BPM6, a disease susceptibility gene in cabbage, and its application in disease-resistant breeding of cabbage.

Abstract

The present invention relates to the cabbage disease susceptibility gene BPM6 and its application method in cabbage disease resistance breeding, which belongs to the field of biological breeding technology and includes the following steps: (1) gene editing of the BPM6 gene in the target cabbage material, knocking out or inactivating the gene; the nucleotide sequence of the cabbage disease susceptibility gene BPM6 is shown in Seq ID No.1; (2) screening cabbage materials with the BPM6 gene edited for regeneration culture to obtain cabbage germplasm materials with improved disease resistance.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to cabbage disease susceptibility genes. BPM6 And its application in disease-resistant breeding of cabbage. Background Technology

[0002] Brassica oleracea It is an important biennial herbaceous species in the Brassicaceae family. According to statistics, 3.77 million hectares of Brassicaceae crops, such as cabbage, broccoli and cauliflower, are cultivated globally, constituting an important agricultural resource (Li et al., 2021).

[0003] With the changing consumer demand, the area of ​​facility cultivation and off-season cultivation has been expanding year by year, which has put forward higher requirements for cabbage varieties. For example, in terms of disease resistance, the north mainly requires resistance to black rot, viral diseases, downy mildew and dry heart, while the south mainly requires resistance to black rot, clubroot, soft rot and sclerotinia (see reference: Si Jun, Li Chengqiong, Ren Xuesong. Research progress and prospect of disease-resistant cabbage breeding in my country. Northern Horticulture, 2001(1):10~12).

[0004] Molecular breeding is an ideal method for disease-resistant breeding, provided that genes related to disease susceptibility are developed and obtained.

[0005] Gene editing technology is a highly efficient molecular breeding technique. In recent years, CRISPR / Cas9 technology has been widely applied to major crops such as rice, wheat, and potatoes. This technology can suppress gene expression to develop high-yielding, disease-resistant, or stress-tolerant crops (Gao, 2021; He et al., 2022). However, currently, cabbage... B. oleracea The low regeneration efficiency of Agrobacterium-mediated transformation limits its efficiency to below 1.0%, thus affecting the efficiency of CRISPR / Cas9 gene editing. Compared to the editing efficiency of 68% in rice, the editing efficiency of cabbage is only 12.9% (Li et al., 2021). Therefore, it is necessary to improve gene editing technology to facilitate its application in the breeding of highly disease-resistant cabbage. Summary of the Invention

[0006] In view of the needs and current status of this field, the inventors, based on their research findings, are requesting protection for the cabbage disease susceptibility gene. BPM6 Its application in disease-resistant cabbage breeding is as follows:

[0007] In a first aspect, protection is sought for a cabbage susceptibility gene. BPM6 The artificial sequence is shown in SeqID No. 27.

[0008] A second aspect of the invention claims protection based on the said cabbage susceptibility gene. BPM6 A method for breeding disease-resistant cabbage, characterized by the following steps:

[0009] (1) For the target cabbage material BPM6 Gene editing is performed to knock out or inactivate the gene, or to suppress its expression; the aforementioned cabbage susceptibility gene. BPM6 The nucleotide sequence is shown in Seq ID No. 47;

[0010] (2) Screening cabbage materials with BPM6 gene edited for regeneration culture to obtain cabbage germplasm materials with improved disease resistance.

[0011] Preferably, the method is characterized in that the gene editing refers to the introduction of a CRISPR / Cas9 gene editing vector into the target cabbage material;

[0012] The sgRNA sequence of the CRISPR / Cas9 gene editing vector is taken from the coding region sequence of the BPM6 gene, as shown in Seq ID No. 48.

[0013] Preferably, the method is characterized in that the sgRNA sequence of the CRISPR / Cas9 gene editing vector is as shown in Seq ID No. 49.

[0014] Preferably, the method is characterized in that the PAM sequence of the CRISPR / Cas9 gene editing vector is 5'-NGGT-3', wherein N is one of A, C, and G.

