Method for preparing meso-porous silicon capable of interfering dsrna to inhibit inflammation

Abstract

The invention discloses a method for preparing meso-porous silicon capable of interfering dsRNA (double-stranded ribonucleic acid) to inhibit inflammation. The dendritic hollow meso-porous silicon with a specific structure is prepared, cerium ions are fixed on the surface of the meso-porous silicon through ligand bonds of a silane coupling agent and NTA and coordination connection of NTA and cerium, and the effect of catalytic digestion of mt-dsRNA is achieved. The IMT1 is a mitochondrial transcription (IMTs) specific inhibitor aiming at mitochondrial RNA polymerase (POLRMT), mtDNA transcription can be effectively destroyed, mtDNA expression and OXPHOS dose-dependent inhibition are caused in a cell line, and generation of mt-dsRNA is reduced. A hydrophobic drug IMT1 is loaded through the adsorption effect of dendritic hollow meso-porous silicon, so that the drug can be stably released in a physiological environment, the generation of mt-dsRNA is reduced, and the effect of doubly inhibiting downstream pathways is achieved so as to inhibit inflammation.

Description

Technical Field

[0001] The present invention relates to a method for preparing mesoporous silica having the function of intervening dsrna to inhibit inflammation. Background Art

[0002] Osteoarthritis is a degenerative disease of the synovial membrane, which often occurs in the knee joint, hip joint, etc. Although osteoarthritis has traditionally been considered a non-inflammatory joint disease or an age-related "wear and tear" disease, the complex interaction between inflammatory cytokines plays a key role in its pathogenesis. Specifically, excessive secretion of interleukin-1β (IL-1β) and tumor necrosis factor α (TNF-α) can promote the exacerbation of synovial tissue inflammation. Among them, macrophages are the main cellular component of the synovial membrane. They are highly plastic and can be stimulated to differentiate into different phenotypes, namely pro-inflammatory phenotype (M1) and anti-inflammatory / tissue repair phenotype (M2). The imbalance of the M1 / M2 ratio is significantly correlated with the severity of OA. Therefore, by regulating the changes in macrophage phenotype, the progression of OA can be alleviated to a certain extent.

[0003] Under viral infection, bidirectional transcription of the circular genome generates long complementary RNAs from mtDNA, which can bind to each other to form intermolecular dsRNAs. Recent studies have shown that in inflammatory conditions such as osteoarthritis, mitochondrial dysfunction, elevated reactive oxygen species (ROS) levels, and DNA damage can lead to the massive accumulation of mt-dsRNA at the single-cell level. This mt-dsRNA is then recognized by the pattern recognition receptors (PRRs) MDA5 and RIG-1, triggering a type I IFN response and inducing inflammation.

[0004] Cerium, a rare earth element, possesses excellent activity in hydrolyzing RNA and DNA. Cerium ions have significantly higher hydrolytic activity than other rare earth elements. Its nucleic acid hydrolysis occurs primarily through the hydrolysis of phosphodiester bonds, a process similar to the cleavage of natural nucleases and ribonucleases. IMT1, a mitochondrial transcription factor (IMTs)-specific inhibitor targeting human mitochondrial RNA polymerase (POLRMT), effectively disrupts mtDNA transcription and induces dose-dependent inhibition of mtDNA expression and OXPHOS in cell lines, thereby reducing the disordered release of mt-dsRNA. The synergistic effect of these two agents can significantly reduce the pro-inflammatory effects of mt-dsRNA, block downstream protein pathways, and exert an anti-inflammatory effect.

[0005] Although cerium and IMT1 have good nucleic acid hydrolysis and mt-dsRNA release inhibition functions, they are also cytotoxic at a certain concentration and cannot target inflammatory cells, which makes it difficult to control the concentration required to achieve anti-inflammatory effects, limiting their clinical application.

