Antisense oligonucleotides targeting the reduction of xdh gene expression and uses thereof

Abstract

The application discloses an antisense oligonucleotide for targeting and reducing XDH gene expression and application thereof, and belongs to the technical field of biological medicines. The antisense oligonucleotide is mediated by an RNA enzyme H (RNase H) dependent cutting mechanism to degrade target mRNA, and post-transcriptionally knocks down mRNA expression of the XDH gene. Or the antisense oligonucleotide is regulated by a steric hindrance effect to control pre-mRNA splicing, and realizes inhibition of XDH gene expression or selective generation of alternative splicing products at a transcription level. The antisense oligonucleotide molecule has a specific nucleic acid sequence and is combined with chemical modification design, can be targeted and specifically combined with XDH mRNA molecules, promotes degradation of XDH mRNA, inhibits synthesis of XDH protein, thereby reduces the expression level of XDH in cells, reduces synthesis of uric acid, and finally realizes the purpose of reducing uric acid. Through cell experiments and animal model tests, the antisense oligonucleotide molecule has good uric acid reducing effect, long drug efficacy duration and high drug safety.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to antisense oligonucleotides (ASO) for targeting and reducing the expression of XDH gene mRNA and protein, and their application in the treatment of hyperuricemia. Background Technology

[0002] There are currently over 170 million people with hyperuricemia in my country, and the number is increasing year by year. Hyperuricemia (HUA) is a metabolic disorder characterized by abnormally high concentrations of uric acid in the blood. Long-term high uric acid levels, if not controlled in time, can lead to gout, kidney damage, and increase the risk of cardiovascular and cerebrovascular diseases as well as metabolic syndrome. It has now become the fourth major category of metabolic disorders after the "three highs" (hypertension, hyperglycemia, and hyperlipidemia).

[0003] Purine metabolism in the liver is the main pathway for uric acid production. Xanthine oxidoreductase (XOR) in hepatocytes is encoded by the XDH gene and exists in two forms: xanthine dehydrogenase (XDH) or xanthine oxidase (XO). XDH and XO catalyze the conversion of purines to uric acid using different substrates. As a key regulatory enzyme in uric acid synthesis in the body, XOR is also an important drug target for clinical uric acid-lowering treatment. Currently, first-line drugs for treating hyperuricemia, such as febuxostat and allopurinol, work by inhibiting the catalytic activity of XOR, thereby reducing uric acid synthesis levels. However, these small-molecule drugs have adverse reactions and limitations in application. Common adverse reactions include hepatotoxicity and nephrotoxicity, while limitations include short duration of action and a high relapse rate after discontinuation. Summary of the Invention

[0004] To address the shortcomings of the existing technologies, this invention provides an antisense oligonucleotide molecule that targets and reduces XDH gene expression and its application in the preparation of drugs to improve hyperuricemia.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] Antisense oligonucleotides that target and reduce XDH gene expression work by mediating the degradation of target mRNA through an RNase H-dependent cleavage mechanism, thereby knocking down XDH gene mRNA expression at the posttranscriptional level.

[0007] Furthermore, the antisense oligonucleotide comprises a gap region consisting of 10 2'-deoxynucleotides, with wing regions consisting of 5 nucleotides at the 5' and 3' ends, respectively. The nucleotides in the 5' and 3' wing regions are modified with 2'-methoxyethoxy (2'-MOE) sugars, and the nucleotides in the gap region are modified with 2'-deoxyribose. All nucleotides in the gapmer are bonded by phosphate thioester (PS) bonds, and all cytosine residues in all gapmers are 5-methylated.

[0008] The antisense oligonucleotide of the present invention comprises at least one N-acetylgalactosamine (GalNAc) as a targeting ligand for specifically binding to the desialylate glycoprotein receptor (ASGPR). The targeting ligand is located at the 5' or 3' end of the antisense oligonucleotide and is covalently coupled to the oligonucleotide via a chemical linker. The linker is selected from monovalent, divalent, or trivalent branched structures, and the GalNAc ligand is located at the 5' or 3' end of the antisense oligonucleotide.

[0009] The sequence of an ASO targeting the XDH gene provided by this invention is shown in the table below:

[0010] serial number sequence XDH ASO-12 CAGCAGGCAAAGGATACACG

[0011] The ASO molecule described in this invention contains all of the above-mentioned sequence features and chemical modification features.

