SNP (Single Nucleotide Polymorphism) marker related to sex reversal character of carp at high temperature and application of SNP marker

The SNP marker at base 39,892 of chromosome A12 was screened through second-generation resequencing and GWAS, which solved the problem of genetic background influence in high-temperature induced carp sexual reversal breeding, and achieved efficient molecular marker-assisted selection, improving breeding efficiency and stability of sexual reversal.

CN120505428APending Publication Date: 2025-08-19INST OF AQUATIC LIFE ACAD SINICA +1
0 Cites 0 Cited by

Patent Information

Application Number
CN202510524751.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-24
Publication Date
2025-08-19

Smart Images

  • Figure BDA0005374950700000041
    Figure BDA0005374950700000041
  • Figure BDA0005374950700000051
    Figure BDA0005374950700000051
  • Figure BDA0005374950700000061
    Figure BDA0005374950700000061
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, and discloses an SNP (Single Nucleotide Polymorphism) marker related to sex reversal traits of carps at high temperature and application of the SNP marker. The applicant adopts a second-generation re-sequencing technology to carry out whole genome level sequencing on 215 carp samples subjected to high-temperature induced reversion, adopts a whole genome association analysis method (GWAS) to analyze the character of sexual reversion of the carps under high-temperature induction, and screens a genetic locus SNP associated with the character. The phenotypic contribution rate (PVE) of the site is 15.5%, which indicates that the site can explain 15.5% of phenotypic variation in a group, and has high breeding value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and particularly relates to a SNP marker related to carp sex reversal traits and applications. Background Art

[0002] Common carp is one of the freshwater fish species widely farmed in Asia and Europe and has important commercial value. One-year-old female common carp grows about 30% faster than males of the same age. Therefore, achieving all-female farming through sex control technology is of great significance for increasing carp aquaculture production. At present, the pseudo-male common carp parents for preparing all-female common carp populations are mainly obtained by sex hormone induction. This method requires a large amount of sex hormones and may cause water pollution. In addition, the sperm production capacity of pseudo-male common carp is unstable and requires continuous sex hormone treatment after being obtained. High temperature induction of female common carp to male is a new method for preparing pseudo-male common carp. This method is simple to operate, environmentally friendly, and the pseudo-male common carp obtained has stable traits, showing potential for application in all-female common carp breeding. However, the success rate of high temperature induction of female common carp from different populations varies, suggesting that the sensitivity of common carp to high temperatures is affected by genetic background.

[0003] Single nucleotide polymorphisms (SNPs) primarily refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. Strategies using molecular marker information to assist breeding have been widely applied in both plants and animals. Compared to traditional breeding methods, molecular breeding can shorten breeding time, simplify the traditional breeding process, and significantly improve breeding efficiency.

[0004] Genome-wide association studies (GWAS) aim to identify genetic variants at the genome-wide level, identifying SNPs associated with target traits. These SNPs can be directly used for molecular marker-assisted selection and are currently an important tool for unlocking genotype-phenotype associations in genetic breeding research. Currently, no SNP markers for sex reversal in common carp have been reported. This study used second-generation resequencing technology to conduct a genome-wide association analysis of sex reversal in common carp from different families, identifying key genes and functional mutations associated with sex reversal in common carp. This study aims to provide new molecular markers for marker-assisted selection and predictive improvement of sex reversal in common carp, significantly promoting research on all-female common carp breeding. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of a reagent for detecting the 39,892th base on carp chromosome A12 in the screening and breeding of sex-reversed traits in carp under high temperature.

[0006] Another object of the present invention is to provide a primer for detecting base 39,892 on chromosome A12 of carp for use in screening and breeding of sex-reversed carp at high temperatures.

[0007] The last object of the present invention is to provide a method for breeding sex-reversed carp at high temperature.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] The applicant used the second-generation resequencing technology to sequence 215 carp samples with high-temperature-induced sex reversal at the whole genome level, and used the whole genome association analysis method (GWAS) to analyze the trait of carp sex reversal under high temperature induction, and identified SNP markers related to carp sex reversal. The SNP marker is the carp genome (GCF_018340385.1), the 39,892th base on chromosome A12, and there is an A / G allele mutation at this site. This molecular marker can be used as a molecular marker for detecting carp sex reversal induced by high temperature, and when the 51st nucleotide on the sequence is A, it is conducive to a higher proportion of high-temperature-induced sex reversal in carp. If the site is G, it is judged to be an individual that is not prone to high-temperature sex reversal. The scope of protection of the present invention includes:

[0010] Application of a reagent for detecting base 39,892 on chromosome A12 of common carp in screening and breeding of sex-reversed common carp under high temperature.

[0011] The reagents described above are preferably primers.

