Application of TaWRKY70 gene in regulation and control of plant phenol amine substance content and regulation and control method
By overexpressing or knocking out the TaWRKY70 gene in wheat, the content of phenoamines is regulated by using CRISPR/Cas9 gene editing technology, the problem of unclear phenoamine metabolism regulation network in WRKY transcription factor in wheat is solved, and effective regulation of the content of phenoamines is achieved.
Patent Information
- Application Number
- CN202510742134.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-08-19
AI Technical Summary
In important cereal crops such as wheat, the functional association and regulatory network of WRKY transcription factors and phenoamine metabolism have not been clarified, and the prior art is difficult to effectively regulate the content of plant phenoamine substances.
By overexpressing or knocking out the TaWRKY70 gene, the content of plant phenolamines is regulated using CRISPR/Cas9 gene editing technology, and genetic transformation is used for overexpression vectors such as pLGY-OE3 to construct plant germplasms with high content of phenolamines.
The content of plant phenolamines is significantly regulated. After overexpression, the content of phenolamines decreases, and the expression of downstream phenolamine biosynthesis-related genes decreases; after knockout, the expression of phenolamines increases, and the expression of downstream phenolamine biosynthesis-related genes increases, achieving negative correlation regulation of phenolamine content.
Smart Images

Figure CN120505362A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to an application of the TaWRKY70 gene in regulating the content of plant phenolamine substances and a regulation method. Background Art
[0002] Plant phenolamines are a class of secondary metabolites widely found in plants, present in nearly all plant organs. However, the types and amounts of phenolamines vary among different plant tissues. Phenolamines, also known as hydroxycinnamamides, can be considered products of the catabolism of amine compounds or conjugates of amines with hydroxycinnamic acid. Amines bind to hydroxycinnamoyl-CoA via specific hydroxycinnamoyltransferases and play a crucial role in plant growth, development, and interactions with the environment.
[0003] Plant phenolamines, important secondary metabolites of the phenylpropanoid family, begin their biosynthesis from aromatic amino acid precursors such as phenylalanine or tyrosine. These compounds undergo multi-stage modification, catalyzed by enzymes such as hydroxylases, methyltransferases, and acyltransferases, to form structurally diverse phenolamine derivatives. Studies have shown that the metabolic regulatory network for this class of compounds is closely associated with specific transcription factors. For example, in tomato, SlMYB13 specifically activates the expression of the phenolamine biosynthesis gene clusters BGC11 and BGC7, positively regulating phenolamine accumulation and significantly enhancing drought tolerance. This provides direct evidence for the molecular mechanism by which MYB transcription factors mediate phenolamine metabolism (Two gene clusters and their positive regulator SlMYB13 that have undergone domestication-associated negative selection control phenolamide accumulation and drought tolerance in tomato). It is worth noting that although WRKY transcription factors, which have similar regulatory characteristics to the MYB family, have been proven to be widely involved in plant growth and development, stress response, and secondary metabolism regulation, there are few studies on their regulatory effects on the metabolic pathways of phenolamines. In particular, in important cereal crops such as wheat, the functional association and regulatory network between WRKY transcription factors and phenolamine metabolism are still unclear. Summary of the Invention
[0004] The present invention provides an application of the TaWRKY70 gene in regulating the content of plant phenolamine substances and a regulation method. The TaWRKY70 gene is significantly correlated with the content of phenolamine substances.
[0005] The present invention provides an application of the TaWRKY70 gene in regulating the content of phenolamine substances in plants. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0006] In a preferred embodiment of the present invention, the plant phenolamine substances include at least one of the following: coumaroyl agmatine, caffeoyl agmatine, feruloyl agmatine and sinapyl agmatine.
[0007] The present invention also provides a use of a reagent for promoting TaWRKY70 gene expression in reducing the content of plant phenolamines. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0008] In a preferred embodiment of the present invention, the reagent for promoting the expression of the TaWRKY70 gene comprises an overexpression vector comprising the TaWRKY70 gene.
[0009] The present invention also provides an overexpression vector comprising the TaWRKY70 gene. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0010] The present invention also provides the use of a reagent for gene editing TaWRKY70 in wheat in increasing the content of phenolamines in wheat. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0011] In a preferred embodiment of the present invention, the gene editing includes CRISPR / Cas9 gene editing.
