A primer and probe design method
By screening and optimizing primer-probe combinations and avoiding the secondary structure of nucleic acid templates, the problems of insufficient PCR amplification efficiency and sensitivity have been solved, realizing high-efficiency amplification and detection of multiplex PCR systems, which are suitable for a variety of PCR applications and gene analysis.
Patent Information
- Application Number
- CN202510602427.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2045-05-12
AI Technical Summary
Existing primer and probe design methods do not fully consider the dynamic spatial conformation (PTCD) of nucleic acid templates, resulting in insufficient PCR amplification efficiency and sensitivity, especially in multiplex PCR reactions where amplification consistency and detection accuracy are difficult to guarantee.
By screening amplicon regions, primers and probes were designed to circumvent the secondary structure of target nucleic acids. The interaction between primers and probes was optimized. Tools such as AlleleID 7.3 and Beacon Designer were used to simulate PTCD information at PCR experimental temperatures. Complementary matching conditions for primer-probe combinations were set to ensure effective binding at annealing temperatures.
It improves the amplification efficiency and sensitivity of singleton and multiplex PCR systems, and is suitable for various PCR applications, including singleton fluorescent qPCR, multiplex fluorescent qPCR and digital PCR. It is compatible with gene expression analysis and gene mutation detection, lowers the technical threshold and has the possibility of automated design.
Smart Images

Figure BDA0005397196650000071 
Figure BDA0005397196650000081 
Figure BDA0005397196650000131
Abstract
Description
Technical Field
[0001] This invention belongs to the field of nucleic acid detection technology, specifically relating to a method for designing primers and probes. Background Technology
[0002] Quantitative real-time PCR (qPCR) is a highly sensitive, specific, and accurate nucleic acid analysis technique that has been widely applied in gene expression, pathogen detection, and other fields. With increasing demands for throughput and efficiency, multiplex qPCR (including one-step multiplex RT-qPCR) has become the mainstream technology. Its core lies in amplifying different targets using multiple primer pairs in the same reaction system and utilizing fluorescent labeling to achieve highly specific detection.
[0003] However, the design methods for PCR primers and TaqMan probes have limitations, resulting in high detection limits for probe-based qPCR, which is insufficient for detecting low-abundance nucleic acids. Traditional design relies on experience and software (such as Primer3 and BeaconDesigner), primarily controlling basic primer and probe parameters (such as length, GC content, annealing temperature, hairpin structure, and dimers). However, with further research, the inventors discovered that even with these parameters being relatively close, PCR amplification efficiencies can vary significantly depending on the location of the target gene. This may be related to the PTCD of the target gene.
[0004] During PCR, although denaturation at 95°C linearizes the nucleic acid template, complex templates (such as sequences with high GC content or rich in secondary structures) may not be completely dissociated. Simultaneously, during the subsequent annealing / extension phase (55-60°C), the dissociated single-stranded nucleic acids may refold to form complex structures. This dynamic spatial conformation of the nucleic acid template during PCR (hereinafter referred to as PCR-induced Templated Conformational Dynamics, PTCD) may affect PCR amplification efficiency in the following three ways:
[0005] First, PTCD interferes with primer and probe recognition and binding: PTCD may mask the binding sites of primers and probes, preventing them from effectively recognizing and binding to the target, thus reducing PCR amplification efficiency. In multiplex PCR reaction systems, different targets have varying thermodynamic stability due to sequence differences, exacerbating the complexity and heterogeneity of PTCD. Therefore, it is difficult to achieve consistent PCR amplification of different targets in the same PCR reaction system, ultimately affecting the target detection rate.
[0006] Secondly, PTCD affects the stability of primer-probe recognition / binding: Stable binding of the target, primers, and probes is crucial for amplification during PCR. However, dissociated single-stranded DNA or RNA may refold during the annealing / extension phase (55-60℃), especially when the template sequence contains high GC content or complex repetitive sequences. This change in spatial conformation may cause primers and probes to dissociate during extension due to structural instability, even if they can recognize and bind to the target, leading to PCR termination. Furthermore, multiplex PCR reactions typically use only one uniform extension condition, making precise control of binding stability between different targets difficult. Therefore, under the same reaction conditions, the stability of binding between the target, primers, and probes varies significantly, resulting in inconsistent PCR amplification efficiency and ultimately affecting target detection rates.