[0015] Preferably, any of the above methods is characterized by further comprising introducing an expression vector for the fusion protein GRF5-GIF1-GRF5 while performing gene editing on the target cabbage material;

[0016] The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is as follows (1) or (2):

[0017] (1) From the N to the C end, the GRF5-1 peptide shown in Seq ID No.33, the GIF1 peptide shown in Seq ID No.37, and the GRF5-2 peptide shown in Seq ID No.34 were linearly fused; the peptides were linked by 3 to 5 alanine residues.

[0018] (2) From the N to the C end, its amino acid sequence is obtained by linear fusion of the GRF5-2 peptide shown in Seq ID No.34, the GIF1 peptide shown in Seq ID No.37, and the GRF5-1 peptide shown in Seq ID No.33; the peptides are linked by 3 to 5 alanine residues.

[0019] Preferably, the amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is shown in Seq ID No. 38, and its coding sequence is shown in Seq ID No. 41.

[0020] In another aspect, protection is claimed for cabbage material with the BPM6 gene edited using any of the methods described in claim 1, wherein the cabbage material refers to cells and / or tissues.

[0021] Another aspect of the present invention claims protection for a CRISPR / Cas9 gene editing vector, characterized in that the sgRNA sequence therein is derived from the coding region sequence of the BPM6 gene as shown in Seq ID No. 48.

[0022] Preferably, the gene editing vector is characterized in that the sgRNA sequence is as shown in Seq ID No. 49.

[0023] Preferably, the gene editing vector is characterized in that its PAM sequence is 5'-NGGT-3', where N is one of A, C, or G.

[0024] This invention amplifies the cabbage disease susceptibility gene BPM6 (Seq ID No. 47) in cabbage, and suppresses the expression of the BPM6 gene using gene editing methods. This invention yields transgenic cabbage material with significantly enhanced disease resistance compared to the cabbage variety M1. bobpm6 The disease indices of plants inoculated with Fusarium wilt, black rot, and clubroot decreased significantly from 65.4 to 14.5, from 53.8 to 20.9, and from 63.1 to 55.7, respectively. Figure 6 .

[0025] Based on the characteristics of this gene, the most important aspect of this invention is to provide the application of the aforementioned cabbage disease-susceptibility gene BPM6 in disease-resistant breeding, that is, to obtain cabbage materials in which the BPM6 gene has been edited, thereby suppressing the expression of the BPM6 gene, through gene editing methods, and to obtain new varieties with broad-spectrum disease resistance by breeding these materials.

[0026] This invention also improves gene editing and genetic transformation methods. Experimental data show that selecting 'T' after the 5'-NGG-3' sequence in the CRISPR / Cas9 vector significantly increases the number of editing types and improves editing efficiency in the CRISPR / Cas9 gene editing system; expression of the fusion protein GRF5-GIF1-GRF5 increases the average regeneration efficiency of cabbage by 55.2%. These technological improvements enable the efficient application of the cabbage disease susceptibility gene BPM6 in disease-resistant breeding. Attached Figure Description

[0027] Figure 1 This invention presents a schematic diagram of the structure of a PDS gene editing vector constructed to study the effects of different PAM sequences on gene editing efficiency and types.

[0028] Figure 2 Experimental results on the effects of different PAM sequences on the efficiency and type of gene editing in rice, among which,

[0029] The top figure shows rice plants where the OsPDS gene was knocked out using NGGN and NGGT PAM sequences, with red circles indicating plants that did not undergo gene editing; the bottom figure shows the rice OsPDS gene editing efficiency (bar chart) and editing type (line chart).

[0030] Figure 3 Experimental results on the effects of different PAM sequences on gene editing efficiency and type in cabbage, among which,

[0031] The top graph shows the knockout of the BoPDS gene using NGGN and NGGT as PAM sequences, with Mock representing cabbage plants that did not undergo gene editing; the bottom graph shows the gene editing efficiency (bar graph) and editing type (line graph) of cabbage.