[0012] The present invention also provides the use of the TaWRKY70 gene in creating plant germplasm with a high phenolamine content. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0013] The present invention also provides a method for increasing the content of phenolamines in plants, comprising gene editing the TaWRKY70 gene in the plant, wherein the amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0014] In a preferred embodiment of the present invention, the plant includes monocotyledonous plants.
[0015] Beneficial effects: The present invention found that the TaWRKY70 gene was significantly correlated with the content of plant phenolamines. In particular, after overexpression of the TaWRKY70 gene, the content of phenolamines such as coumaroylagmatine (Cou-agm), caffeoylagmatine (caf-agm), feruloylagmatine (fer-agm) and sinapylagmatine (sin-agm) was significantly decreased, and the expression levels of downstream phenolamine biosynthesis-related genes TaF5H3 and TaACT4-1 / 4-2 / 4-3 were reduced. However, after knocking out the TaWRKY70 gene, the content of phenolamines such as Cou-agm, caf-agm, fer-agm and sin-agm increased, and the expression levels of TaF5H3 and TaACT4-1 / 4-2 / 4-3 genes increased, proving that the expression level of the TaWRKY70 gene was negatively correlated with the content of plant phenolamines. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 This is the classification of metabolites induced by powdery mildew infection in wheat seedling leaves in natural populations (FC>3);
[0017] Figure 2 The results of genome-wide association analysis of phenolamine content in wheat are shown in Figure 1.
[0018] Figure 3 is the expression level of TaWRKY70 in different wheat varieties after being treated with pathogens;
[0019] Figure 4 The subcellular localization results of TaWRKY70 in tobacco;
[0020] Figure 5 This is a diagram demonstrating the EMSA experiment;
[0021] Figure 6 The graphs are the results of the Y1H and LUC experiments;
[0022] Figure 7 Schematic diagram of the genetic transformation vector structure for overexpressing TaWRKY70 in wheat;
[0023] Figure 8 The expression levels of TaWRKY70 gene (A), expression levels of downstream phenolamine synthesis-related genes (B), and content of phenolamine substances (C) in wild-type wheat and transgenic wheat overexpressing TaWRKY70; ** indicates P < 0.01, *** indicates P < 0.001;
[0024] Figure 9 Two types of editing for the TaWRKY70 gene in wheat;
[0025] Figure 10The expression levels of phenolamine synthesis-related genes and the content of phenolamine substances in young leaves 48 hours after wheat powdery mildew infection were edited by TaWRKY70 gene. DETAILED DESCRIPTION
[0026] The present invention provides an application of the TaWRKY70 gene in regulating the content of phenolamine substances in plants. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0027] The TaWRKY70 gene described in the present invention is coded as TraesCS2D01G489700 in the genomic database and is named TaWRKY70 in this invention. The nucleotide sequence of the full-length TaWRKY70 genomic sequence is shown in SEQ ID No. 1, totaling 1174 bp. This gene has two introns. The nucleotide sequence of its CDS region is shown in SEQ ID No. 2, totaling 882 bp. The amino acid sequence of the encoded protein is shown in SEQ ID No. 3, encoding a total of 293 amino acids.
[0028] In one embodiment of the present invention, the TaWRKY70 gene was amplified from the wheat variety Fielder by PCR amplification. The primer pair for amplification included TaWRKY70-F and TaWRKY70-R, and the amplified fragment was 882 bp. In one embodiment of the present invention, PCR amplification was performed using Fly Fast High-Fidelity DNA Polymerase and specific primers according to the instructions to obtain the target gene fragment.
[0029] TaWRKY70-F(SEQ ID No.4)5'-ATGTCCATGGCGCCGTACGAGA-3';
[0030] TaWRKY70-R (SEQ ID No. 5): 5'-TCAATGGTCGAGATCGTACGA-3'.
[0031] The expression level of the TaWRKY70 gene described in the present invention can regulate the content of phenolamines in plants, wherein the plant phenolamines include at least one of the following: coumaroyl agmatine, caffeoyl agmatine, feruloyl agmatine, and sinapitoyl agmatine. In one embodiment of the present invention, genetic transformation is achieved by overexpression, and the resulting mutant has a reduced content of plant phenolamines and also inhibits the transcriptional activity of downstream phenolamine synthesis-related genes TaF5H3 and TaACT4-1 / 4-2 / 4-3. In another embodiment of the present invention, by knocking out the TaWRKY70 gene, the functional phenolamine content in the knockout mutant is increased, and the transcriptional activity of downstream phenolamine synthesis-related genes TaF5H3 and TaACT4-1 / 4-2 / 4-3 is also promoted. Therefore, the expression level of the TaWRKY70 gene described in the present invention can negatively regulate the content of phenolamines in plants.