[0007] Finally, PTCD hinders the extension efficiency of DNA polymerase: even if primers bind successfully, the complex spatial conformation of the target area during extension can cause nucleic acid extension to stall or slow down, resulting in reduced synthesis of the target product. Furthermore, this effect significantly reduces the rate of fluorescence signal increase, especially in probe-based PCR. This is because fluorescence detection depends on the 5'→3' exonuclease activity of DNA polymerase: after the fluorescent probe bound to the target is cleaved by DNA polymerase, the fluorescent reporter group on the probe separates from the quencher group, and the fluorescence signal is no longer quenched. As PCR amplification progresses, the target copy number increases, more probes are cleaved, and the fluorescence signal gradually strengthens and becomes stably detected. Therefore, PTCD causes the fluorescence signal intensity to be inconsistent with the initial concentration of the target to be analyzed, thus affecting the accuracy of PCR detection. In multiplex PCR systems, this effect further affects the stability and accuracy of detection due to the inconsistent cleavage efficiency of multiple probes.
[0008] Existing primer and probe design methods primarily rely on optimizing their own parameters, such as length, GC content, annealing temperature, hairpin structure, and dimerization. While these parameters can guide design to some extent, these methods fail to fully consider the characteristics of the nucleic acid template itself, especially the dynamic spatial conformation changes of the template during the PCR reaction. Patent CN113234794A uses next-generation sequencing (NSG) fragment abundance as an indicator of "PCR ease," designing primers and probes by screening high-coverage regions through bioinformatics. However, template expansion is insufficient, resulting in low PCR efficiency. The evaluation standard, NGS experimental data, has a single data source, is expensive, and lacks widespread operability. Furthermore, this data is static NGS abundance data and does not integrate temperature gradient data (55-65℃) that may exist during actual PCR, thus limiting its operability and generalizability. In addition, the 3' end complementarity rule is lenient, only requiring that the last three bases at the 3' end of the primer avoid complementarity, but without specifying the specific sequence. Patent CN115851891A optimizes primer set specificity through multi-sequence structural alignment and fragmentation strategies, supporting the simultaneous detection of more than 50 pathogens. However, this patent develops an evaluation strategy based on the nucleic acid sequence data of pathogens, whose sequence characteristics differ significantly from those of mammals (including humans), resulting in low universality of the analytical strategy used. Furthermore, the target nucleic acid structure (secondary structure) analysis has a limited length, and the size of amplicon designed for pathogens differs from that of mammals, with pathogen amplicon regions being shorter. Therefore, when designing the spatial conformation analysis strategy, the scanning range of upstream and downstream secondary structures of the amplicon is not specified because the analyzable range is limited, far less than that of mammals (including humans). Patent CN115851891A designs reagents with specific sequences and terminal modification structures. However, optimization of the target nucleic acid structure (secondary structure) depends on specific reagents, requiring the additional design and use of unwinding agents, increasing experimental costs and complexity. Moreover, the design of unwinding agents needs to target specific secondary structures and is not applicable to all types of templates. Patent CN202011633512.3 optimizes primer combination design by establishing a scoring mechanism. However, the 3' binding sites of primers and probes only consider their own structural stability, without considering their relationship with the target template conformation, and also lack optimization parameters based on spatial conformation. Patent CN202211506377.5 uses template fragmentation processing and comparison to screen out species-specific and species-universal nucleic acid fragments for efficient primer and template recognition. However, it does not evaluate the conformation of universal fragment nucleic acids. Furthermore, the 3' binding sites of primers and probes only consider their own structural stability, without considering their relationship with the target nucleic acid conformation, and also lack primer optimization parameters based on nucleic acid conformation.
[0009] Current technologies do not adequately consider the characteristics of nucleic acid templates when designing primers and probes, nor do they explicitly consider the conformation of nucleic acid templates; nor do they propose optimized parameters for primer and probe design based on the differences in nucleic acid conformations. This may lead to a significant decrease in the binding efficiency of primers / probes to the template in the following four situations, thereby affecting PCR amplification efficiency and sensitivity.