[0012] The present invention also provides the application of the antisense oligonucleotide in the treatment of hyperuricemia.

[0013] The present invention has the following beneficial effects:

[0014] (1) The antisense oligonucleotides designed in this invention mediate the degradation of target mRNA through RNase H-dependent cleavage mechanism, thereby knocking down the mRNA expression of the XDH gene at the posttranscriptional level and further reducing the XDH protein product at the translational level, thus achieving targeted regulation of XDH gene expression.

[0015] (2) The antisense oligonucleotides designed in this invention contain a targeting ligand with a delivery function, which is used to specifically bind to the desialyl glycoprotein receptor (ASGPR), enhance the hepatocyte targeting of the oligonucleotides, and the number of potential off-target genes predicted by ASO is ≤3.

[0016] (3) The antisense oligonucleotides of the present invention are used to prepare drugs for treating diseases that directly target XDH gene products or pathological conditions related to abnormal or dysfunctional expression of XDH gene, providing a pathway for the treatment of hyperuricemia.

[0017] (4) This invention provides antisense oligonucleotide molecules. Their mechanism of action is that these ASO molecules, using the specific nucleic acid sequences described above and combined with chemical modifications, can target and specifically bind to XDH mRNA molecules, promoting XDH mRNA degradation, inhibiting XDH protein synthesis, thereby reducing XDH expression levels in cells, ultimately decreasing uric acid synthesis and achieving the effect of lowering uric acid. Cell experiments and animal model tests have shown that the ASO molecules of this invention can not only efficiently reduce the expression of the target XDH gene (as shown in Example 1), but also have a good uric acid-lowering effect in vivo (as shown in Example 2), and compared with allopurinol, the duration of efficacy (as shown in Example 3) and drug safety (as shown in Example 4) are significantly improved. Attached Figure Description

[0018] Figure 1 This is a diagram showing the effect of ASO (XDH ASO-12), which targets XDH, on reducing the expression of the target gene XDH in the AML12 mouse hepatocyte line in Example 1 of the present invention.

[0019] Figure 2 This is a graph showing the serum uric acid level measurement in the hyperuricemia mouse model of Example 2 of the present invention;

[0020] Figure 3 This is a graph showing the short-term uric acid-lowering effect of ASO XDH ASO-12 in a mouse model of hyperuricemia, as described in Example 2 of this invention.

[0021] Figure 4 This is a graph showing the long-term uric acid-lowering effect of ASO XDH ASO-12 in a mouse model of hyperuricemia, as described in Example 3 of this invention.

[0022] Figure 5 Anatomical diagrams of the liver and kidneys of mice treated with different doses of XDH ASO-12, febuxostat, and allopurinol in Example 4 of this invention.

[0023] Figure 6 This is a schematic diagram showing the changes in body weight of mice treated with different doses of XDH ASO-12, febuxostat, and allopurinol in Example 4 of the present invention.

[0024] Figure 7 The graphs show the detection results of kidney and liver function indicators in mice treated with different doses of XDH ASO-12, febuxostat, and allopurinol in Example 4 of the present invention. In the graphs, A represents the detection results of the kidney function indicator CRE2, and B represents the detection results of the liver function indicator AST. Detailed Implementation

[0025] The XDH ASO-12 molecules used in Examples 1-4 were synthesized strictly according to their sequence and chemical modification characteristics.

[0026] Example 1: Validation of the ability of cell line XDH ASO-12 to reduce the expression of the target gene XDH in vitro.

[0027] Step 1: Cell Culture and ASO Transfection

[0028] Cell culture: AML12 cells (normal mouse hepatocyte line) were seeded into 12-well plates, and 1 mL of complete culture medium (containing 10% fetal bovine serum) was added to each well. The culture conditions were 37°C and 5% CO2, and the cells were cultured in a carbon dioxide incubator until the cell density reached 70%-80%.