[0032] Figure 4 This invention presents the results of a study on the effects of growth condition factors on genetic transformation and regeneration efficiency. Specifically, the treatment expressing the GRF5-GIF1-GRF5 fusion protein increased the average regeneration efficiency of cabbage by 55.2%.

[0033] Figure 5 The diagram illustrates the structure of the BoBPM6 gene cloned in this invention and the gene editing process, wherein...

[0034] Light pink represents the gene coding region (exon), dark pink represents the intron region, and the red short underline target 1 at the bottom of the first exon region represents the sgRNA target region; the nucleotide sequence below represents target region 1, of which the wild-type target nucleotide sequence is shown underlined, and the other four are from the T0 generation mutant that has undergone gene editing. Blue broken lines represent deletions, and yellow letters represent insertions; ACCG before the target site represents the PAM sequence.

[0035] Figure 6 This shows the occurrence of BoBPM6 gene editing. bobpm6 The results of the disease resistance study of the plants showed that the disease index of inoculated plants with Fusarium wilt, black rot and clubroot decreased significantly from 65.4 to 14.5, from 53.8 to 20.9, and from 63.1 to 55.7. Detailed Implementation

[0036] The present invention will be further described below with reference to specific implementation methods and accompanying drawings, but the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods in the art, and the reagents used are commercially available.

[0037] Experimental materials used in this study:

[0038] The rice genetic transformation material used in this experiment was Nipponbare.

[0039] The cabbage variety 'M1' is an inbred line material, which the applicant's organization has preserved and can provide for verification experiments;

[0040] The CRISPR / Cas9 vector used for rice is pVS1, purchased from Addgene™.

[0041] The CRISPR / Cas9 vector used for cabbage was pYLCRISPR / Cas9-35S-B, purchased from Addgene. TM ;

[0042] Example 1. Construction of CRISPR / Cas9 editing vectors and the effect of PAM sequences on gene editing efficiency and editing type.

[0043] The inventors observed in their research that Cas9 (ScCas9) from *Streptococcus canis* requires a spacer adjacent motif (PAM) sequence such as 5'-NNG-3', after which any base can be selected; however, editing efficiency is higher when the base following the PAM sequence is "T". http: / / crispor.tefor.net / ).

[0044] To test whether the "T" after the SpCas9 PAM sequence could enhance the editing efficiency of CRISPR / Cas9 technology, the inventors constructed CRISPR / Cas9 gene editing vectors (OsPDS and BoPDS) for rice and cabbage, respectively, to knock out the phytoene dehydrogenase gene PDS.

[0045] S1. Construction of PDS gene editing vector

[0046] To construct cabbage and rice knockout PDS The vectors were edited, and 5'-NGGN-3' and 5'-NGGT-3' were selected as the PAM sequences for rice and cabbage, respectively, where 'N' represents the three bases other than 'T'.

[0047] Based on the selected target sites and PAM sequences, target introduction sequence sgRNAs and their adapter primers were designed (Table 1), synthesized, and ligated into the pVS1 rice PDS gene editing vector. OsPDSSimilarly, based on the selected target sites and PAM sequences, target introduction sequence sgRNAs and their adapter primers were designed (Table 2). After synthesis, they were ligated into the pYLCRISPR / Cas9-35S-B(Bol) vector to obtain the cabbage PDS gene editing vector. BoPDS ;

[0048] A schematic diagram of the CRISPR / Cas9 construct is shown below. Figure 1 As shown: Figure A: Schematic diagram of the CRISPR / Cas9 construct OsPDS used for PDS editing in rice; NGGN (N1-N3) and NGGT (T1-T3) represent the locations of the target sites. Figure B: Schematic diagram of the CRISPR / Cas9 construct BoPDS used for PDS editing in cabbage; NGGN (N1-N2) and NGGT (T1-T2) represent the locations of the target sites.

[0049] Table 1. Rice PDS gene sgRNA sequence

[0050]

[0051] Table 2. sgRNA sequence of the PDS gene in cabbage

[0052]

[0053] The impact of S2.5'-NGGT-3' PAM sequence on CRISPR / Cas9 editing efficiency and the diversity of editing types.