[0032] The present invention also provides a use of a reagent for promoting TaWRKY70 gene expression in reducing the content of plant phenolamines. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0033] The present invention does not specifically limit the type of agent for promoting TaWRKY70 gene expression, and any agent known in the art that can overexpress or overexpress the TaWRKY70 gene can be used. For example, in one embodiment of the present invention, overexpression of the TaWRKY70 gene is achieved by transformation with an overexpression vector.
[0034] The present invention also provides an overexpression vector comprising the TaWRKY70 gene. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0035] The overexpression vector of the present invention uses a common plant overexpression vector in the art as a backbone vector, and the TaWRKY70 gene is inserted into the backbone vector. For example, in one embodiment of the present invention, pLGY-OE3 is used as a backbone vector, and the backbone vector is digested with BamH I to obtain a linearized vector. The fragment shown in SEQ ID No. 2 is ligated to the linearized vector to construct an overexpression vector containing the TaWRKY70 gene.
[0036] The present invention also provides a use of a reagent for gene editing TaWRKY70 in wheat for increasing the content of phenolamines in wheat. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0037] The present invention is not particularly limited to the gene editing method, such as CRISPR. In one embodiment of the present invention, the expression of the TaWRKY70 gene is inhibited by gene knockout.
[0038] In one embodiment of the present invention, referring to the method in the article (Genome-edited powdery mildew resistance in wheat without growth penalties), CRISPR-cas9 gene editing technology was used to edit TaWRKY70 and its orthologous genes in wheat, and the target sequence was:
[0039] 1+PAM (SEQ ID No. 6): GATCTGGTCCATGATGTGGCCGG;
[0040] 2+PAM (SEQ ID No. 7): CAAGTACGACCAGCAGTGCATGG.
[0041] The present invention also provides the use of the TaWRKY70 gene in creating plant germplasm with a high phenolamine content. The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0042] The method for creating plant germplasm of the present invention includes genetic transformation. The present invention is not particularly limited to the method of genetic transformation, and the genetic transformation of the TaWRKY70 gene is performed by referring to the method described in the prior art (Hayta S, Smedley MA, Demir SU, et al. An efficient and reproducible Agrobacterium-mediated transformation method for hexaploidwheat (Triticum aestivum L.) [J]. Plant Methods, 2019, 15: 1-15.).
[0043] The present invention also provides a method for increasing the content of phenolamines in plants, comprising gene editing the TaWRKY70 gene in the plant, wherein the amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No. 3.
[0044] The plants described in the present invention include monocotyledons. In one embodiment, wheat is used as an example for illustration, but this cannot be considered as the entire protection scope of the present invention.
[0045] To further illustrate the present invention, the application and regulation method of the TaWRKY70 gene provided by the present invention in regulating the content of plant phenolamine substances are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.
[0046] Example 1
[0047] Acquisition of TaWRKY70 gene
[0048] 1. TaWRKY70 gene identification and structural analysis
[0049] The inventors found that after powdery mildew infects wheat seedlings in natural populations, the contents of phenyloxalic acid and phenylalanine in the downstream metabolic pathway of phenylalanine increase ( Figure 1 ), after infection, coumaroyl agmatine was located in a gene cluster located on chromosome 2D of wheat ( Figure 2 ), further quantitative PCR detection showed that TaWRKY70 in this gene cluster was induced after pathogen treatment. Among them, different wheat varieties (LW05: Chinese Spring (CS), JZ189: Avocet and JZ283: FARO) had the gene number TraesCS2D01G489700 and were named TaWRKY70 ( Figure 3 The full-length genomic sequence of TaWRKY70 is 1174 bp (SEQ ID No: 1), the coding sequence is 882 bp (SEQ ID No: 2), encoding 293 amino acids (SEQ ID No: 3), and the gene has 2 introns.
