity, it is widely used in the food, health product, and biopharmaceutical industries. Stachyose is widely found in legumes and Lamiaceae plants, such as *Stachys edulis*, *Rehmannia glutinosa*, and soybeans. Currently, the main method for industrial production of stachyose is extraction from plants such as *Stachys edulis*, but the naturally occurring stachyose content in plants is low, significantly affecting stachyose yield.

[0003] Potatoes are annual plants belonging to the Solanaceae family, widely cultivated for their starchy, edible tubers. Potato tubers are easily digestible and contain various nutrients such as vitamin C, vitamin B1, vitamin B3, and protein, making them one of the world's major food crops. The main sugar in potato tubers is starch, but the content of stachyose is relatively low. Increasing the stachyose content in potato tubers and using high-stachyose-content potato tubers as raw materials for stachyose production could boost the stachyose industry. Therefore, a method to increase the stachyose content in potato tubers is urgently needed.

[0004] With the rapid development of biotechnology, it has become a reality to synthesize natural products in plants using synthetic biology techniques. This technology has promoted the advancement of related technologies, improved production efficiency, and reduced costs.

[0005] However, how to increase the stachyose content in potato tubers remains a technical problem that needs to be solved with existing technologies. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned technical deficiencies and provide a gene combination, recombinant expression vector, construction method and application for increasing the stachyose content of potatoes, thereby solving the technical problem of how to increase the stachyose content in potato tubers in the prior art.

[0007] This invention provides a method for increasing the stachyose content in potato tubers by specifically overexpressing three genes, GalE, GS, and STS, through modification of the potato stachyose synthesis pathway.

[0008] To achieve the above-mentioned technical objectives, the present invention provides a gene combination for increasing the stachyose content of potatoes, including the GalE gene, the GS gene, and the STS gene.

[0009] In any embodiment, the GalE gene is derived from the Escherichia coli UDP-glucose 4-epimerase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number WP_074488048.1; the GS gene is derived from the Arabidopsis thaliana inositol galactosidase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number NP_172406.1; the STS gene is derived from the Arabidopsis thaliana stachyose synthase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number NP_192106.3.

[0010] In addition, the present invention also proposes a recombinant expression vector comprising the above-mentioned gene combination.

[0011] In any implementation, the promoters and terminators regulating the expression of the GalE, GS, and STS genes are respectively:

[0012] The promoter of the GalE gene is MCPI, and the terminator is hsp;

[0013] The promoter of the STS gene is GBSS, and the terminator is rbcS-E9;

[0014] The promoter of the GS gene is class I patatin, and the terminator is NOS.

[0015] In any embodiment, the GalE, GS, and STS genes are inserted into a backbone vector and ligated using the restriction endonuclease Eco31I and 2×Seamless Cloning Mix recombinase.

[0016] In any embodiment, the skeleton carrier is carrier pNK2.

[0017] Furthermore, this invention also proposes a method for constructing the above-mentioned recombinant expression vector, comprising the following steps:

[0018] S1. Amplify GalE, GS, STS genes, MCPI, GBSS, classI patatin promoters and hsp, rbcS-E9, NOS terminators using KOD One™ PCR Master Mix;

[0019] S2. The backbone vector is digested with Eco31I enzyme, and the target gene and regulatory elements are ligated into the vector to form the recombinant expression vector pNK2-GalE-STS-GS.

[0020] Furthermore, this invention also proposes the application of the above-mentioned gene combination or the above-mentioned recombinant expression vector in increasing the stachyose content in potato tubers.

[0021] In any embodiment, the recombinant expression vector is transferred into Agrobacterium GV3101 competent cells, followed by infection of potato explants.

[0022] Compared with the prior art, the beneficial effects of the present invention include: the three genes GalE, GS and STS proposed in the present invention are specifically expressed in potato tubers, which increases the stachyose content in potato tubers by up to 16 times. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the pNK2-GalE-STS-GS carrier structure constructed in Embodiment 1 of the present invention.