[0054] The rice editing vector OsPDS and the cabbage editing vector BoPDS constructed from S1 were introduced into the rice variety Nipponbare and the cabbage variety M1 respectively through Agrobacterium-mediated genetic transformation.

[0055] Transform Agrobacterium according to standard procedure: Add 1 μg of plasmid to 100 μl of competent Agrobacterium cells, mix well, and then incubate on ice, in liquid nitrogen, at 37°C, and on ice for 5 min each time. Add 800 μl of LB liquid medium (antibiotic-free) and incubate at 200 rpm and 28°C with shaking for 3 hours. Centrifuge at 5000 rpm for 1 minute, discard part of the supernatant, gently aspirate the remaining bacterial cells, and spread them onto LB solid medium containing kanamycin and rifampin. Incubate upside down at 28°C for 2-3 days to obtain Agrobacterium plasmids containing the PDS gene editing vectors BoPDS and OsPDS.

[0056] Rice genetic conversion is a well-known technique in the field, and the following is an example operation.

[0057] Co-culture stage: Dilute the Agrobacterium cultured in advance on AB medium with AAM liquid medium containing an appropriate amount of AS to about 0.2 OD600 to start the co-culture stage. Co-culture the diluted bacterial solution with the pre-cultured vigorous rice callus tissue for 3 days.

[0058] Screening and Culture Stage: After co-culturing, the callus tissue is thoroughly cleaned with pre-sterilized antibiotic-containing Tm-containing sterile water and air-dried at room temperature. All of the above operations should be performed under sterile conditions in a laminar flow hood. Once completely dried, the callus tissue is transferred to a screening medium supplemented with an appropriate amount of antibiotics using forceps. The medium is changed approximately every 10 days under light. Screening is performed using a gradient of decreasing antibiotic concentrations, repeating approximately 2-3 times.

[0059] Differentiation stage: The selected callus tissue with good activity is transferred to the differentiation medium. The callus tissue with good activity will gradually turn green and differentiate into seedlings.

[0060] Rooting stage: Transfer rice seedlings with a small amount of callus tissue to a rooting culture medium and culture them under light for about 2 weeks until most roots have grown.

[0061] Genomic DNA was extracted from rice seedlings, and resistance primers were used to identify the transformed seedlings. Positive rice lines were initially screened out and then further identified after being transplanted to the field.

[0062] The genetic conversion of cabbage is a well-known technique in the field, and the following is an example operation.

[0063] (1) Obtaining cabbage explants

[0064] Select mature, plump, and round cabbage seeds free of mold and disease spots. Disinfect the seeds with 75% alcohol for 3 minutes, then with 8-10% sodium hypochlorite solution for 8-10 minutes. Rinse three times with sterile water. After sterilization, blot off excess water using sterile filter paper in a laminar flow hood and arrange the seeds evenly on solid MS medium. Incubate for 5-7 days under 16h light / 8h dark conditions. Cut the cabbage hypocotyls into 0.8-1cm lengths to serve as recipients for Agrobacterium-mediated transformation.

[0065] (2) Genetic transformation of cabbage

[0066] Agrobacterium plasmids containing the PDS gene editing vector were cultured to OD600 = 0.4-0.6, centrifuged at 6000 rpm for 10 minutes, and then resuspended in liquid MS medium as the infection solution.

[0067] Infect cabbage explants for 8-10 minutes, then incubate in a co-culture medium at 25°C in the dark for 36-48 hours. Subsequently, transfer the explants to a selection medium containing 10 mg / L Basta, and maintain a 16-hour light / 8-hour dark cycle, changing the selection medium every two weeks. Once resistant shoots reach approximately 2-3 cm in length, cut them off and transfer them to a seedling growth medium containing termethin, and culture for 20-30 days under a 16-hour light / 8-hour dark cycle. Then, culture them in a rooting medium for 20 days. Plants with well-developed root systems are then transferred to vermiculite for 7 days to harden off before transplanting into potting soil.

[0068] After PCR amplification using Bar primers, T0 generation positive plants were obtained by detection using 1.0% agarose gel electrophoresis.

