Screening of aspergillus oryzae with high yield of protein and its application

CN120536255BActive Publication Date: 2026-08-18AIXBIO (HANGZHOU) BIOTECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510691019.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2026-08-18
Estimated Expiration
2045-05-27

AI Technical Summary

Technical Problem

目前商业化的米曲霉菌株,在特定的发酵过程中可能表现出较低的蛋白质产量或者生产周期长效率不高,且一般较为依赖标准化的培养条件和底物(如特定的碳源和氮源),这些条件可能限制了它们在不同环境和不同培养体系下的适应性,难以大规模工业应用

Benefits of technology

[0022] (1) The present invention screened and obtained Aspergillus oryzae strain WL03 with strong sporulation ability, good adaptability, stable subculture, and superior mycelial concentration and mycelial protein content. After subculturing 10 times in screening medium 2, the protein content remained ≥32% and the mycelial concentration was ≥7.5g/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536255B_ABST
    Figure CN120536255B_ABST
Patent Text Reader

Abstract

The application discloses screening of aspergillus oryzae with high yield of mycelial protein and application thereof, and belongs to the technical field of fermentation engineering. The aspergillus oryzae strain WL03 with high spore production capacity, good adaptability, stable subculture, and high mycelial concentration and mycelial protein content is screened, the culture medium for aspergillus oryzae fermentation is optimized, and the scale-up culture is further carried out in a 5L fermenter and a 20L fermenter. The strain of the application achieves the effects of 21g / L mycelial concentration and 46% mycelial protein content in the 5L fermenter, and achieves the effects of 20g / L mycelial concentration and 46% mycelial protein content in the 20L fermenter, and has the industrial application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the screening and application of Aspergillus oryzae with high microbial protein production, belonging to the field of fermentation engineering technology. Background Technology

[0002] Food security and environmental issues have become global concerns. With the decreasing sustainability of livestock production, there is an urgent need for alternative protein sources. Fungal protein, extracted from sustainable food sources based on fungi, can be used as a meat substitute, pet food, and animal feed. As people become increasingly health-conscious, the demand for functional foods is also growing. Fungal protein can have a positive impact on the immune system and cholesterol levels, and can be used in the pharmaceutical field, such as in the production of functional diets and supplements.

[0003] Aspergillus oryzae is a superior strain in my country's traditional brewing industry, widely used in soy sauce brewing and fermented black bean production. It is also a recognized food safety production strain with mature fermentation and post-processing technologies, commonly used to produce primary and secondary metabolites and mold products, and is a source of high-quality fungal protein. Aspergillus oryzae mycelium contains abundant protein with a relatively balanced amino acid composition, and its mycelial morphology offers a meat-like texture advantage in food processing. Currently commercially available Aspergillus oryzae strains may exhibit low protein yields or long production cycles and low efficiency in specific fermentation processes, and generally rely heavily on standardized culture conditions and substrates (such as specific carbon and nitrogen sources). These conditions may limit their adaptability to different environments and culture systems, hindering large-scale industrial application. Screening for new Aspergillus oryzae strains can yield strains with higher protein yields, stronger adaptability, and more stable production performance. These new strains can function stably in more diverse production environments, reducing the potential risks of existing strains while improving production efficiency and quality. Therefore, screening new Aspergillus oryzae strains with high protein and mycelial yields, and developing lower-cost fermentation and feeding methods, are of great significance for promoting the application of Aspergillus oryzae in the food industry and developing new food raw materials and alternative proteins. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides a high-protein-producing Aspergillus oryzae WL03, classified as Aspergillus oryzae WL03, which was deposited on March 10, 2025, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2025400, located at Wuhan University, Wuhan, China.

[0005] The present invention also provides a microbial preparation containing spores or hyphae of the Aspergillus oryzae WL03.

[0006] In one embodiment, the microbial preparation includes a liquid preparation or a solid preparation.