[0024] Figure 2 This is a graph showing the detection results of stachyose content in potato tubers from the GalE-STS-GS overexpression lines of Example 3 of this invention. Detailed Implementation

[0025] The "range" disclosed in this application is defined by a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, which define the boundaries of a particular range. Ranges defined in this way can include or exclude endpoints and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60~120 and 80~110 are listed for a specific parameter, it is also expected that ranges of 60~110 and 80~120 are also included. Furthermore, if minimum range values ​​of 1 and 2 are listed, and if maximum range values ​​of 3, 4, and 5 are listed, then the following ranges are all expected: 1~3, 1~4, 1~5, 2~3, 2~4, and 2~5. In this application, unless otherwise stated, the numerical range "a~b" represents a shortened representation of any combination of real numbers between a and b, where a and b are real numbers. For example, the numerical range "0~5" indicates that all real numbers between "0~5" have been listed in this article; "0~5" is simply a shortened representation of these numerical combinations. Furthermore, when a parameter is stated as an integer ≥2, it is equivalent to disclosing that the parameter is, for example, an integer such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0026] Unless otherwise specified, the terms "comprising" and "including" as used in this application can be open-ended or closed-ended. For example, "comprising" and "including" can mean that other components not listed may also be included, or that only the listed components may be included.

[0027] Unless otherwise specified, the term "or" is inclusive in this application. For example, the phrase "A or B" means "A, B, or both A and B". More specifically, the condition "A or B" is satisfied by any of the following conditions: A is true (or exists) and B is false (or does not exist); A is false (or does not exist) and B is true (or exists); or both A and B are true (or exist).

[0028] This specific embodiment provides a gene combination for increasing the stachyose content of potatoes, including the GalE gene, the GS gene, and the STS gene.

[0029] In some embodiments, the GalE gene is derived from the Escherichia coli UDP-glucose 4-epimerase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number WP_074488048.1; the GS gene is derived from the Arabidopsis thaliana inositol galactosidase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number NP_172406.1; the STS gene is derived from the Arabidopsis thaliana stachyose synthase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number NP_192106.3.

[0030] This specific embodiment also proposes a recombinant expression vector, including the above-mentioned gene combination.

[0031] In some embodiments, the promoters and terminators regulating the expression of the GalE, GS, and STS genes are respectively:

[0032] The promoter of the GalE gene is MCPI, and the terminator is hsp;

[0033] The promoter of the STS gene is GBSS, and the terminator is rbcS-E9;

[0034] The promoter of the GS gene is class I patatin, and the terminator is NOS.

[0035] In some embodiments, the GalE, GS, and STS genes are inserted into a backbone vector and ligated using the restriction endonuclease Eco31I and 2×Seamless Cloning Mix recombinase.

[0036] In some embodiments, the skeleton carrier is carrier pNK2.

[0037] This specific embodiment also proposes a method for constructing the above-mentioned recombinant expression vector, including the following steps:

[0038] S1. Amplify GalE, GS, STS genes, MCPI, GBSS, classI patatin promoters and hsp, rbcS-E9, NOS terminators using KOD One™ PCR Master Mix;

[0039] S2. The backbone vector was digested with Eco31I, and the target gene and regulatory elements were ligated into the vector using seamless cloning technology to form the recombinant expression vector pNK2-GalE-STS-GS.

[0040] This specific embodiment also proposes the application of the above-mentioned gene combination, or the above-mentioned recombinant expression vector, in increasing the stachyose content in potato tubers.

[0041] In some embodiments, the recombinant expression vector is transferred into Agrobacterium GV3101 competent cells, followed by infection of potato explants.

[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0043] In this invention, the terms "some embodiments," "this embodiment," and examples are used to describe a subset of all possible embodiments. However, it is understood that "some embodiments" can be the same subset or different subsets of all possible embodiments and can be combined with each other without conflict.

[0044] If the application documents contain similar descriptions such as "first / second", the following explanation shall be added: In the following description, the terms "first / second / third" are used only to distinguish similar objects and do not represent a specific ordering of objects. It is understood that "first / second / third" may be interchanged in a specific order or sequence where permitted, so that the embodiments described herein can be implemented in an order other than that illustrated or described herein.

[0045] In this embodiment, the term "and / or" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, object A and / or object B can represent three situations: object A exists alone, object A and object B exist simultaneously, and object B exists alone.

[0046] The following describes embodiments of this application. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.

[0047] Example 1: Construction of Recombinant Expression Vector

[0048] 1. Gene cloning

[0049] (1) UDP-glucose 4-episomerase: derived from Escherichia coli, UniProt database number WP_074488048.1, and GalE is used in this example for ease of description.

[0050] (2) Inositol galactosidase: derived from Arabidopsis thaliana, UniProt database number NP_172406.1, and GS is used in this example for ease of description.