[0069] The Bar primer sequences are as follows:

[0070] BarH-F: 5'-AAACCCACGTCATGCCAGTT-3'; SEQ ID No. 31

[0071] BarH-R: 5'-GTCTGCACCATCGTCAACCAC-3'; SEQ ID No. 32

[0072] The selected T0 generation positive plants were subjected to first-generation high-throughput sequencing, and the sequencing results were statistically analyzed.

[0073] The results show:

[0074] For rice, knockout OsPDS Among positively edited rice plants, the average increase in editing type using 'NGGT' compared to 'NGGN' was 28.6%; the average increase in editing efficiency was 13.8%. Figure 2 (and Table 3).

[0075] Table 3. Statistical data on rice gene editing types and efficiency using different PAM sequences.

[0076]

[0077] For cabbage, knockout BoPDS The positively edited cabbage plants exhibited an albino phenotype, with 'NGGN' edited plants essentially showing a chimeric appearance; 'NGGT' showed a higher degree of editing on cabbage plants compared to 'NGGN, and the editing efficiency increased from an average of 20.4% to an average of 68.7%, such as... Figure 3 As shown in Table 4.

[0078] Table 4. Statistics on gene editing types and efficiency in cabbage

[0079]

[0080] Results in rice and cabbage showed that selecting 'T' after 5'-NGG-3' of the PAM sequence significantly increased the number of editing types and improved the editing efficiency of the CRISPR / Cas9 gene editing system.

[0081] Example 2. Fusion expression of GRF5-GIF1-GRF5 on cabbage B. oleracea Impact of regeneration efficiency

[0082] The vector used in the genetic system experiments was a modified pCAMBIA1301 vector (purchased from Addgene). TM The empty vector pBWA(V)BS-Empty replaces the Hyg resistance in the original vector with Basta resistance.

[0083] The experimental material was the cabbage inbred line 'M1'.

[0084] Studies have found that overexpression of certain plant growth regulators can significantly improve plant regeneration efficiency in transgenic tissue culture (Debernardi et al., 2020).

[0085] Through bioinformatics analysis, the research team of this invention identified 19 growth regulatory factor (GRF) proteins and 1 GRF interaction factor (GIF) protein in the cabbage genome.

[0086] Further studies were conducted on two GRF5 proteins, two GRF4 proteins, and one GIF1 protein. Two GRF5 proteins (Seq ID No. 33 and Seq ID No. 34) and two GRF4 proteins (Seq ID No. 35 and Seq ID No. 36) were fused with GIF1 protein (Seq ID No. 37) through a four-alanine residue linking to express GRF5-GIF1-GRF5 (Seq ID No. 38 or Seq ID No. 39) and GRF4-GIF1-GRF4 (Seq ID No. 40), respectively.

[0087] The effects of four proteins (GRF5-GIF1-GRF5, GRF4-GIF1-GRF4, GRF5, and GIF1) and a blank control on the regeneration efficiency of cabbage were tested, see [link to study]. Figure 4 The nucleotide sequences (Seq ID No. 41~44) encoding four proteins were constructed into the expression vector pBWA(V)BS-Empty and introduced into the cabbage variety M1 via Agrobacterium-mediated genetic transformation.

[0088] The genetic transformation operation is the same as S2 in Example 1.

[0089] The results showed that the average regeneration efficiency of the cabbage transformant expressing GRF5-GIF1-GRF5 was increased by 55.2%. Figure 4 .

[0090] Table 5 shows the nucleotide or amino acid sequences involved in the examples.

[0091]

[0092] Example 3 Gene BoBPM6 The discovery and cloning of [genes], and the construction of gene-editing vectors.

[0093] The inventors discovered a new differentially expressed gene in cabbage during their research. BTB / POZ (Broad complex , Tramtrack , Bric-a-brac / Pox virus and Zinc finger)-MATH 6 ( BPM6 This gene is induced by wilt and black rot, suggesting that it may be a susceptibility gene that induces the onset of various diseases.