[0006] In recent years, mesoporous silica nanomaterials have emerged as one of the most promising drug carriers in the innovative development of inorganic nanomaterials. The advantages of developing nanotechnology-based delivery systems lie in the excellent biocompatibility of MSNs, the high Si-O bond energy that maintains chemical stability, the availability of silanol groups on the surface for modification, and the rigid skeleton, well-defined pore structure, easily controllable morphology, and tunable surface chemistry of MSNs. Furthermore, mesoporous silica can deliver unique protein-drug combinations, which is crucial for personalized medicine. This allows it to overcome the shortcomings of proteins, such as poor solubility, poor stability, difficulty crossing cell membranes, and lack of specificity. Due to its relatively high affinity for cell membrane phospholipids, MSNs can be adsorbed on the cell surface and taken up by various cells through endocytosis.

[0007] Cerium-modified mesoporous silica has a special morphology and the property of hydrolyzing nucleic acids. After loading IMT1, it can hydrolyze the produced mt-dsRNA and reduce the production of mt-dsRNA while maintaining properties that are more conducive to cellular endocytosis, thereby inhibiting downstream signaling proteins and suppressing inflammation. Summary of the Invention

[0008] The purpose of the present invention is to provide a method for preparing cerium ion-modified drug-loaded dendritic mesoporous silica with the functions of clearing mt-dsRNA and inhibiting the release of mt-dsRNA to inhibit inflammation.

[0009] The present invention provides a method for preparing mesoporous silica having intervening dsRNA to inhibit inflammation, comprising the following steps:

[0010] Preparation of dendritic mesoporous silica (DMSN): Hexadecyltrimethylammonium chloride (CTAC) and triethanolamine are added to water, followed by a mixture of ethyl silicate and cyclohexane. The mixture is stirred in an oil bath to obtain monodisperse mesoporous silica particles. After removing excess CTAC ligands, anhydrous methanol and concentrated hydrochloric acid are added to remove the template, and the mesoporous silica is obtained by high-speed centrifugation. The template removal step is repeated to completely remove any residual surfactant.

[0011] Preparation of NTA-NH2: nε-benzyloxycarbonyl-l-lysine was dissolved in a NaOH solution, added dropwise to a bromoacetic acid solution, and then stirred and heated after adding NaOH. After cooling, HCl was added, and the mixture was filtered and dried to obtain a crude white powder, which was further dissolved and purified to obtain compound A. Compound A was dissolved in methanol / water, and a Pd / C catalyst was added. The mixture was stirred in hydrogen, filtered, and lyophilized to obtain a white powder. After dissolution, the powder was allowed to stand with seeds to obtain NTA-NH2.

[0012] Synthesis of Ce@DMSN: DMSN was centrifuged and then re-dissolved in anhydrous ethanol. NTA-NH2 was added and stirred. After centrifugation, it was redispersed in water. Ammonium cerium nitrate was added and stirred. After high-speed centrifugation, it was redispersed in water to obtain the product Ce@DMSN.

[0013] Drug loading of Ce@DMSN: Ce@DMSN and IMT1 were dissolved in anhydrous ethanol and dissolved to a certain volume; rotary evaporation was performed, followed by water washing and dilution to a certain volume with water.

[0014] Furthermore, in the preparation of the dendritic mesoporous silica, the surfactant is a quaternary ammonium salt compound, the catalyst is an alcoholamine compound, the silicon source is a silicate compound, and the organic solvent is cyclohexane.

[0015] Furthermore, in the preparation of NTA-NH2, the amino acid derivative is a benzyloxycarbonyl-protected amino acid, the base is sodium hydroxide, and the halogenated acid is bromoacetic acid.

[0016] Furthermore, in the synthesis of Ce@DMSN, the ligand is a compound containing an iminodiacetic acid group, and the cerium source is ammonium cerium nitrate.

[0017] Furthermore, the drug in the drug-carrying agent of Ce@DMSN is a transcription inhibitor targeting mitochondrial RNA polymerase.

[0018] The present invention provides mesoporous silica for inhibiting inflammation, prepared using the above-mentioned method. The dendritic mesoporous silica has an overall diameter between 100 and 200 nm, facilitating cellular endocytosis. The release of cerium ions after endocytosis can eliminate free mt-dsRNA. Simultaneously, IMT1, a mitochondrial transcription-specific inhibitor of mitochondrial RNA polymerase, disrupts mtDNA transcription and reduces mt-dsRNA production.