[0012] The primers described above may be considered to be the primers provided by the present invention: F: AAATAAGACATTTCAGGACGGCG TGG and R: TGCACTAGCTGTTACATTAAAGGGGTCATA.

[0013] A method for breeding sex-reversed carp at high temperature comprises detecting base 39,892 on carp chromosome A12 using conventional protocols in the art, wherein the conventional protocols include but are not limited to sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0014] The method described above comprises the following determination method: when it is detected that the 39,892th base on chromosome A12 of the carp is A, the carp has a higher proportion of high temperature-induced sex reversal.

[0015] The version number of the carp genome used in the present invention is GCF_018340385.1, and the download address is https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_018340385.1 / .

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] Currently, there are no reports linking high-temperature-induced sex reversal in common carp with genetic background. This study, published in Nature Communications, is the first to discover that the proportion of common carp undergoing sex reversal induced by high temperatures is correlated with their genetic background. The study also identified a single nucleotide polymorphism (SNP) at a genetic locus associated with this trait. The phenotypic contribution (PVE) of this locus is 15.5%, indicating that it can explain 15.5% of the phenotypic variation within the population and has high breeding value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Manhattan plot for genome-wide association analysis of sex reversal traits in common carp;

[0019] This figure shows the high temperature-induced sex reversal traits of the carp population. The most stringent correction method was selected for analysis, and the screened SNP is located on chromosome A12.

[0020] Figure 2 QQ-Plot diagram of genome-wide association analysis of sex reversal traits in carp. DETAILED DESCRIPTION

[0021] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field; the reagents or materials described are all from commercial channels unless otherwise specified.

[0022] The sequence and genome-wide association analysis results in the present invention are based on the information of the common carp genome (GCF_018340385.1) version, which can be downloaded from https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_018340385.1 / .

[0023] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0024] Example 1:

[0025] Acquisition of SNP markers related to sex reversal traits in carp under high temperature:

[0026] (1) DNA was extracted from 251 fin ray samples of common carp that had undergone high-temperature-induced sex reversal. After quality testing, qualified samples were used for library construction and genome sequencing to obtain raw fastq format data. The average sequencing depth of the samples was 15×.

[0027] (2) Raw data were preprocessed by using fastqc to remove low-quality reads, aligned to the common carp reference genome, and using Picard to remove PCR duplications.

[0028] (3) GATK4 software was used for SNP calling, and the Varian Filtration module was used to perform quality filtering of SNPs (filtering criteria: QD < 2.0 || FS > 60.0 || MQ < 35.0 || MQRankSum < -12.5 || ReadPosRankSum < -8.0 || SOR > 3.0). High-quality SNPs were used for subsequent genotype filling.

[0029] (4) Begale4.1 was used to fill in the missing SNPs obtained, and Plink1.9 was used to perform secondary quality control on the filled SNPs (quality control standards: remove SNPs missing in more than 10% of the samples, remove samples with genome call rates lower than 90%, remove SNPs with minimum allele frequencies less than 0.01, and screen SNPs with large deviations from the Harvin equilibrium). Finally, 215 individuals and 19,111,782 high-quality SNPs were retained for subsequent whole-genome association analysis.

[0030] (4) Filter and screen the phenotypic data to eliminate outliers.

[0031] (5) After obtaining high-quality phenotypic and genotypic data, genome-wide association analysis (GWAS) was performed using GEMMA software, using the following mixed linear model:

[0032] y=Wα+xβ+u+ε。

[0033] Where y represents the phenotype; W is the covariate matrix; α is the corresponding coefficient; x is the genotype vector; β represents the effect of the corresponding SNP; u is the random polygenic effect vector; ε represents the random error. The first four principal components are added as covariates in the model to control population stratification and false positives. GEMMA software will output the statistical test P value of each SNP marker. According to the size of the P value, Bonferroni correction is the most stringent multiple testing correction method. The SNPs significantly associated with the sex reversal trait of carp are determined, and the Manhattan plot is drawn using the R language CMplot package ( Figure 1 ) and QQplot ( Figure 2 ).

[0034] (6) Haplotype analysis

[0035] The present invention selected the SNP site with the strongest significance on the threshold line for further analysis and used R language to perform a significance test. The allele gene frequencies of different individuals in the population showed significant differences in the sex reversal trait (P < 0.05). When the marker mutated to A, it was conducive to high temperature-induced sex reversal in carp (Table 1).

[0036] Table 1 SNP locus gene frequency

[0037]

[0038] The SNP marker is located at base 39,892 on chromosome A12 of the carp genome (GCF_018340385.1). The nucleotide sequence of the 50 bp upstream and downstream of the SNP site is as follows:

[0039] TTGGGTTTGAGACTTTAGTCTTTGCAACTTTAGGGATCTTATCTATTTACN(G / A)AA CAGCTTGTAACACTCCAAAGAGAATGGAAAACTTGAAATCACATTATA.