[0094] To test whether the gene could be used to generate broad-spectrum disease resistance in cabbage, the inventors constructed a gene-editing vector to knock it out.

[0095] By designing primers (Table 6)

[0096] Table 6

[0097]

[0098] Using DNA from cabbage variety M1 as a template, the BPM6 genome fragment, BoBPM6, was obtained from cabbage. The fragment is 3526 bp in length (Seq ID No. 47). Its coding region consists of 2326 bp (Seq ID No. 48), and the sequence is shown in Table 7.

[0099] i. Constructing the CRISPR / Cas9 editing platform for BoBPM6:

[0100] (1) pYLCRISPR / Cas9-35S-B(Bol) was selected as the gene editing vector framework;

[0101] (2) 5'-'NGGT'-3' was selected as the PAM sequence for the cabbage BPM6 editing vector;

[0102] (3) Subsequently targeting BoBPM6The following sgRNA and its adapter primers were designed:

[0103] BoBPM6 sgRNA: CTCCAAGTCCGTGACGCAGA CGG, Seq ID No. 49, see Figure 5

[0104] BB6-F:cagtGGTCTCatgca CTCCAAGTCCGTGACGCAGAG ttttaga, Seq ID No. 50

[0105] BB6-R:cagtGGTCTCaaaac TCTGCGTCACGGACTTGGAG Seq ID No. 51

[0106] After the synthesized adapter primers were annealed to double strands, they were digested and ligated into the pYLCRISPR / Cas9-35S-B vector to obtain... BoBPM6 Gene editing vectors.

[0107] Example 4. BoBPM6 gene editing in cabbage materials

[0108] The BPM6 gene editing vector constructed in Example 3, together with the expression vector of the GRF5-GIF1-GRF5 fusion protein (Seq ID No. 38) constructed in Example 2, were co-transformed into the cabbage variety M1 via Agrobacterium-mediated genetic transformation.

[0109] Transform Agrobacterium according to the standard procedure: Add 1 μg of plasmid to 100 μl of competent Agrobacterium cells, mix well, and then incubate on ice, in liquid nitrogen, in a 37°C water bath, and on ice for 5 min each. Add 800 μl of LB liquid medium (antibiotic-free) and incubate at 200 rpm and 28°C with shaking for 3 hours. Centrifuge at 5000 rpm for 1 minute, discard part of the supernatant, gently aspirate the remaining supernatant to mix the cells, and spread it onto LB solid medium containing kanamycin and rifampin. Incubate upside down at 28°C for 2-3 days.

[0110] The genetic transformation method is the same as S2 in Example 1.

[0111] The selected T0 generation positive plants were subjected to first-generation sequencing. bobpm6 The conversion efficiency was 5.5%; the editing efficiency was 62.0%.

[0112] Where conversion efficiency = number of positive plants / number of infected explants;

[0113] Editing efficiency = Number of plants edited / Number of positive plants.

[0114] The conversion efficiency was significantly higher than the 1% cabbage conversion efficiency and 12.9% editing efficiency reported in existing literature.

[0115] T1 generation seeds were obtained through self-pollination and seed saving. First-generation sequencing was performed on randomly selected seeds. The results showed... bobpm6 Get 3 editing types ( Figure 5 ).

[0116] Example 5. Disease resistance test of BoBPM6 gene-edited materials

[0117] The T1 generation of cabbage obtained in Example 4 was inoculated with wilt, black rot and clubroot pathogens (the three main diseases of cabbage).

[0118] Black rot is treated by artificial inoculation using a spray method:

[0119] (1) Preparation of bacterial suspension: The preserved black rot pathogen ( Xanthomonas campestris pv. Campestris The black rot pathogen was activated by streak plating, and the activated pathogen was added to liquid PSA medium in the form of a clump using an inoculation loop. The medium was then incubated in the dark for 16 hours at 28°C and 200 rpm in a shaker. The OD was adjusted using sterile water. 600 Once the value is 0.2, prepare for vaccination.