[0050] 2. Amplification of the TaWRKY70 gene
[0051] Total RNA was extracted from the wheat variety Fielder, reverse transcribed into cDNA, and amplified using specific primers (TaWRKY70-F and TaWRKY70-R). The target fragment was amplified by PCR and ligated into the blunt-end vector pTOPO-BluntVector. The reaction product was transformed into Escherichia coli DH5α and revived in 1 mL of LB for 1 hour. 150 μL of the revived bacterial suspension was plated on a plate containing LB medium containing Amp-resistant AMP and incubated at 37°C for 12 hours. Single clones were detected by PCR, and plasmids were extracted and sequenced. The PCR products were sequenced and analyzed to obtain the cDNA sequence of the TaWRKY70 gene. An 882-bp TaWRKY70 gene sequence was amplified from Fielder. After correct sequence alignment, the cells were homologously recombined with the target vectors.
[0052] 3. Localization of the TaWRKY70 gene
[0053] TaWRKY70 was ligated with the linearized vector obtained by digesting the tobacco expression vector pSXGA with bsal enzyme. The gene localized in the nucleus was used as a nuclear marker. The two Agrobacterium resuspensions were mixed and injected into tobacco. Fluorescence imaging was performed using a laser confocal microscope 2 days later. The results are shown in Figure 2. Figure 4 As shown in the figure, the localization of TaWRKY70 protein is consistent with that of nuclear maker, both of which are located in the nucleus of tobacco. Therefore, it is speculated that TaWRKY70 protein is involved in the regulation of other genes in the nucleus of wheat.
[0054] Example 2
[0055] Regulation of wheat phenolamine content by TaWRKY70 genetic material
[0056] TaWRKY70 protein regulates the transcription of downstream phenolamine synthesis-related genes TaF5H3 (TraesCS2D01G490500), TaACT4-1 (TraesCS2D01G490400), TaACT4-2 (TraesCS2D01G490900), and TaACT4-3 (TraesCS2D01G491100):
[0057] EMSA: CY3-labeled oligonucleotide probes containing binding motifs, unlabeled conventional primers with the same sequence, and reverse complementary sequence primers were synthesized at Wuhan Qingke Biotechnology Co., Ltd. The probes, competitive probes, and mutant probes were synthesized into double strands using PCR. Before the reaction, a 6% polyacrylamide gel (PAGE) was prepared and pre-electrophoresis was performed in 0.5xTBE buffer at 4°C and 90V. After mixing the system, the reaction was incubated on ice in the dark for 30 minutes to 1 hour. After the reaction, the protein-nucleic acid complex was loaded onto a 6% PAGE gel and electrophoresed at 90V for 60 minutes. The gel was then imaged and analyzed on the Bio-Rad gel imaging system ChemiDoc.
[0058] F (SEQ ID No. 16): tgttccaggggcccctgggaATGTCCATGGCGCCGTACGAGAAGG;
[0059] R (SEQ ID No. 17): tcagtcacgatgcggccgcTCAATGGTCGAGATCGTACGACAGGAG.
[0060] Analysis of cis-acting elements in the promoter regions of four downstream structural genes (2.5 kb before the ATG) revealed that these four structural gene promoters contain W-boxes capable of binding to WRKY. Therefore, TaWRKY70 was constructed between the BamHI / NotI residues of the prokaryotic expression vector pGEX-6P-1 and induced for expression in Escherichia coli to obtain purified fusion proteins. Gel shift assays were performed using the fluorescently labeled W-box probe, GTGACG, present in all four promoters, as a probe. A synthetic DNA motif, TTTAAA, was used as a mutant probe, and a competitive probe, without fluorescently labeled GTGACG, was used. Results showed that the complexes of the TaWRKY70-encoded protein and the W-box probes in the promoter regions of the four structural genes migrated more slowly during gel electrophoresis than the blank control, forming a single band near the front of the membrane. However, the addition and increasing concentration of the competitive probe, the W-box probe from the TaACT4-2 promoter, decreased the intensity of the band, while the mutant probe did not. These results indicate that the TaWRKY70-encoded protein can bind to the W-boxes in the promoter regions of the four structural genes.