[0019] The present invention provides a pharmaceutical composition comprising the mesoporous silicon, and the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0020] The beneficial effects of this invention lie in the specific morphology and suitable particle size of cerium-modified mesoporous silica, which facilitates cellular endocytosis and provides the dual function of stable release of drugs and cerium ions. Under inflammatory conditions, the stable release of drugs and cerium ions antagonizes the RIG-1 / MDA5-MAVS inflammatory pathway by both reducing the production of mt-dsRNA and hydrolyzing existing mt-dsRNA, thereby achieving a significant anti-inflammatory effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a transmission electron microscope photo of cerium-modified drug-loaded mesoporous silica.

[0022] Figure 2 is the relationship between the molecular weight of Ce@DMSN and the amount of IMT1 fed.

[0023] Figure 3 The potential (left) and particle size (right) of dendritic mesoporous silica before and after cerium modification and drug loading treatment.

[0024] Figure 4 The difference in RNA expression of inflammatory factors and pathway proteins after Ce@DMSN-IMT1 was co-cultured with inflammatory cells for 24 hours.

[0025] Figure 5 This is the blood test result after Ce@DMSN-IMT1 and other particles were injected into the joint cavity of rats.

[0026] Figure 6 This is the release curve of cerium ions and IMT1 drugs from Ce@DMSN-IMT1 particles.

[0027] Figure 7 This is an imaging analysis of rat knee joints after Ce@DMSN-IMT1 particles were injected into the rat joint cavity. DETAILED DESCRIPTION

[0028] The present invention is further described below with reference to examples, but these examples are not intended to limit the present invention.

[0029] Preparation of dendritic mesoporous silica (DMSN):

[0030] Step (1): 6 g of hexadecyltrimethylammonium chloride (CTAC) and 0.18 g of triethanolamine were added to 24 ml of water in sequence, followed by 36 ml of water. The mixture was stirred vigorously in an oil bath at 60 degrees for half an hour to fully dissolve.

[0031] Step (2): 2 ml of ethyl silicate and 18 ml of cyclohexane were slowly added dropwise to the mixture, and the mixture was slowly stirred in an oil bath at 60°C for 8-10 hours to obtain monodisperse mesoporous silica particles. Excess CTAC ligand was then removed by low-speed centrifugation. A small amount of anhydrous ethanol was added to reduce the solubility of the mesoporous silica in the solvent, and the mesoporous silica was separated by high-speed centrifugation.

[0032] Step (3): Redisperse the mesoporous silica in 40 ml of anhydrous methanol and add 1 ml of concentrated hydrochloric acid. Stir in an oil bath at 60°C for 1-2 hours to remove the template, then centrifuge at high speed to obtain the mesoporous silica. Repeat this step 2-3 times to completely remove the template. Redissolve the dendritic mesoporous silica obtained by high-speed centrifugation in water until no foam is generated to confirm complete removal of residual surfactant.

[0033] Preparation of NTA-NH2:

[0034] Step (1), nε-benzyloxycarbonyl-l-lysine (8.41 g, 30 mmol) was dissolved in 45 mL of 2M NaOH (8 g of NAOH pellets were dissolved in 100 mL of water), and the solution was stirred and then added dropwise to a 0°C solution of bromoacetic acid (8.34 g, 60 mmol). 2M NaOH (30 mL) was then added. The solution was stirred at 25°C overnight and then heated at 70°C for 2 hours. 1M HCl (90 mL) was added to the cooled solution. The precipitate was filtered and dried to obtain a crude white powder, which was further dissolved and purified with 1M NaOH (100 mL) (4 g of NAOH pellets were dissolved in 100 mL of water), and precipitated with 1M HCl (100 mL) to obtain pure (1S)-n-(5-carbobenzyloxyamine-1-carboxypentyl)iminodiacetic acid (Compound 1).