[0007] The present invention also provides a method for producing mycelial protein by fermentation of the aforementioned Aspergillus oryzae, wherein the method involves culturing the Aspergillus oryzae in a fermentation medium for a period of time and collecting the protein in the fermentation broth.

[0008] The present invention also provides a method for producing mycelium by fermentation of the aforementioned Aspergillus oryzae, wherein the method involves culturing the Aspergillus oryzae in a fermentation medium for a period of time and collecting the mycelium in the fermentation broth.

[0009] In one embodiment, the fermentation is carried out at 28–30°C.

[0010] In one implementation, fermentation lasts for at least 6 hours, or at least 18 hours, or at least 24 hours, or at least 30 hours.

[0011] In one embodiment, the fermentation medium uses dextrin as a carbon source and yeast powder and (NH4)2SO4 as nitrogen sources.

[0012] In one embodiment, the fermentation medium contains dextrin, yeast powder, alanine, ammonium salt, potassium salt, citric acid, and trisodium citrate.

[0013] In one embodiment, the concentration of alanine in the fermentation medium is 20–80 mM.

[0014] In one embodiment, the fermentation medium contains 40 g / L dextrin, 8.64 g / L yeast extract, 2 g / L alanine, 1 g / L (NH4)2SO4, 0.1 g / L citric acid monohydrate, 0.05 g / L trisodium citrate dihydrate, 0.01 g / L KH2PO4, 2 mL / L trace element solution, and 1 mL / L complex vitamin solution; the trace element solution contains: 2 g / L CaCl2, 3 g / L FeSO4·7H2O, 0.4 g / L CuSO4·5H2O, 1 g / L CuCl2·2H2O, 1 g / L MnSO4·H2O, 1 g / L H3BO3, 1 g / L Na2MoO4·2H2O, 0.3 g / L CoCl2·6H2O, and 0.3 g / L ZnSO4·7H2O. 4.5 g / L; the compound vitamin solution contains: biotin 50 mg / L, para-aminobenzoic acid 200 mg / L, niacin 1 g / L, calcium pantothenate 1 g / L, pyridoxine hydrochloride 1 g / L, thiamine hydrochloride 1 g / L, and inositol 25 g / L.

[0015] In one implementation, additional feed is provided during the fermentation process.

[0016] In one embodiment, yeast powder and (NH4)2SO4 are added as feed.

[0017] The present invention also provides the application of Aspergillus oryzae WL03 in the food industry.

[0018] In one embodiment, the application includes, but is not limited to, the preparation of new food ingredients and / or alternative proteins.

[0019] The present invention also provides the application of the aforementioned Aspergillus oryzae WL03 in the preparation of culture media.

[0020] In one embodiment, the application involves using the mycelial protein of Aspergillus oryzae WL03 as a nitrogen source for the culture medium.

[0021] Beneficial effects:

[0022] (1) The present invention screened and obtained Aspergillus oryzae strain WL03 with strong sporulation ability, good adaptability, stable subculture, and superior mycelial concentration and mycelial protein content. After subculturing 10 times in screening medium 2, the protein content remained ≥32% and the mycelial concentration was ≥7.5g / L.

[0023] (2) The present invention optimizes the culture medium for Aspergillus oryzae WL03 fermentation, including the types and amounts of amino acids added, carbon and nitrogen source content, so that Aspergillus oryzae WL03 can achieve a mycelial concentration of 16 g / L and a cell protein content of 37% by using inexpensive carbon and nitrogen sources in shake flask fermentation.

[0024] (3) The present invention scaled up the Aspergillus oryzae WL03 obtained by screening in 5L fermenters and 20L fermenters. The mycelial concentration of 21g / L and the mycelial protein content of 46% were achieved in the 5L fermenter, and the mycelial concentration of 20g / L and the mycelial protein content of 46% were achieved in the 20L fermenter, which helps to achieve low-cost and high-efficiency industrial production.