[0051] (3) Stachyose synthase: derived from Arabidopsis thaliana, UniProt database number NP_192106.3, and STS is used in this embodiment for ease of description.

[0052] The above genes were cloned and amplified using KOD One™ PCR Master Mix. For relevant operating procedures, please refer to the corresponding instruction manual.

[0053] 2. Promoter and terminator cloning

[0054] Promoters: MCPI, GBSS, class I patatin

[0055] Terminator: hsp, rbcS-E9, NOS

[0056] GalE gene expression uses the MCPI promoter and hsp terminator, STS uses the GBSS promoter and rbcS-E9 terminator, and GS gene expression uses the class I patatin promoter and NOS terminator.

[0057] The promoters and terminators mentioned above were all amplified using plasmids preserved in the laboratory as templates and KOD One™ PCRMaster Mix. For relevant operating procedures, please refer to the corresponding instruction manual.

[0058] 3. Enzyme digestion, ligation, and transformation

[0059] (1) The backbone vector pNK2 was digested with restriction endonuclease Eco31I, and the target gene fragment and linearized pNK2 were ligated with 2×Seamless CloningMix recombinase.

[0060] (2) Take 10 μl of the ligation product and transform it into competent Escherichia coli DH5a cells using the 42℃ heat shock method. Specifically: take 100 μL of competent Escherichia coli DH5a cells, add 10 μL of the ligation product, and place on ice for 30 min; incubate at 42℃ for 90 s, then place on ice for 2 min; add to 500 μL of LB broth without antibiotics, and incubate at 37℃ and 220 r / min for 1 h; then spread the bacterial culture on LB solid medium containing kanamycin resistance and incubate overnight.

[0061] 4. Validation of the recombinant vector

[0062] Eight single clones were selected for colony PCR validation. Two positive clones were chosen, and plasmids were extracted using the Axygen plasmid DNA mini-extraction kit and sequenced. The sequencing results were analyzed using Snapgene software, confirming the successful construction of the recombinant vector (i.e., recombinant expression vector), which was named pNK2-GalE-STS-GS. The vector structure diagram is shown below. Figure 1

[0063] Example 2 Genetic transformation of potatoes

[0064] 1. Preparation of Agrobacterium

[0065] Add 1 µL of plasmid to 50 µL of GV3101 Agrobacterium competent cells, mix thoroughly, and transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and transfer to a 1.5 mL centrifuge tube. Incubate at 30°C and 180 rpm for 30 min on a shaker. Inoculate 50 µL of the activated Agrobacterium culture onto LB solid medium containing the recombinant vector from Example 1 and incubate in the dark at 30°C for 48 h. Pick Agrobacterium single clones, synthesize the detection primers SEQ ID NO.1 and SEQ ID NO.2, and perform PCR amplification. Verify whether the recombinant expression vector has been transformed into competent cells by agarose gel electrophoresis. SEQ ID NO.1: Forward primer sequence for Agrobacterium detection is GATGGATTGCACGCAGGTTC; SEQ ID NO.2: Reverse primer sequence for Agrobacterium detection is TAAAGCACGAGGAAGCGGTC.

[0066] 2. Genetic transformation of potatoes

[0067] (1) Explant preparation

[0068] Select test-tube seedlings that have grown for 3-4 weeks, and use a scalpel to cut stem segments of 0.2-0.5 cm as explant material. Inoculate these segments into pre-culture medium and incubate in the dark at 23°C for 2-3 days.

[0069] (2) Agrobacterium infection and co-culture

[0070] Agrobacterium was picked and placed in the infection solution to prepare an Agrobacterium resuspension with an OD600 of 0.2-0.5. The explants were then inoculated into the Agrobacterium suspension for 10 min. The infected explants were then inoculated onto sterile filter paper and air-dried before being inoculated onto co-culture medium and incubated in the dark at 23°C for 48-72 h.

[0071] (3) Screening

[0072] The co-cultured explants were inoculated onto selection medium and cultured at 25°C under 16 / 8h light for 14 days.

[0073] (4) Screening / Differentiation

[0074] Explants were inoculated onto selection / differentiation medium, 30 explants per dish, and cultured at 25°C under 16 / 8h light. The medium was changed every 20 days.

[0075] (5) Rooting culture

[0076] The differentiated buds were inoculated into rooting medium and cultured at 25°C under 16 / 8h light until roots were formed.