[0120] (2) Inoculation process: Once the seedlings have grown to 4-5 true leaves, they can be prepared for inoculation. One day before inoculation, move the seedlings to the inoculation site, thoroughly water the seedling substrate, and spray the leaves with water using a sprayer. Cover with a film to maintain moisture until inoculation, ensuring that the film contains more than 90% moisture so that the water pores on the leaf edges are open before inoculation. Use a sprayer to evenly spray the bacterial solution onto the leaves until the leaves are completely covered with the bacterial solution. Control the temperature at around 28℃.

[0121] (3) Resistance survey and resistance level classification: Resistance evaluation criteria: Grade 0, no symptoms on inoculated leaves; Grade 1, less than 5% of leaf area; Grade 3, 5-15% of leaf area; Grade 5, 15-30% of leaf area; Grade 7, 30-50% of leaf area; Grade 9, greater than 50% of leaf area. DI = Σ (number of diseased leaves × extreme value of the disease) / (total number of investigated leaves × highest disease grade) × 100. Highly resistant (HR), 0 < DI ≤ 10; resistant (R), 10 < DI ≤ 30; moderately resistant (MR), 30 < DI ≤ 50; susceptible (S), 50 < DI ≤ 70; highly susceptible (HS), DI > 70.

[0122] Fusarium wilt pathogens were artificially inoculated using the root-dipping method.

[0123] (1) Preparation of bacterial suspension: The preserved wilt pathogen ( Fusarium oxysporum f. sp. ConglutinansAdd to liquid CM medium and incubate in a shaker at 28°C under darkness for 3 days. Filter the mycelium using gauze and adjust the remaining spores to 1x10⁻⁶. 6 After achieving a concentration of / mL, prepare for inoculation.

[0124] (2) Inoculation process: After the seedlings have grown to 3 true leaves, they can be inoculated. Before inoculation, pull the seedlings out of the seedling tray substrate and wash the roots. Soak the roots completely in the bacterial solution. After 15 minutes, take out the seedlings, transplant them into seedling bowls filled with soil and move them to a temperature-controlled greenhouse. The temperature is controlled at 23-29℃.

[0125] (3) Resistance Survey and Resistance Level Classification: Resistance evaluation criteria: Level 0, no symptoms; Level 1, one leaf slightly yellowed; Level 2, 1-2 leaves moderately yellowed; Level 3, half of the leaves severely yellowed or wilted; Level 4, all leaves except the heart leaf severely yellowed or wilted; Level 5, all leaves severely yellowed or the plant died. The leaf lesion levels of the surveyed materials were used to calculate the average disease index (DI), and the resistance level was classified based on the disease index. DI = [Σ(each disease level × number of plants with corresponding disease level) / (total number of surveyed plants × highest disease level)] × 100. Highly resistant (HR), 0 < DI ≤ 10; resistant (R), 10 < DI ≤ 30; moderately resistant (MR), 30 < DI ≤ 50; susceptible (S), 50 < DI ≤ 70; highly susceptible (HS), DI > 70.

[0126] Clubroot disease is artificially inoculated using the root drenching method:

[0127] (1) Preparation of bacterial suspension: The swollen roots of cabbage stored in a -20℃ refrigerator were activated at room temperature for 12 hours in advance. After adding three times the volume of sterile water, the roots were thoroughly crushed using a juicer. The mixture was filtered through gauze and the filtrate was collected into a 50ml centrifuge tube. The tube was centrifuged at 600rpm for 10 minutes and the supernatant was collected. Then, the bacteria were collected and resuspended in sterile water after centrifugation at 3500rpm for 10 minutes. The spore concentration was adjusted to 2x10 under a microscope. 7 cfu / mL.

[0128] (2) Inoculation process: When the cabbage seedlings have grown to 2 true leaves, inoculate them. Make 2 cuts on the root of each plant with a knife, then use a pipette to draw 2 mL of bacterial solution and inject it into the root of the seedling. Move the seedlings to a temperature-controlled greenhouse and keep the temperature at 18-25℃.