[0035] Step (2), compound 1 (6.83 g, 17.2 mmol) was dissolved in methanol (108 mL) / water (5.7 mL) and 10% Pd / C catalyst (0.68 g). Stirred overnight in hydrogen at 25°C and 760 mmHg. The solution was filtered and the residue was dispersed in water (50 mL). The suspension was then filtered and the filtrate was freeze-dried to obtain a white powder. The powder was dissolved in water (20 mL) and ethanol (15 mL) was added until turbid; after heating to a clear solution, it was allowed to stand at -20°C together with the seeds. The white crystals were filtered and dried to obtain (1S)-n-(5-amino-1-carboxypentyl)iminodiacetic acid (NTA-NH2, 4.37 g, yield 96.7%).

[0036] Step (3): 0.2 g of NTA was dissolved in 2 ml of DMSO, 250 μl of isocyanatepropyltriethoxysilane was added in argon, and then 93 mg of 4-dimethylaminopyridine was added. The mixture was stirred in argon for 24 h to obtain the product NTA-NH2.

[0037] Synthesis of Ce@DMSN:

[0038] Step (1): DMSN was centrifuged (12000r, 30min) and then re-dissolved in anhydrous ethanol. NTA-NH2 was added at a mass ratio of DMSN:NTA-NH2=1:2 and stirred overnight.

[0039] Step (2), after centrifugation at 12000r for 30min, the mixture was redispersed in water, and ammonium cerium nitrate was added according to the mass ratio of DMSN-NTA: ammonium cerium nitrate = 1:3. After stirring for 1h, the mixture was centrifuged at high speed and redispersed in water to obtain the product Ce@DMSN.

[0040] Drug loading of Ce@DMSN:

[0041] Step (1): dissolve Ce@DMSN and IMT1 in anhydrous ethanol and adjust the volume to 5 ml.

[0042] Step (2): rotary evaporation was performed at 150 MPa, 70 rpm, and 36 degrees Celsius, followed by washing with water twice and diluting the volume to 1 ml with water.

[0043] The dendritic mesoporous silica described in the present invention has an overall diameter between 100 and 200 nm. This structure facilitates cellular endocytosis, and the porous structure facilitates drug release. The present invention eliminates free mt-dsRNA by releasing cerium ions after endocytosis. Simultaneously, IMT1, a specific inhibitor of mitochondrial transcription (IMTs) targeting mitochondrial RNA polymerase (POLRMT), effectively disrupts mtDNA transcription and induces dose-dependent inhibition of mtDNA expression and OXPHOS in cell lines, reducing mt-dsRNA production.

[0044] The principle behind this invention is that the resulting mesoporous silica is stable under normal physiological conditions and can persist in the joint cavity for extended periods, steadily releasing drugs and cerium ions. IMT1 activates the mitochondrial mtDNA transcription process, thereby reducing the release of mt-dsRNA during inflammation. Simultaneously, cerium ions hydrolyze produced mt-dsRNA, blocking its activation of downstream response proteins RIG-1 and MDA5, thereby inhibiting inflammation. Furthermore, the mesoporous silica's dendritic morphology and suitable particle size facilitate drug adsorption and efficient cellular endocytosis, increasing its intracellular accumulation and residence time.

[0045] Example 1

[0046] 1) Add 6g of hexadecyltrimethylammonium chloride (CTAC) and 0.18g of triethanolamine to 24ml of water in sequence, then add 36ml of water and stir vigorously in a 60-degree oil bath for half an hour to fully dissolve. Take 2ml of ethyl silicate and 18ml of cyclohexane and slowly drip them into the mixture, and stir slowly in a 60-degree oil bath for 8-10h to obtain monodispersed mesoporous silica particles. After low-speed centrifugation to remove excess CTAC ligands, add a small amount of anhydrous ethanol to reduce the solubility of mesoporous silica in the solvent, and then centrifuge at high speed to separate the mesoporous silica. Re-disperse the mesoporous silica in 40ml of anhydrous methanol and add 1ml of concentrated hydrochloric acid. Stir in a 60-degree oil bath for 1-2 hours to remove the template and then centrifuge at high speed to obtain mesoporous silica. Repeat this step 2-3 times to completely remove the template.