[0025] Preservation of biological materials

[0026] Aspergillus oryzae WL03, classified as Aspergillus oryzae WL03, was deposited on March 10, 2025, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:M 2025400, located at Wuhan University, Wuhan, China. Attached Figure Description

[0027] Figure 1 To screen the growth status of Aspergillus oryzae on plates.

[0028] Figure 2 The image shows the results of the shake flask screening for WL01 to 46.

[0029] Figure 3 The graph shows the concentration of mycelium and protein content of Aspergillus oryzae WL01-46.

[0030] Figure 4 This is a diagram showing the growth status of Aspergillus oryzae under corn steep liquor culture conditions.

[0031] Figure 5 This is a graph showing the results of the secondary screening for Aspergillus oryzae.

[0032] Figure 6 The fermentation effect of Aspergillus oryzae WL03 under different concentrations of alanine was studied.

[0033] Figure 7 The fermentation effect of WL03 under different carbon and nitrogen sources.

[0034] Figure 8 This is a schematic diagram of strain WL03 fermenting with Aspergillus oryzae in a 5L tank.

[0035] Figure 9 The fermentation curve of strain WL03 in a 5L tank.

[0036] Figure 10 This is a schematic diagram of strain WL03 fermenting with Aspergillus oryzae in a 20L tank.

[0037] Figure 11 The fermentation curve of strain WL03 in a 20L tank. Detailed Implementation

[0038] The specific embodiments of the present invention are described below:

[0039] (a) Culture medium:

[0040] Czapek-Dox medium: NaNO3 3g / L, K2HPO4 1g / L, MgSO4·7H2O 0.5g / L, KCl 0.5g / L, FeSO4 0.01g / L, sucrose 30g / L, agar 15g / L, natural pH.

[0041] Screening medium 1: dextrin 20 g / L, peptone 5 g / L, yeast extract 1 g / L, NaNO3 1 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.5 g / L, FeSO4·7H2O 0.01 g / L.

[0042] Screening medium 2: dextrin 20 g / L, corn steep liquor 5 g / L, yeast powder 1 g / L, NaNO3 1 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.5 g / L, FeSO4·7H2O 0.01 g / L.

[0043] PDA medium: 200 g / L potato, 20 g / L glucose, 15 g / L agar.

[0044] Seed culture medium: dextrin 40 g / L, yeast extract 8.64 g / L, alanine 2 g / L, (NH4)2SO4 1 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.5 g / L, natural pH.

[0045] Fermentation medium: dextrin 40 g / L, yeast powder 8.64 g / L, alanine 2 g / L, (NH4)2SO4 1 g / L, citric acid monohydrate 0.1 g / L, trisodium citrate dihydrate 0.05 g / L, KH2PO4 0.01 g / L, trace element solution 2 mL / L, and compound vitamin solution 1 mL / L.

[0046] Trace element solution: CaCl2 2g / L, FeSO4·7H20 3g / L, CuSO4·5H2O 0.4g / L, CuCl2·2H2O1g / L, MnSO4·H2O 1g / L, H3BO3 1g / L, Na2MoO4·2H2O 1g / L, CoCl2·6H2O 0.3g / L, ZnSO4·7H2O4.5g / L.

[0047] Compound vitamin solution: Biotin 50mg / L, para-aminobenzoic acid 200mg / L, niacin 1g / L, calcium pantothenate 1g / L, pyridoxine hydrochloride 1g / L, thiamine hydrochloride 1g / L, inositol 25g / L.

[0048] (II) Testing methods:

[0049] Mycelial concentration: Collect the fermentation broth into 50 mL centrifuge tubes, filter to collect the mycelial cells, resuspend and wash 2-3 times with deionized water, then place in a freeze dryer with the cold trap temperature set to -40℃ and the vacuum degree to 15-50 Pa, freeze-dry for 3 days until constant weight is obtained, and weigh to obtain the mycelial mass (g). Divide the mycelial mass (g) by the fermentation broth volume (L) to obtain the mycelial concentration (g / L).