[0029] ASO transfection: Using Lipofectamine 2000 transfection reagent in cell lines, ASO targeting XDH (50 / 100 / 150 nM) was mixed with liposome transfection reagent according to the manufacturer's instructions. A negative control group (transfected with ASO not targeting any gene sequence), a blank control group (no ASO transfection), and a positive siRNA control group (siRNA sequences reported in the literature to have a clear effect on knocking down XDH expression) were set up. The transfection procedure is as follows:

[0030] (1) Add 50 μL of opti-MEM serum-free medium to a 1.5 mL sterile centrifuge tube, add 2 μL of LExFect, vortex to mix, and let stand for 3 minutes; (2) Add 50 μL of opti-MEM to a 1.5 mL sterile centrifuge tube, add an appropriate amount of ASO (final transfection concentration of 50 / 100 / 150 nM), vortex to mix, and let stand for 3 minutes; (3) Add ExFect-opti-MEM dropwise to ASO-opti-MEM, vortex to mix, let stand at room temperature for 15 minutes, and then use for transfection; (4) Add the ExFect / ASO complex mixture dropwise to the medium, and gently shake the culture dish to disperse ExFect / ASO evenly; (5) Incubate overnight for 24 h; (6) Collect cells, extract RNA, and perform subsequent experiments.

[0031] Step 2: Use quantitative real-time PCR to detect the knockdown effect of the target gene XDH at the mRNA level.

[0032] qPCR detection of target mRNA expression: Total RNA was extracted from cells (using TRIzol reagent), and cDNA was synthesized by reverse transcription (using a reverse transcription kit). The expression level of XDH mRNA was detected using qPCR. Primer sequences are as follows:

[0033] XDH (target gene) detection primers: forward 5'-TAGAAGAAAGTTGGGGCTGTGCG-3', reverse 5'-CAGATGGGGGTCAAGCAGGCA-3';

[0034] GAPDH (internal reference gene) detection primers: forward 5'-CATCACTGCCACCCAGAAGACTG -3', reverse 5'-ATGCCAGTGAGCTTCCCGTTCAG -3'.

[0035] Reaction conditions: 95°C pre-denaturation for 30 seconds, 95°C denaturation for 10 seconds, 60°C annealing for 30 seconds, instrument default settings, for a total of 40 cycles;

[0036] The results are as follows Figure 1 As shown, the X-axis of the bar chart indicates the experimental groups, namely: (1) Blank, blank experimental group, cells were cultured normally without additional treatment; (2) NC, negative control group, cells were treated with ASO molecules at three different final concentrations (50nM, 100nM, 150nM) that did not target any gene sequence; (3) ASO-12 experimental group, cells were treated with ASO-12 molecules at three different final concentrations (50nM, 100nM, 150nM); (4) siRNA, positive control group, cells were treated with siRNA that was published in the literature and clearly could effectively reduce XDH expression. The Y-axis of the bar chart indicates the relative expression level of XDH mRNA.

[0037] Real-time quantitative PCR analysis showed that, compared with the blank control (cells without any treatment) or the negative control group (NC group, i.e., cells treated with an ASO sequence that does not target any gene), the expression level of XDH mRNA was reduced after treatment with XDH ASO-12, which targets XDHASO. This finding provides strong experimental evidence for the application of XDH-targeting ASO in the treatment of hyperuricemia. Experiments demonstrate that the ASO-12 of this invention effectively blocks the translation process of XDH by specifically binding to XDH mRNA, thereby reducing the synthesis of XDH protein.

[0038] Example 2: Validation of the short-term uric acid-lowering function of ASO (XDH ASO-12) in a hyperuricemic mouse model.

[0039] Step 1: Establishment of an animal model of hyperuricemia and administration of ASO (code XDH ASO-12)

[0040] (1) Adaptive feeding of animals: The experimental mice (strain: C57BL / 6, male, 8 weeks old) were adapted to feeding under standard feeding conditions for 1 week to ensure stable health status;

[0041] (2) Drug preparation:

[0042] a. Potassium oxazine: 200 mg / mL, dissolved in 0.5% sodium carboxymethyl cellulose solution;

[0043] b. Hypoxanthine: 100 mg / mL, dissolved in 0.5% sodium carboxymethyl cellulose solution;

[0044] (3) Model building and grouping:

[0045] c. Blank control group: 0.5% sodium carboxymethyl cellulose solution (150 μL) was administered by gavage for the first time, and the same solution (150 μL) was administered by gavage for the second time 2 hours later.

[0046] d. Modeling group: Initially administered hypoxanthine solution (100 mg / mL, 150 μL) by gavage, followed by potassium oxonate solution (200 mg / mL, 150 μL) by gavage 2 hours later. Modeling continued until the end of treatment.