[0047] The dendritic mesoporous silica obtained by high-speed centrifugation was redissolved in water until no foam was produced to ensure that the residual surfactant was completely removed. After centrifugation of DMSN (12000r, 30min), it was re-dissolved in anhydrous ethanol, and NTA-NH2 was added at a mass ratio of DMSN:NTA-NH2=1:2, and stirred overnight. After centrifugation at 12000r, 30min, it was redispersed in water, and ammonium cerium nitrate was added at a mass ratio of DMSN-NTA: ammonium cerium nitrate=1:3. After stirring for 1h, it was obtained by high-speed centrifugation and redispersed in water to obtain the product Ce@DMSN. Its transmission electron microscope photo is shown in Figure 1 .

[0048] 2) 1 mg of the Ce@DMSN microparticles obtained in step 1) were centrifuged to obtain Ce@DMSN precipitated microparticles. Ce@DMSN and 0.25 mg of IMT1 were dissolved in anhydrous ethanol and then diluted to 5 ml with anhydrous ethanol. Rotary evaporation was performed at 150 MPa, 70 rpm, and 36°C. The microparticles were then washed twice with water and diluted to 1 ml with water. The collected microparticles were lyophilized and redissolved in DMSO. After the IMT1 in the mesoporous silica was expelled, the supernatant was collected and the drug loading was determined by HPLC. The results showed that the IMT1 drug loading was 3.4% ( Figure 2 ).

[0049] 3) Dissolve 1 mg of DMSN, Ce@DMSN, and Ce@DMSN-IMT1 obtained in steps 1) and 2) in ultrapure water. The particle size and surface potential of the dendritic mesoporous silica before and after cerium modification and drug loading were measured. The results showed that after cerium modification and drug loading, the mesoporous silica particle size increased significantly, and the surface charge changed from negative to positive, indicating changes in surface molecules ( Figure 3 ).

[0050] 4) The Ce@DMSN-IMT1 microparticles (5 μg / mL) obtained in step 2) were co-cultured with primary macrophages BMDM stimulated with LPS (100 ng / ml) for 24 hours. After washing with PBS, RNA was collected and reverse transcribed, and the inhibitory effect of the microparticles on inflammation was tested using qPCR (primer sequences: RIG1-F: CGATATTTTGAAAGACTTGGGTACA, R: ATGGCTCCGTTGTTGAGATTG; IL-6-F: TACCACTTCACAAGTCGGAGGC, R: CTGCAAGTGCATCATCGTTGTTC). The results showed that in the presence of Ce@DMSN-IMT1, it can achieve better anti-inflammatory and inhibitory effects on pathway proteins than using Ce@DMSN or IMT1 alone ( Figure 4 ).

[0051] 5) 1 ml of Ce@DMSN-IMT1 microparticles obtained in step 2) was dialyzed in 10 ml of 0.1% Tween water for sustained release, and the dialysates at 0.5 h, 1 h, 3 h, 6 h, 12 h, 24 h, and 48 h were collected to measure the release rates of IMT1 drugs and cerium ions by HPLC and ICP ( Figure 5 ).

[0052] 6) The Ce@DMSN-IMT1 microparticles (50ul, 10mg / ml) obtained in step 2) were injected into the rat joint cavity. After one month of continuous injection, blood samples were collected from the rats for routine blood tests and biochemical tests. The results showed that the nanoparticles did not show obvious drug toxicity ( Figure 6 ).