[0061] Yeast one-hybrid assay (Y1H): The Y1H vector was constructed as follows: the full-length transcription factor ORF was inserted into the pGADT7 vector between EcoRI and XhoI by homologous recombination. The promoter fragment (2.5 kb before the ATG of TaACT4-1 / 4-2 / 4-3 / TaF5H3) was inserted into the pAbAi vector between HindIII and SmaI. The correctly sequenced pAbAi recombinant plasmid and the p53-AbAi control vector were digested with BbsI, ensuring the integrity of the target sequence. The URA3 gene in the pAbAi vector was disrupted and linearized, and then dephosphorylated by FastAP enzyme treatment. The vector was transformed into the yeast strain Y1HGold (Shanghai Weidi Biotechnology) using the lithium acetate method and cultured in SD / -Ura medium at 30°C for 3 days. Y1H Gold yeast strains harboring the pAbAi linearized recombinant plasmid and the p53-AbAi linearized plasmid were selected. The Y1H Gold yeast strain successfully transformed with pAbAi was selected and the pGADT7 plasmid and the recombinant AD plasmid of the target transcription factor were respectively transformed into the yeast using the lithium acetate method. The pGAD-p53 plasmid was also transformed into the p53-AbAi yeast strain as a positive control. The strains were cultured at 30°C in SD / -Ura-Leu medium. Positive single colonies were selected and inoculated in ddH2O. After adjusting the concentration to a consistent level, ABA concentration screening and point-to-point interaction verification were performed on SD / -Ura-Leu medium containing varying concentrations of ABA.
[0062] EMSA and Y1H experiments Figure 5 and Figure 6As shown, yeast co-transformed with the promoter and TaWRKY70 can grow plaques on double-deficient plates with high concentrations of ABA, indicating that TaWRKY70 protein binds to the promoters of TaF5H3 and TaACT4-1 / 4-2 / 4-3 in vitro and in vivo, and can bind to the specific motif W-BOX on the promoters of downstream phenolamine synthesis-related genes TaF5H3 and TaACT4-1 / 4-2 / 4-3 in vitro.
[0063] LUC: The vectors for the dual luciferase experiment were constructed as follows: the gene promoter fragment was homologously recombined into the pGreenII0800-LUC dual reporter vector, the full-length ORF of the transcription factor was homologously recombined into the pCXSN-StrepII vector, and the two vectors and the pCXSN-StrepII empty vector were separately transformed into Agrobacterium GV3101 (pSoup-p19). The transformation recipient used in this experiment was Nicotiana benthamiana cultured for 4 to 5 weeks at a temperature of 25°C, 65% humidity, 14h light / 10h dark. Referring to the reported method (versatile expression vectors for easy and quick transient expressionofheterologous proteins inplants.doi:10.1111 / j.1467-7652.2009.00434.x), transient expression was performed in tobacco leaves. The experimental group injected the promoter recombinant vector bacterial solution (OD 600 =0.2) and the transcription factor recombinant vector bacterial solution (OD 600 =0.6) were co-injected into tobacco leaves, and the control group was injected with the promoter recombinant vector solution (OD 600 =0.2) and pCXSN-StrepII empty bacterial solution (OD 600 =0.6) were injected into the other half of the experimental group. Eight to ten tobacco leaves were treated with each combination. Three days later, samples were taken with a hole punch and the activities of firefly luciferase (LUC) and Renilla luciferase (REN) were measured using a Dual-Luciferase Reporter System Kit (Promega) and a Spark 10M microplate reader. The LUC / REN ratio in the experimental and control groups indicated transcriptional activity.
[0064] The results of the dual luciferase reporter gene assay were as follows Figure 6 As shown in the figure, the ratio of the detection values of luciferase to Renilla luciferase in the treatment group with co-expression of the four promoters and transcription factors was significantly lower than that in the control group, indicating that TaWRKY70 has a transcriptional inhibitory effect on the downstream TaF5H3 and TaACT4-1\2\34 genes.
[0065] 2. Construction of TaWRKY70 genetic transformation vector
[0066] The TaWRKY70 gene fragment amplified from Fielder in Example 1 was subjected to homologous recombination reaction with the target vector pLGY-OE3 to obtain a recombinant vector. The vector map is shown in Figure 7 The vector is an Agrobacterium-mediated genetic transformation vector carrying a maize ubiquitin gene promoter with constitutive and overexpression characteristics.
[0067] 3. TaWRKY70 genetic transformation
[0068] Referring to the prior art (Hayta S, Smedley MA, Demir SU, et al. An efficient and reproducible Agrobacterium-mediated transformation method for hexaploid wheat (Triticum aestivum L.) [J]. Plant Methods, 2019, 15: 1-15.), the plasmid correctly cloned in step 2 was introduced into the wheat variety Fielder through Agrobacterium EHA105 mediation and wheat genetic transformation system. After pre-culture, infection, co-cultivation, screening of callus tissue with glufosinate resistance, differentiation, rooting, seedling hardening and transplanting, transgenic plants were obtained.