[0047] (4) Model validation

[0048] Nine days after modeling, orbital blood was collected from mice to detect serum uric acid levels. After confirming that the serum uric acid level in the model group was significantly higher than that in the blank control group, the next step of drug administration was carried out.

[0049] (5) Different groups of drugs were administered.

[0050] e. Experimental group: ASO-12 targeting XDH was administered at doses of 15, 10, and 5 mg / kg (finally dissolved in 100 μL of physiological saline) and injected into mice via the tail vein 9 days after modeling.

[0051] f. Negative control group: physiological saline, dose 100 μL / mouse, injected into mice via tail vein 9 days after modeling.

[0052] g. Positive control group: Allopurinol, dose of 25 mg / kg, administered by gavage once daily for 5 days after modeling, 7 hours after modeling.

[0053] h. Blank control group: The group that did not undergo the high uric acid model treatment.

[0054] Step 2: Serum uric acid level test:

[0055] Five days after administration, orbital blood was collected from mice, serum was separated, and uric acid levels were measured using a fully automated biochemical analyzer to simulate the effect of short-term administration in lowering uric acid.

[0056] like Figure 2As shown, the X-axis of the bar chart indicates the experimental groups, namely the non-modeling group and the modeling group; the Y-axis indicates the serum uric acid level of mice (unit: μmol / L). *** indicates that there is a statistically significant difference in serum uric acid values ​​between the modeling group and the non-modeling group, p < 0.001; after modeling by processing in steps (1), (2), (3), and (4) of step 1, the serum uric acid value of the modeling group mice was significantly higher than that of the non-modeling group (P < 0.001), indicating that the hyperuricemia mouse model was successfully established.

[0057] like Figure 3 As shown, the X-axis of the bar chart indicates the experimental groups, namely: (1) blank control group without modeling, mice were fed normally without drug stimulation to induce modeling; (2) negative control group, mice were gavaged with physiological saline after modeling; (3) ASO experimental group, mice were treated with three doses (5 / 10 / 15 mg / kg) of ASO-12 targeting XDH after modeling; (4) positive control group, mice were treated with allopurinol after modeling. ** and *** indicate that there are statistically significant differences in serum uric acid values ​​between the two comparison groups, where **P<0.01; ***P<0.001. Different doses (5 / 10 / 15 mg / kg) of ASO designated as XDH ASO-12 can effectively reduce the uric acid level of hyperuricemic mice and restore it to normal. The results show that in the short term (5 days after administration), different concentrations (5, 10, 15 mg / kg) of ASO targeting XDH can significantly reduce the serum uric acid level of hyperuricemic mice. This result indicates that ASO targeting XDH can effectively intervene in the uric acid metabolism pathway and reduce uric acid production, thus playing an important role in the treatment of hyperuricemia.

[0058] Example 3: ASO product XDH ASO-12 was able to maintain a long-lasting uric acid-lowering effect in hyperuricemic mice.

[0059] Because small molecule chemical drugs such as allopurinol have a short duration of action and uric acid levels tend to rebound after drug withdrawal, this embodiment uses a hyperuricemic mouse model to detect the changes in uric acid levels of ASO-12 compared to allopurinol over a period of time after drug withdrawal.

[0060] The specific experimental procedures are as follows: Step 1: Establishment of the hyperuricemia animal model and administration of ASO, same as Step 1 in Example 2. Step 2: After completing the administration procedure, stop administration (ASO or allopurinol). All model mice continue to be stimulated with potassium oxonate / hypoxanthine for 28 days to simulate the scenario of long-term drug withdrawal after a period of medication in patients. Step 3: Detection of serum uric acid levels, same as Step 2 in Example 2.

[0061] like Figure 4As shown, the X-axis of the bar chart indicates the experimental groups, namely: (1) blank control group without modeling, mice were fed normally without drug stimulation to induce modeling; (2) negative control group, mice were gavaged with physiological saline after modeling; (3) ASO experimental group, mice were treated with ASO-12 targeting XDH after modeling, and the results were measured 28 days after administration; (4) positive control group, mice were treated with allopurinol after modeling, and the results were measured 28 days after administration. * and *** indicate that there are statistically significant differences in serum uric acid values ​​between the pairwise comparison groups, where *P<0.05; ***P<0.001.