[0010] First, the characteristics of nucleic acid templates have not been fully considered: existing design methods mainly focus on optimizing the parameters of primers and probes themselves, without adequately considering the characteristics of nucleic acid templates. The sequence composition, GC content, and spatial conformation of nucleic acid templates have a significant impact on the binding efficiency and specificity of primers and probes. For example, regions with high GC content may lead to unstable primer binding, while complex spatial conformations (such as secondary structures) may obscure binding sites, thereby reducing the binding efficiency of primers and probes.
[0011] Secondly, there is a lack of detailed evaluation of nucleic acid template conformation: Although existing literature mentions avoiding secondary structure regions of the template when designing primers and probes, current methods do not provide specific parameter guidance. While nucleic acid secondary structure prediction tools (such as Mfold and RNAstructure) can predict the spatial conformation of the template, current methods fail to specify how to optimize primer and probe design based on these predictions. This lack of specific guidance leads to insufficient reliability and consistency of design results.
[0012] Secondly, the temperatures used to predict nucleic acid template conformation are inconsistent with actual PCR reaction temperatures: nucleic acid template conformation changes dynamically during PCR. While the template is linearized during the 95°C denaturation step, it may refold into complex secondary or tertiary structures during the subsequent annealing / extension phase (55-60°C). Existing design methods fail to account for this dynamic change, potentially leading to ineffective primer and probe binding in actual reactions. Furthermore, existing nucleic acid secondary structure prediction tools (such as Mfold and RNAstructure) typically predict structures based on a 37°C temperature, which is inconsistent with actual PCR conditions, limiting the reference value of these predictions.
[0013] Finally, the interaction between nucleic acid template conformation and primer / probe interactions has not been adequately considered: the binding characteristics of primers and probes are primarily determined by their 3' end sequences. Existing design methods only focus on the GC content of the 3' end, 3' end complementarity, and the Tm difference between the 3' end and the middle sequence to ensure specific binding, avoid primer-probe dimer formation, and activate PCR polymerase activity. However, these methods only examine the 3' end stability of the primers themselves or between primers, without assessing the interaction between the primer 3' end and the template's dynamic folding structure at annealing temperature, nor providing quantitative evaluation criteria.
[0014] To address these issues, there is an urgent need to develop a method for evaluating PTCD and to optimize primer and probe design accordingly, thereby improving the amplification efficiency of singleton and multiplex PCR systems and promoting the application of multiplex fluorescent qPCR / dPCR technology in fields such as precision medicine. Summary of the Invention
[0015] This application proposes a primer and probe design method that optimizes primer and probe design to circumvent the secondary structure of the target nucleic acid. Based on this, the present invention has been completed.
[0016] In a first aspect, the present invention provides a method for designing multiplex qPCR and dPCR primers and probes based on PCR template dynamic conformation (PTCD), the method comprising the following steps:
[0017] S1. Screening amplicon regions: Input target nucleic acid sequence information and use the model to simulate the PTCD information of the sequence at the annealing temperature of the PCR experiment;
[0018] S2. Identify and screen candidate amplicon regions, wherein the candidate amplicon region sequences satisfy the following conditions:
[0019] S2.1 Within the flanking regions extending 200 bp from the 5' and 3' ends of the candidate region, the number of single-chain nonlinear conformations (including hairpin structures, stem-loop structures, and G-quadruplexes) is ≤3;
[0020] The CG content of candidate regions in S2.2 is ≤55%;
[0021] S3. Based on the interaction between PTCD and primers / probes, design primer / probe combinations that satisfy conditions S3.1, S3.2, S3.3, and / or S3.4:
[0022] The complementary matching length of the 5 bases at the 3' end of primer S3.1 with any PTCD conformation in the candidate region is <3bp;
[0023] S3.2 The complementarity matching free energy between the full sequence of the probe and any PTCD conformation in the candidate region is > -5 kcal / mol, meaning that the full sequence of the probe does not have any complementarity with any PTCD in the amplicon.
[0024] The last three bases at the 3' end of primer S3.3 do not contain consecutive homologous dinucleotides AA or TT;
[0025] The initial 5' bases of primer S3.4 have a complementary match length of <3bp with any PTCD conformation in the candidate region.
[0026] S4. Complete the final design by combining conventional primer and probe parameters (including length, Tm value, GC% and dimer formation status);
[0027] S5. Use in silico PCR tools to verify PCR specificity.