[0040] The N at the 51st base of the above sequence represents an A51-G51 allele mutation, which results in a nucleotide polymorphism in the sequence. This molecular marker can be used as a molecular marker for detecting high-temperature-induced sex reversal in carp. When the 51st nucleotide in the sequence is an A, it is more likely to cause high-temperature-induced sex reversal in carp.

[0041] Example 2:

[0042] Development of SNP molecular marker detection primers and detection methods:

[0043] Primers for amplifying and detecting the genotype of the SNP site described in Example 1 were developed. The primer sequences are as follows:

[0044] F: AAATAAGACATTTCAGGACGGCGTGG;

[0045] R: TGCACTAGCTGTTACATTAAAGGGGTCATA.

[0046] The length of the amplified sequence was 186 bp.

[0047] The PCR reaction procedure for amplifying SNP molecular markers using the above primers was as follows: pre-denaturation at 94°C for 3 min; 33 cycles of 94°C for 20 s, 60°C for 20 s, and 72°C for 20 s; and finally extension at 72°C for 5 min. The PCR products were stored at 4°C for future use and used for sequencing.

[0048] The PCR reaction system (total volume 25 μL) for amplifying SNP molecular markers using the above primers is as follows:

[0049] 0.5 μL of upstream and downstream primers, concentration 10 pmol / L; 10.5 μL of ddH2O; 12.5 μL of 2×Taq PCR Mix; 1 μL of DNA template, concentration 100 ng / μL.

[0050] Using the above primers, the 186 bp sequence amplified is:

[0051] AAATAAGACATTTCAGGACGGCGTGG ATGAGTCTTAACTTTTATAAAGAATATAT

[0052] CTTTGGGTTTGAGACTTTAGTCTTTGCAACTTTAGGGATCTTATCTATTTAC G AACAGC

[0053] TTGTAACACTCCAAAGAGAATGGAAAACTTGAAATCACATTA TATGACCCCTTTAATGTAACAGCTAG TGCA .

[0054] or

[0055] AAATAAGACATTTCAGGACGGCGTGG ATGAGTCTTAACTTTTATAAAGAATATAT

[0056] CTTTGGGTTTGAGACTTTAGTCTTTGCAACTTTAGGGATCTTATCTATTTAC A AACAGC

[0057] TTGTAACACTCCAAAGAGAATGGAAAACTTGAAATCACATTA TATGACCCCTTTAATGTAACAGCTAG TGCA .

[0058] The amplified product is sequenced to detect the genotype of the SNP site. If the site is A, the individual is judged to be prone to high temperature sex reversal. If the site is G, the individual is judged to be less likely to undergo high temperature sex reversal.

[0059] Example 3:

[0060] Application of SNP molecular markers in carp due to the high sex reversal rate at high temperatures:

[0061] This example used Yellow River carp from three families, designated X, H, and D, as the experimental material. Sixty carp from each family were subjected to a high-temperature treatment at 36.5-37.5°C between 60 and 120 days after hatching, while maintaining normal feeding. After the high-temperature treatment, gonadal biopsies were taken from each fish to determine if sex reversal had occurred. For detailed procedures, refer to CN118435911A.

[0062] The SNP marker genotypes of the above materials were detected using the SNP marker amplification primers, PCR amplification program, and reaction system described in Example 2. The genotypes and genotype frequencies of the SNP locus (A12: position 2415082) were also detected. The results are shown in the following table. The gene frequency at this locus in carp that can undergo sex reversal after high temperature induction is significant, with the A gene frequency being significantly lower than the G gene frequency (Tables 2 and 3).

[0063] Table 2 Allele frequencies of SNP loci in three different families

[0064]

[0065] Table 3 Genotype results of this locus in three different families

[0066]

[0067] This specific embodiment is only an explanation of the present invention, and it is not a limitation of the present invention. After reading this specification, those skilled in the art can make non-creative modifications to this embodiment as needed, but as long as it is within the scope of the claims of the present invention, it is protected by patent law.

Claims

1. Application of a reagent for detecting base 39,892 on chromosome A12 of carp in screening and breeding for sex reversal traits in carp under high temperature.

2. The use according to claim 1, wherein the reagent is a primer.

3. The use according to claim 2, wherein the primers are: F: AAATAAGACATTTCAGGACGGCGTGG and R: TGCACTAGCTGTTACATTAAAGGGGTCATA.

4. A method for breeding sex-reversed carp at high temperature, comprising detecting base 39,892 on chromosome A12 of carp using conventional protocols in the art, wherein the conventional protocols include sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry.

5. The method according to claim 4, characterized in that: When the 39,892th base on chromosome A12 of carp was detected to be A, the carp underwent a higher rate of high temperature-induced sex reversal.