[0050] Protein determination method: Unless otherwise specified, "bacterial protein" as used in this application refers to all proteins synthesized and present in the cells during the growth of Aspergillus oryzae. The content is determined after digestion. The specific steps are as follows: Weigh 0.2g CuSO4, 3g K2SO4, and 10mL concentrated sulfuric acid and add them sequentially to a dry digestion tube. Place 0.1-0.5g of freeze-dried cells to constant weight at the bottom of the digestion tube, and prepare one blank control. Each sample is tested in triplicate. Place the digestion tube in a digestion oven, and finally place the digestion tube on a graphite digester for digestion. The protein content is determined using the Kjeldahl method. The protein content per gram of bacterial cells (dry weight) is expressed as a percentage (%).

[0051] Carbon source conversion rate determination and calculation method: The carbon source consumed is determined by the phenol-sulfuric acid method and denoted as N1. The carbon source conversion rate is obtained by dividing the measured mycelial concentration (denoted as N2) by the carbon source consumed. Carbon source conversion rate = N1 / N2.

[0052] Example 1: Enrichment and Identification of Aspergillus oryzae in Soil

[0053] Soil samples were collected from different moist areas near soy sauce factories and vineyards, rich in plant residues. The collected soil samples were first screened to remove larger impurities such as stones and plant residues. The soil was then fully suspended in sterile PBS buffer and stirred to obtain a soil suspension. The suspension was filtered through 300-mesh gauze. The filtered bacterial cells were inoculated at a volume ratio of 2% into screening medium 1 and incubated at 30°C for 48 hours. Since *Aspergillus oryzae* exhibits chloramphenicol resistance, chloramphenicol was added to a final concentration of 50 μg / mL for further enrichment. The cultured bacterial suspension was serially diluted and plated onto Czapek-Dox plates containing chloramphenicol, incubated at 30°C for 4–7 days, and colonies were observed. *Aspergillus oryzae* colonies are typically large and have a white or yellow appearance, with yellowish-green conidia. Colonies that may be *Aspergillus oryzae* were further purified. Typical *Aspergillus oryzae* colonies were selected from the culture medium and transferred to fresh culture medium using a sterile inoculation loop for single-colony culture. Figure 1To ensure the purity of the strain, the genome of the purified strain was extracted and molecularly identified using 18S (Op18s-F: CTGGTTGATCCTGCCAGTAGTC; Op18s-R: CCTTCCGCAGGTTCACCTAC) and ITS (ITS1: TCCGTAGGTGAACCTGCGG; ITS2: GCTGCGTTCTTCATCGATGC; ITS3: GCATCGATGAAGAACGCAGC; ITS4: TCCTCCGCTTATTGATATGC). The sequencing results were compared with databases, showing that the selected strains had 98% similarity to *Aspergillus oryzae*. The correctly identified strains were inoculated into selection medium 1 and fermented in shake flasks at 30°C for 48 hours. The cell growth was then observed. Figure 2 After fermentation, the fermentation products were collected, and their mycelial concentration and protein content were determined. Figure 3 By comparing them, 46 strains of Aspergillus oryzae with different mycelial concentrations and protein contents were obtained and named WL01 to WL46.

[0054] Example 2: Secondary screening of high-protein-producing strains of Aspergillus oryzae

[0055] The Aspergillus oryzae strains screened in Example 1 were streaked onto fresh PDA plates and incubated upside down at 30°C for 3–7 days until the plates were covered with dense yellow-green spores. The plates were then washed with sterile spore suspension to obtain a fresh spore suspension. Spores were counted using a hemocytometer to form a 6 × 10⁻⁶ spore count. 5 Inoculate with a concentration of 1 / mL into 50mL of selection medium 2 in a 250mL shake flask and incubate at 30℃ and 200rpm for 48h.