[0028] Furthermore, in step S1, the model is selected from a steady-state model and / or a dynamic folding model.
[0029] Furthermore, the simulation in step S1 is performed using a simulation tool selected from one or more of AlleleID 7.3, Beacon Designer, and / or NUPACK.
[0030] Furthermore, in step S1, the model simulation is to simulate PTCD at the annealing temperature set in the actual experiment.
[0031] Furthermore, when PTCD is simulated at the annealing temperature in actual experiments, the accuracy of the conformation prediction results obtained by the model is ≥80%.
[0032] Furthermore, the screening conditions in step S3 only take effect when the number of single-chain nonlinear conformations in the candidate region described in S2 meets the threshold.
[0033] Furthermore, when the threshold is ≤2 for the number of single-chain nonlinear conformations in the candidate region, conditions S3.1 and S3.2 must be satisfied.
[0034] Furthermore, when the threshold is equal to 3 for the number of single-chain nonlinear conformations in the candidate region, all conditions S3.1-S3.4 must be satisfied.
[0035] Secondly, the present invention provides the application of the method as described in the first aspect in the design of primers and probes.
[0036] Thirdly, the present invention provides a primer and a probe, which are designed and obtained by the method described in the first aspect of the present invention; the primer and probe circumvent the secondary structure of the target nucleic acid.
[0037] Beneficial effects
[0038] 1. Propose strategies for assessing and avoiding PCR template dynamic conformation (PTCD).
[0039] In the development of PCR technology, PTCD often leads to insufficient binding of primers and probes to the template, thereby reducing amplification efficiency. This technical solution uses pre-PTCD prediction and screening to identify candidate amplicons, effectively avoiding the obstruction of primer binding by secondary structures and improving amplification efficiency and sensitivity.
[0040] 2. Based on the interaction between PTCD and probe primers, optimize primer and probe design parameters appropriately.
[0041] Conventional primer and probe design strategies only consider their own parameters and do not take into account their interaction with PTCD. Even when the requirement to avoid PTCD is mentioned, specific parameters are not provided. This technical solution innovatively introduces a series of parameter thresholds for PTCD-primer and probe interaction, filling the gap in primer and probe design and ensuring universality and specificity under different template backgrounds. This method is applicable to the detection of gene expression and gene mutations in different species.
[0042] 3. Possesses a wide range of application scenarios and technological scalability
[0043] This technical solution is not only applicable to various PCR applications such as singleton fluorescent qPCR, multiplex fluorescent qPCR, and digital PCR, but also compatible with fields such as gene expression analysis and gene mutation detection. Furthermore, its standardized workflow design allows it to be integrated with new technologies such as CRISPR, single-cell sequencing, and NGS, offering broad potential for technological expansion.
[0044] 4. It lowers the technical threshold and provides the possibility for the development of system automation.
[0045] The PTCD prediction and parameter optimization strategies proposed in this technical solution can all be accomplished using various computer tools without requiring the design of complex mathematical models, making it easy for beginners to quickly master. Furthermore, the models and processes involved in the solution have the potential to be coded into automated design software, which is expected to further improve work efficiency and promote the popularization and application of the technology.
[0046] In summary, this technical solution, based on PTCD, breaks through the bottleneck of primer and probe design, significantly improves the amplification efficiency and detection sensitivity of multiplex qPCR and dPCR, and has important technological innovation and application value. Attached Figure Description
[0047] Figure 1 This study presents PTCD information for the candidate amplicon region of gene 1_KPNA6 (NM_012316.4) and the relationship between primers, probes, and PTCD.
[0048] Figure 2 This study presents the PTCD information of the candidate amplicon region of gene 2_GNA15 (NM_002068.4) and the relationship between primers, probes and PTCD.
[0049] Figure 3 This study presents the PTCD information of the candidate amplicon region of gene 3_RREB1 (NM_001003699.4) and the relationship between primers, probes and PTCD.
[0050] Figure 4This study presents the PTCD information of the candidate amplicon region of gene 4_IFTAP (NM_001276722.2) and the relationship between primers, probes and PTCD.
[0051] Figure 5 This study presents the PTCD information of the candidate amplicon region of gene 5_CIT(NM_001206999.2) and the relationship between primers, probes and PTCD.