[0129] (3) Resistance investigation and division of resistance levels: Resistance evaluation criteria: Grade 0 = no symptoms on the roots; Grade 1 = no symptoms on the main roots, small nodules on the lateral roots; Grade 2 = slightly enlarged main roots, larger tumors on the lateral roots; Grade 3 = severely enlarged main roots, obvious lateral roots; Grade 4 = extremely severely enlarged main roots, almost no lateral roots. DI = ∑(number of diseased plants at each level × corresponding disease level) / (total number of plants investigated × highest disease level) × 100. Resistance evaluation criteria: Immune (I): DI = 0; Highly resistant (HR): 0 < DI ≤ 5; Resistant (R): 5 < DI ≤ 20; Moderately resistant (MR): 20 < DI ≤ 30; Susceptible (S): 30 < DI ≤ 60; Highly susceptible (HS): DI > 60.

[0130] The investigation results show that:

[0131] Compared with the cabbage variety M1, bobpm6 the disease indices of the plants inoculated with fusarium wilt, black rot, and clubroot decreased from 65.4 to 14.5 (significantly), from 53.8 to 20.9 (significantly), and from 63.1 to 55.7 ( Figure 6 );

[0132] The above experimental results indicate that BoBPM6 the gene is a sensitive gene that induces the onset of various cabbage diseases. Knocking out or inhibiting the expression of this gene can obtain new germplasms with broad-spectrum disease resistance. The BoBPM6 application of the gene in cabbage disease-resistant breeding and the supporting optimized gene editing and genetic transformation systems provide strong technical support for cabbage disease-resistant breeding.

[0133] Table 7

[0134]

Claims

1. A method for breeding disease resistant Brassica oleracea based on the susceptible gene BPM6 of Brassica oleracea, characterized in that, Comprising the following steps: (1) gene editing on the BPM6 gene in the target Brassica napus material to inhibit the expression of the gene; The nucleotide sequence of the BPM6 gene of the Brassica napus is shown in Seq ID No. 47; (2) screening the Brassica napus material with edited BPM6 gene for regeneration culture to obtain Brassica napus germplasm material with improved disease resistance; The Brassica napus disease resistance breeding refers to obtaining Brassica napus germplasm material with improved resistance to fusarium wilt, black rot and clubroot.

2. The method of claim 1, wherein, The gene editing refers to introducing a CRISPR / Cas9 gene editing vector into the target Brassica napus material; The sgRNA sequence of the CRISPR / Cas9 gene editing vector is shown in Seq ID No.

49.

3. The method of claim 2, wherein, The PAM sequence of the CRISPR / Cas9 gene editing vector is 5'-NGGT-3', wherein N is one of A, C, and G.

4. The method according to claim 1 or 2, characterized in that, It also includes introducing an expression vector expressing a fusion protein GRF5-GIF1-GRF5 while gene editing the target Brassica napus material; The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is as follows (1) or (2): (1) from N to C terminus, a GRF5-1 polypeptide shown in Seq ID No. 33, a GIF1 polypeptide shown in Seq ID No. 37, and a GRF5-2 polypeptide shown in Seq ID No. 34 are linearly fused; the polypeptides are connected by 3-5 alanine residues; (2) from N to C terminus, the amino acid sequence is linearly fused from a GRF5-2 polypeptide shown in Seq ID No. 34, a GIF1 polypeptide shown in Seq ID No. 37, and a GRF5-1 polypeptide shown in Seq ID No. 33; the polypeptides are connected by 3-5 alanine residues.

5. The method of claim 4, wherein, The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is shown in Seq ID No. 38, and its coding sequence is shown in Seq ID No.

41.

6. A CRISPR / Cas9 gene editing vector for editing BPM6 gene of Brassica oleracea, characterized in that, The nucleotide sequence of the BPM6 gene is shown in Seq ID No. 48; The sgRNA sequence of the CRISPR / Cas9 gene editing vector is shown in Seq ID No.

49.

7. The CRISPR / Cas9 gene editing vector of claim 6, wherein, The PAM sequence thereof is 5'-NGGT-3', wherein N is one of A, C, and G.

Images