[0056] Forty-six Aspergillus oryzae strains were streaked onto PDA plates and continuously passaged until the 7th generation. Most strains showed only mycelial growth without producing significant conidia during continuous passage. Strains with strong conidial production were selected and inoculated onto selection medium 2. After culturing at 30℃ for 48 hours, strains with strong adaptability were screened, resulting in 10 strains (WL22, WL10, WL42, WL31, WL03, WL13, WL05, WL14, WL26, WL12) with high protein content, mycelial concentration, and carbon source conversion rate. Figure 4 , Figure 5 ).

[0057] The strain WL03 was passaged 10 times in selection medium 2, and its protein content and mycelial concentration were detected. The results showed that after 10 passages, the protein content of strain WL03 was ≥32%, and the mycelial concentration was ≥7.5g / L.

[0058] Example 3: Culture medium optimization

[0059] The protein content of strain WL03 screened in Example 2 was measured to be an average of 32%, and the mycelial concentration was 7.5 g / L, both of which were higher than those of mitochondrial ATCC 10124 (protein content 28%, dry weight of cells 6.5 g / L). Based on strain WL03, the culture medium was optimized using screening medium 2 as the base medium.

[0060] (1) Amino acid addition: Based on the metabolic network model prediction, different concentrations of alanine (20, 40, 60, 80 mM) were added to screening medium 2 to investigate its effect on the mycelial concentration and protein content of the strain. Spore suspension of strain WL03 was prepared according to the method in Example 2, and then added at 6 × 10⁻⁶ mM. 5 The cells were inoculated at a concentration of 1 / mL into 50 mL of alanine-containing selection medium 2 in a 250 mL shake flask and cultured at 30 °C for 48 h.

[0061] The results showed that, compared with the culture medium without alanine, the addition of alanine significantly increased the protein content of the bacteria. Figure 6 Considering production costs, alanine (20-80 mM) can be added to the culture medium to promote protein accumulation.

[0062] (2) Carbon and nitrogen source optimization: An experiment was designed based on Table 1 to investigate the growth status of the strain under different carbon and nitrogen sources. Using screening medium 2 supplemented with 2 g / L alanine, 20 g / L dextrin was replaced with different concentrations of soluble starch, dextrin, or maltodextrin, and 5 g / L corn steep liquor was replaced with different concentrations of corn steep liquor, yeast extract, or (NH4)2SO4. Spore suspensions of strain WL03 were prepared according to the method in Example 2, and cultured at 6 × 10⁻⁶ ppm. 5 Inoculate the culture medium at a concentration of 1 / mL into 50mL of optimized medium in a 250mL shake flask, incubate at 30℃ for 48h, and then determine the protein content and mycelial concentration.

[0063] The results showed that, compared with the control group, the dry weight of the cells increased by nearly 100% after partial optimization. Figure 7 Groups with a protein content greater than 35% and a mycelial concentration greater than 15 g / L, namely groups 5, 8, or 9, were selected. However, considering that corn steep liquor has a complex composition and may contain fungal toxins when used as a nitrogen source, 40 g / L dextrin, 8.64 g / L yeast extract, and 1 g / L (NH4)2SO4 were selected as the optimal carbon and nitrogen source for the seed culture medium.

[0064] Table 1. Optimization Design of Carbon and Nitrogen Sources

[0065]

[0066] Example 4: Effects of different conditions on fermentation results

[0067] (1) Different seed culture media

[0068] The Aspergillus oryzae WL03 strain selected in Example 2 was cultured in the following culture media to verify the fermentation effect.

[0069] Seed culture medium before optimization: dextrin 20 g / L, corn steep liquor powder 5 g / L, yeast powder 1 g / L, NaNO3 1 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.5 g / L, FeSO4·7H2O 0.01 g / L, natural pH.

[0070] Optimized seed culture medium: 40 g / L dextrin, 8.64 g / L yeast extract, 1 g / L (NH4)2SO4, 2 g / L alanine, 0.5 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, natural pH.