[0062] In a mouse model of hyperuricemia, serum uric acid levels rebounded to hyperuricemic levels 28 days after administration of allopurinol and subsequent withdrawal. In contrast, serum uric acid levels remained normal 28 days after administration of ASO-12 (a drug targeting XDH). This result indicates that ASO-12, targeting XDH, significantly outperformed allopurinol in maintaining the therapeutic effect.

[0063] Example 4: The ASO designated XDH ASO-12 has good security.

[0064] This embodiment uses a gradient dose administration experiment to evaluate the safety of ASO-12 in mice, thereby verifying its clinical application as a potential therapeutic agent.

[0065] The specific steps are as follows:

[0066] Step 1: Experimental grouping and drug treatment

[0067] 1. Animal acclimatization feeding: After arrival, the experimental mice (C57BL / 6, male, 8 weeks old) were acclimatized for 1 week under standard feeding conditions to ensure stable health status.

[0068] 2. Experimental grouping and drug treatment:

[0069] a. Experimental group: ASO targeting XDH, at doses of 1, 5, and 10 mg / kg / animal (dissolved in 100 μL of physiological saline), administered once via tail vein injection.

[0070] b. Negative control group: 100 μL / animal saline, injected once via tail vein.

[0071] c. Positive control group: Allopurinol, at doses of 25, 125, and 250 mg / kg / animal (dissolved in 100 μL of 3dH2O); Febuxostat, at doses of 20, 100, and 200 mg / kg / animal (dissolved in 200 μL of 0.5% sodium carboxymethyl cellulose solution), both drugs were administered by gavage once daily.

[0072] Step 2: Dynamic monitoring of physiological indicators:

[0073] 1. Weight changes: The mice were weighed at a fixed time every other day (11:00 AM).

[0074] 2. Liver and kidney function indicators: Blood was collected from the eyeballs of mice on days 10 and 14 after drug administration, and serum was separated. AST (a marker of liver injury) and CRE (a key marker of kidney injury) were detected using a biochemical analyzer.

[0075] like Figure 5-7 As shown, healthy mice were treated with physiological saline and low, medium, and high doses of ASO-12, allopurinol, and febuxostat, respectively. Liver and kidney organ function was then assessed. Figure 5 ),weight( Figure 6 ), kidney injury marker CRE2 ( Figure 7 A) Liver injury marker AST ( Figure 7 B) Indicators.

[0076] Commonly used uric acid-lowering drugs (allopurinol, febuxostat) all showed varying degrees of weight loss or nephrotoxicity (mainly manifested as acute kidney injury, abnormal tissue anatomy, or abnormal CRE markers of kidney injury) under high-dose treatment in experimental conditions. This result is basically consistent with the instructions for use of the relevant drugs, which also indicates that such drugs are not suitable for long-term use. However, the ASO-12 targeting XDH of this invention, through precise regulation of target expression, maintains the intervention effect of uric acid metabolism without causing significant metabolic disorders or organ damage, and has a safe profile, providing key experimental evidence for its clinical translation.

[0077] This invention provides an antisense oligonucleotide (ASO) and a prepared drug for inhibiting hyperuricemia. In in vitro cultured cell lines and hyperuricemia mouse models, the ASO targeting XDH effectively reduces XDH gene expression levels, thereby intervening in the uric acid metabolism pathway and reducing uric acid production. Therefore, this invention is expected to provide a new approach for the treatment of hyperuricemia, playing an important role in the treatment of hyperuricemia and promoting the application of antisense oligonucleotide technology in the treatment of metabolic diseases. The hyperuricemia-inhibiting drug of this invention has broad application prospects for adjunctive treatment of hyperuricemia.

Claims

1. An antisense oligonucleotide targeted to reduce expression of an XDH gene, characterized in that: The sequence of the antisense oligonucleotide is shown as SEQ ID NO:

12.

2. A composition capable of reducing the expression of XDH gene, comprising the antisense oligonucleotide of claim 1 and a pharmaceutically acceptable carrier.

3. Use of the antisense oligonucleotide of claim 1 in the preparation of a drug for reducing the expression of XDH gene.

4. Use of the antisense oligonucleotide of claim 1 or the composition of claim 2 in the preparation of a drug for treating hyperuricemia.

Images