[0053] Example 2

[0054] Same as Example 1, except for step 2): Take 10 mg of cerium-modified dendritic mesoporous silicon nanoparticles, use anhydrous ethanol to dissolve Ce@DMSN and 0.25 mg IMT1, and use anhydrous ethanol to dissolve to 5 ml. Rotary evaporation is performed at 150 MPa, 70 r, and 36 degrees, then washed with water twice and diluted to 1 ml with water. After that, the same dose of Ce@DMSN-IMT1, Ce@DMSN, and DMSN-IMT1 is injected into the knee joints of rats with meniscus removal + anterior cruciate ligament detachment of the knee joint every week for anti-inflammatory treatment. After 5 consecutive weeks, the rats were killed, the rat knee joints were separated, and micro-CT was used to shoot the absorption of the rat knee joints. The results show that Ce@DMSN-IMT1 has better anti-inflammatory effect ( Figure 7 ).

[0055] Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art may still modify the technical solutions described in the aforementioned embodiments, or make equivalent substitutions for some of the technical features therein, or implement the present invention in other improved forms. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

Claims

1. A method for preparing mesoporous silica with intervening dsRNA to inhibit inflammation, characterized in that: The following steps are involved: Preparation of dendritic mesoporous silica (DMSN): Cetyltrimethylammonium chloride (CTAC) and triethanolamine were added to water, followed by a mixture of ethyl silicate and cyclohexane. The mixture was stirred in an oil bath to obtain monodispersed mesoporous silica particles. After removing the excess CTAC ligand, anhydrous methanol and concentrated hydrochloric acid were added to remove the template, and mesoporous silica was obtained by high-speed centrifugation; Repeat the template removal step to completely remove the residual surfactant; Preparation of NTA-NH2: nε-benzyloxycarbonyl-l-lysine was dissolved in a NaOH solution, added dropwise to a bromoacetic acid solution, and then stirred and heated after adding NaOH. After cooling, HCl was added, and the mixture was filtered and dried to obtain a crude white powder, which was further dissolved and purified to obtain compound A. Compound A was dissolved in methanol / water, and a Pd / C catalyst was added. The mixture was stirred in hydrogen, filtered, and lyophilized to obtain a white powder. After dissolution, the powder was allowed to stand with seeds to obtain NTA-NH2. Synthesis of Ce@DMSN: DMSN was centrifuged and then re-dissolved in anhydrous ethanol. NTA-NH2 was added and stirred. After centrifugation, it was redispersed in water. Ammonium cerium nitrate was added and stirred. After high-speed centrifugation, it was redispersed in water to obtain the product Ce@DMSN. Drug loading of Ce@DMSN: Ce@DMSN and IMT1 were dissolved in anhydrous ethanol and dissolved to a certain volume; rotary evaporation was performed, followed by water washing and dilution to a certain volume with water.

2. The preparation method according to claim 1, characterized in that In the preparation of the dendritic mesoporous silicon, the surfactant is a quaternary ammonium salt compound, the catalyst is an alcoholamine compound, the silicon source is a silicate compound, and the organic solvent is cyclohexane.

3. The preparation method according to claim 1, characterized in that In the preparation of NTA-NH2, the amino acid derivative is a benzyloxycarbonyl-protected amino acid, the base is sodium hydroxide, and the halogenated acid is bromoacetic acid.

4. The preparation method according to claim 1, characterized in that In the synthesis of Ce@DMSN, the ligand is a compound containing an iminodiacetic acid group, and the cerium source is ammonium cerium nitrate.

5. The preparation method according to claim 1, characterized in that The drug in the Ce@DMSN is a transcription inhibitor targeting mitochondrial RNA polymerase.

6. Mesoporous silica for inhibiting inflammation, prepared by the method according to any one of claims 1 to 5.

7. The mesoporous silicon according to claim 6, characterized in that The overall diameter of the dendritic mesoporous silicon is between 100 and 200 nm, which is conducive to being endocytosed by cells.

8. The mesoporous silicon according to claim 7, characterized in that The release of cerium ions after being internalized by cells can eliminate free mt-dsRNA. At the same time, IMT1 acts as a mitochondrial transcription-specific inhibitor of mitochondrial RNA polymerase, disrupting mtDNA transcription and reducing the production of mt-dsRNA.

9. A pharmaceutical composition comprising the mesoporous silicon according to claim 6, characterized in that: The pharmaceutical composition further includes a pharmaceutically acceptable carrier.

Images