[0071] Fermentation medium: Based on the optimized amino acid and carbon and nitrogen sources in Example 3, the following components were adjusted: 40 g / L dextrin, 8.64 g / L yeast extract, 1 g / L (NH4)2SO4, 2 g / L alanine, 0.1 g / L citric acid monohydrate, 0.05 g / L trisodium citrate dihydrate, 0.01 g / L KH2PO4, 2 mL / L trace element solution, and 1 mL / L complex vitamin solution.

[0072] The specific steps are as follows: Aspergillus oryzae WL03 is prepared at a spore concentration of 6 × 10⁻⁶. 5 Seed culture solutions were prepared by inoculating different seed culture media at a concentration of 10% / mL and incubating them at 30℃ and 220rpm for 24h with shaking. The seed culture solutions were then inoculated into fermentation medium at a 10% inoculation rate and fermented at 30℃ and 220rpm for 48h. The results are shown in Table 2.

[0073] Table 2. Fermentation effects in different seed culture media

[0074]

[0075] (2) Initial pH of the culture medium

[0076] Aspergillus oryzae WL03, screened in Example 2, was used at a spore concentration of 6 × 10⁻⁶. 5 The concentration of 1000 cells / mL was used to culture the seed culture medium optimized in Example 3, and the pH of the medium was controlled at 4.5, 5.5 and 6.5 respectively.

[0077] Fermentation was carried out according to the parameters in step (1), and the results are shown in Table 3.

[0078] Table 3. Fermentation effect at different initial pH levels

[0079]

[0080] (3) Different spore inoculation concentrations

[0081] The Aspergillus oryzae WL03 strain screened in Example 2 was used at a concentration of 1.2 × 10⁻⁶. 5 6×10 5 3×10 6 The inoculum was cultured in the seed culture medium optimized in Example 3, with the pH of the culture medium controlled at 6.5 (natural pH), and fermentation was carried out according to the parameters of step (1). The results are shown in Table 4.

[0082] Table 4. Fermentation effects at different inoculum sizes

[0083]

[0084] Example 5: Cultivation of strain WL03 in a 5L fermenter

[0085] Aspergillus oryzae WL03 obtained from Example 2 was used at a spore concentration of 6 × 10⁻⁶. 5 Seed culture was prepared by inoculating the seed culture medium (0.45 L) at a concentration of 1 / mL into a 2 L shake flask containing 0.45 L of the optimized seed culture medium from Example 3 and incubating at 30 °C and 220 rpm for 24 h with shaking.

[0086] The seed culture was inoculated at a 15% inoculum into a 5L fermenter containing 2.55L of fermentation medium. Fermentation parameters were: temperature 30℃, aeration rate 1.0 vvm, dissolved oxygen 40%, rotation speed 200–800 rpm, dissolved oxygen-dependent stirring, and pH self-controlled (pH 6.3). Feeding conditions were as follows: starting at 6 hours, 200 g / L of yeast powder was added at a constant rate of 20 mL / h, and the aeration rate was changed to 1.5 vvm. Feeding was stopped after 3 hours, and after 18 ± 0.5 hours of fermentation, feeding was continued for 1 hour, for a total of 4 hours of feeding. Aspergillus oryzae ATCC 10124 was used as a control and fermented using the same method.

[0087] 50 mL samples were taken every 6 hours, and the culture was carried out for 24 hours before being transferred to the fermentation tank. At the end of fermentation, a total of 6 g / L of yeast powder was added. The samples were filtered through medium-speed neutral filter paper to obtain the fermentation cells, dried using a moisture analyzer, weighed, and the mycelial concentration was calculated. The dried samples were then digested using a graphite digester, and the total protein content of the cells was determined using the Kjeldahl method. At the end of fermentation, the cell protein content reached 46%, and the mycelial concentration was 21 g / L. Figure 8 , Figure 9 ).