[0077] (6) Detection

[0078] Genomic DNA from potatoes was extracted using the CTAB method and then detected by PCR using primers SEQ ID NO.1 and SEQ ID NO.2.

[0079] (7) Planting

[0080] Positive potato seedlings were planted in nutrient soil and cultured at 22°C under 16 / 8h light until the tubers were harvested.

[0081] Example 3: Detection of Stachyose Content in Potato Tubers

[0082] The potato tubers obtained from the sampling example 2 were placed in 2 mL EP tubes and frozen in liquid nitrogen for at least 15 min; the 96-well plate of the grinder was pre-frozen in liquid nitrogen, two steel balls were added, and the sample was ground at 60 Hz for 2 min.

[0083] Take 0.1 g of ground potato sample, add 1000 μL of extraction buffer (methanol:acetonitrile:water, volume ratio 2:2:1, containing 0.5 μg / mL 2-chlorophenylalanine internal standard), vortex for 30 s, sonicate for 30 min, and let stand at -20℃ for 30 min; centrifuge at 12000 rpm for 15 min at 4℃, filter through a 0.22 μm filter membrane, collect the supernatant in a sample vial, and freeze at -80℃ until detection. The detection method is HPLC-MS, chromatographic column: Waters BEH Amide (1.7 μm, 2.1 × 100 mm). Mass spectrometry is OrbitrapExploris 120, acquisition mode ddms2, m / z scan range 85-1250. Stachyose in the test sample is identified by the retention time and mass spectrum of stachyose standard, and data analysis and quantification are performed using Xcalibur software.

[0084] Quantitative analysis results as follows Figure 2As shown in the figure. The results indicated that, compared to the control group (0.041 mg / kg), the stachyose content in potato tubers of the overexpression lines was significantly increased. Among them, the stachyose content in potato tubers of line #27 was the largest increase, reaching 0.67 mg / kg, a maximum increase of 16 times. In addition, the stachyose content in tubers of lines #24, #37, #42, and #45 was also increased, with contents of 0.432 mg / kg, 0.336 mg / kg, 0.222 mg / kg, and 0.443 mg / kg, respectively. It should be noted that the control group was wild-type potato, while lines #24, #27, #37, #42, and #45 were positive seedlings.

[0085] The technical solution provided by this invention can increase the stachyose content of tubers without affecting their normal growth and development.

[0086] The specific embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any other corresponding changes and modifications made in accordance with the technical concept of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of a recombinant expression vector in increasing the stachyose content in potato tubers, characterized in that, Including the GalE gene, GS gene, and STS gene; The GalE gene is derived from the *E. coli* UDP-glucose 4-epimerase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number WP_074488048.1; the GS gene is derived from the *Arabidopsis thaliana* inositol galactosidase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number NP_172406.1; the STS gene is derived from the *Arabidopsis thaliana* stachyose synthase gene, and its nucleotide sequence is as shown in the coding sequence corresponding to UniProt database number NP_192106.3; this gene combination is used for specific expression in potato tubers; The recombinant expression vector includes a combination of the GalE gene, the GS gene, and the STS gene.

2. The application according to claim 1, characterized in that, This includes transferring the recombinant expression vector into Agrobacterium GV3101 competent cells, followed by infecting potato explants.

3. The application according to claim 1, characterized in that, The promoters and terminators regulating the expression of the GalE, GS, and STS genes are as follows: The promoter of the GalE gene is MCPI, and the terminator is hsp; The promoter of the STS gene is GBSS, and the terminator is rbcS-E9; The promoter of the GS gene is class I patatin, and the terminator is NOS.

4. The application according to claim 1, characterized in that, The GalE, GS, and STS genes were inserted into the backbone vector and ligated using the restriction endonuclease Eco31I and 2×Seamless Cloning Mix recombinase.

5. The application according to claim 4, characterized in that, The skeletal carrier is carrier pNK2.

6. A method for constructing a recombinant expression vector as described in claim 1, characterized in that, Includes the following steps: S1. Use KOD One™ PCR Master Mix to amplify GalE, GS, STS genes, MCPI, GBSS, class Ipatatin promoters, and hsp, rbcS-E9, NOS terminators; S2. The backbone vector is digested with Eco31I enzyme, and the target gene and regulatory elements are ligated into the vector to form the recombinant expression vector pNK2-GalE-STS-GS.