[0069] 4. Analysis of gene expression and phenolamine content in TaWRKY70 overexpressing transgenic materials
[0070] DNA levels in T0-generation transgenic wheat plants were tested to confirm the construction of TaWRKY70-positive plants. These plants were then self-pollinated, with each generation testing positive. RNA and metabolic samples were collected from T3-generation transgenic wheat plants overexpressing TaWRKY70 and wild-type wheat plants that had grown to two leaves and one heart. The expression levels of TaWRKY70, TaF5H3, and TaACT4-1 / 4-2 / 4-3, as well as the levels of phenolamines, were analyzed.
[0071] TaF5H3-F (SEQ ID No. 8):CTTGACTTCAGGGGCAACTGC;
[0072] TaF5H3-R(SEQ ID No.9):ATTGGGTAGCGCCCAGCTAA;
[0073] TaACT4-1-F (SEQ ID No. 10): TGCTCATCCTGCTGCCGTCTT;
[0074] TaACT4-1-R(SEQ ID No.11):CTACTCGAGGTTGTAGCAGC;
[0075] TaACT4-2-F (SEQ ID No. 12): GCCAGACCAGTGAAGCACGC;
[0076] TaACT4-2-R (SEQ ID No. 13):ATCCACCTCGATGTTGGGGC;
[0077] TaACT4-3-F (SEQ ID No. 14): GACCGCGCTTCCTTCTTCCAA;
[0078] TaACT4-3-R (SEQ ID No. 15):TCCACAGACAATATCGTCGTA.
[0079] The results showed that the expression level of TaWRKY70 gene in the positive transformed plants overexpressing TaWRKY70 was significantly increased compared with the wild-type Fielder control ( Figure 8 A), the contents of phenolamine substances coumaroylagmatine (Cou-agm), caffeoylagmatine (caf-agm), feruloylagmatine (fer-agm) and sinapylagmatine (sin-agm) and the expression levels of TaF5H3 and TaACT4-1 / 4-2 / 4-3 were significantly decreased ( Figure 8 Middle B).
[0080] 5. Analysis of gene expression and phenolamine content in TaWRKY70 knockout transgenic materials
[0081] DNA levels in T0 transgenic wheat plants were tested to confirm the construction of TaWRKY70-positive plants. RNA and metabolic samples were collected from T2 transgenic wheat plants (positive for TaWRKY70 knockout) and wild-type wheat plants that had grown to two leaves and one heart, and the expression levels of TaF5H3, TaACT4-1 / 4-2 / 4-3, and the content of phenolamines in the plants were analyzed.
[0082] The results are as follows Figure 9 and Figure 10 As shown, compared with the wild-type control Fielder, the expression levels of TaF5H3 and TaACT4-1 / 4-2 / 4-3 genes in the TaWRKY70 knockout-positive transformed plants were increased, and the contents of phenolamine substances coumaroylagmatine (Cou-agm), caffeoylagmatine (caf-agm), feruloylagmatine (fer-agm) and sinapylagmatine (sin-agm) were increased.
[0083] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. The application of TaWRKY70 gene in regulating the content of plant phenolamine substances is characterized in that: The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No.
3.
2. The application according to claim 1, characterized in that The plant phenolamine substances include at least one of the following: coumaroyl agmatine, caffeoyl agmatine, feruloyl agmatine and sinapyl agmatine.
3. Use of an agent for promoting TaWRKY70 gene expression in reducing the content of plant phenolamines, characterized in that: The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No.
3.
4. The application according to claim 3, characterized in that The reagent for promoting the expression of the TaWRKY70 gene includes an overexpression vector containing the TaWRKY70 gene.
5. An overexpression vector comprising the TaWRKY70 gene, characterized in that: The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No.
3.
6. An application of a reagent for gene editing TaWRKY70 in wheat to increase the content of phenolamines in wheat, characterized in that: The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No.
3.
7. The application according to claim 6, characterized in that The gene editing includes CRISPR / Cas9 gene editing.
8. The use of the TaWRKY70 gene in creating plant germplasm with high phenolamine content, characterized in that: The amino acid sequence of the protein encoded by the TaWRKY70 gene is shown in SEQ ID No.
3.
9. A method for increasing the content of phenolamines in plants, characterized in that: The method comprises performing gene editing on the TaWRKY70 gene of the plant, wherein the amino acid sequence of the protein encoded by the TaWRKY70 gene is shown as SEQ ID No.
3.
10. The method according to claim 9, characterized in that: The plants include monocotyledons.