[0088] Compared with existing Quorn products, strain WL03 of this invention has superior nutritional components (the protein content of Quorn products is approximately 12.8-14.5%), and compared with Aspergillus oryzae ATCC 10124 fermented in a 5L tank for 9 days (protein content 17.1%, cell dry weight 13.4g / L), this invention can yield a larger cell volume and higher cell protein.

[0089] Example 6: Cultivation of strain WL03 in a 20L fermenter

[0090] The seed culture method was the same as in Example 5. The spore concentration was 6 × 10⁻⁶. 5 Seed culture solution was prepared by inoculating 0.6 L of the optimized seed culture medium into 2 L shake flasks at 30 °C and 220 rpm for 21 h with 1 / mL of seed culture medium.

[0091] The seed culture was inoculated at a 15% inoculum into a 20L fermenter containing 10.2L of fermentation medium for further scale-up culture. Fermentation parameters were: temperature 30℃, aeration rate 1.08 vvm, dissolved oxygen 40%, dissolved oxygen-dependent stirring at 200–800 rpm, and pH automatically controlled (pH 6.3). Feeding conditions were as follows: starting from the 6th hour, yeast extract at a constant feed rate of 100 mL / h (103.36 g / L) and (NH4)2SO4 at a constant feed rate of 60.96 g / L were added for a total of 2.5 hours. A 100 mL sample was taken every 6 hours, and fermentation continued for a total of 30 hours. At the end of the fermentation, the total yeast extract concentration was 2.2 g / L, and the (NH4)2SO4 concentration was 1.3 g / L. The fermentation broth was filtered through medium-speed neutral filter paper to obtain fermentation cells. These cells were then dried using a moisture analyzer, weighed, and their mycelial concentration was calculated. The dried sample was then digested using a graphite digester, and the protein content was determined using the Kjeldahl method. At the start of fermentation (30 hours), the mycelial concentration reached 18 g / L, and the cell protein content was 46%.

[0092] Following the above fermentation method, the parameters were fine-tuned. The results showed that increasing the tank pressure to 0.06 MPa increased the mycelial concentration by 2–3 g / L, and increasing the mycelial concentration to 20 g / L further increased the concentration. Figure 10 , Figure 11 ).

[0093] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. Aspergillus oryzae ( Aspergillus oryzae WL03 was deposited on March 10, 2025 at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:M 2025400, located at Wuhan University, Wuhan, China.

2. A microbial preparation, characterized in that, Contains spores or mycelium of Aspergillus oryzae as described in claim 1.

3. The microbial preparation according to claim 2, characterized in that, The microbial preparation may be a liquid or a solid preparation.

4. A method for preparing bacterial protein by fermentation, characterized in that, The Aspergillus oryzae WL03 of claim 1 is cultured in a fermentation medium for a period of time, and the protein in the fermentation broth is collected; the fermentation medium uses dextrin as a carbon source and yeast powder and (NH4)2SO4 as nitrogen sources; the fermentation medium contains alanine at a concentration of 20-80 mM.

5. A method for preparing mycelium by fermentation, characterized in that, The Aspergillus oryzae WL03 of claim 1 is cultured in a fermentation medium for a period of time, and the mycelium in the fermentation broth is collected; the fermentation medium uses dextrin as a carbon source and yeast powder and (NH4)2SO4 as nitrogen sources; the fermentation medium contains alanine at a concentration of 20-80 mM.

6. The method according to claim 4 or 5, characterized in that, The fermentation is carried out at 28~30℃.

7. The method according to claim 4 or 5, characterized in that, The fermentation medium contains dextrin, yeast powder, alanine, ammonium salt, potassium salt, citric acid, and trisodium citrate.

8. The method according to any one of claims 4 to 7, characterized in that, Feed is also added during the fermentation process.

9. The application of Aspergillus oryzae according to claim 1, or the microbial preparation according to any one of claims 2 to 3, or the method according to any one of claims 4 to 8 in the food field.

Citation Information

Patent Citations

  • Aspergillus oryzae strain with high yield of mycoprotein and application thereof

    CN117229923A