[0052] Figure 6 This study presents the PTCD information of the candidate amplicon region of gene 6_DEFA4 (NM_001925.3) and the relationship between primers, probes and PTCD.
[0053] Figure 7 This study presents the PTCD information of the candidate amplicon region of gene 7_LY86 (NM_004271.3) and the relationship between primers, probes and PTCD.
[0054] Figure 8 This study provides PTCD information for the candidate amplicon region of gene 8_FCER1A (NM_001387280.1) and the relationship between primers, probes, and PTCD.
[0055] Figure 9 This study provides PTCD information for the candidate amplicon region of gene 9_CDIPT(NM_006319.5) and the relationship between primers, probes, and PTCD.
[0056] Figure 10 This study presents the PTCD information of the candidate amplicon region of gene 10_TGFBI(NM_000358.3) and the relationship between primers, probes and PTCD.
[0057] Figure 11 This is a fluorescent qPCR amplification curve based on the patented primer and probe design.
[0058] Figure 12 This is a fluorescence signal detection diagram of dPCR based on a patented primer-probe design.
[0059] Figure 13 The PTCD information of the candidate amplicon region of Ctrl-KPNA6 (NM_012316.4) and the relationship between primers, probes and PTCD are presented.
[0060] Figure 14 The PTCD information of the candidate amplicon region of Ctrl-GNA15 (NM_002068.4) and the relationship between primers, probes and PTCD are shown.
[0061] Figure 15 The PTCD information of the candidate amplicon region of Ctrl-RREB1(NM_001003699.4) and the relationship between primers, probes and PTCD are provided.
[0062] Figure 16 The amplification curves of the experimental group and the control group in the singlet fluorescent qPCR system of Example 2 are shown.
[0063] Figure 17 The amplification curves of the experimental group and the control group in the multiplex fluorescent qPCR system of Example 2 are shown.
[0064] Figure 18 The standard curves for the experimental and control groups in Example 2 are shown in singlet and multiplex fluorescent qPCR systems.
[0065] Figure 19 The droplet fluorescence distribution in the singlet dPCR system for the experimental and control groups in Example 3 is shown.
[0066] Figure 20 The droplet fluorescence distribution in the experimental and control groups of Example 3 in a one-step multiplex dPCR system. Note: Figure 1-10 and Figure 13-14 The middle arrow symbol "→" represents the 5'→3' direction of the nucleic acid strand. Detailed Implementation
[0067] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.
[0068] Unless otherwise specified, the test methods in the following embodiments are conventional methods, and the test materials used in the following embodiments are all available through conventional commercial channels.
[0069] Example 1: Using the method of this patent, a primer-probe combination with high PCR amplification efficiency was designed.
[0070] A. Overview of Experimental Design
[0071] Based on single-pair fluorescent qPCR and single-pair dPCR detection systems, a single-arm experiment was established to evaluate the PCR amplification efficiency of the primer-probe combination designed in this patented method, so as to verify its technical feasibility.
[0072] B. Target sequence and biological characteristics
[0073] Target selection: Ten clinically significant immune response marker genes were selected as the detection targets, covering high / medium / low expression levels to enhance the generalizability of the results. The mRNA sequence information of genes 1-10 was obtained from the NCBI nucleic acid database, as shown in Table 1 (some mRNA sequences are long (>7000bp), so only the biological characteristics and expression levels of the targets are described).
[0074] Table 1. mRNA sequence information of genes 1-10 obtained from the NCBI nucleic acid database
[0075]
[0076]
[0077] C. Using the method of this patent, design experimental strategies for primer-probe combinations.
[0078] (1) The kinetic folding model (AlleleID 7 software) was used to simulate the sequence at the annealing temperature (60℃) of the PCR experiment.
[0079] Download PTCD information, and set the conditions to meet the following requirements:
[0080] 1) Within the flanking regions extending 200 bp from the 5' and 3' ends of the candidate region, the number of single-strand nonlinear conformations (including hairpin structures, stem-loop structures, and G-quadruplexes) is ≤3;
[0081] 2) The CG bases in the candidate region are ≤55%, and candidate amplicon regions are selected based on this.
[0082] (2) Based on the candidate amplicon regions selected in (1), primers and probes were designed using the NCBI Primer-Blast tool; and
[0083] The following principles were used to select combinations that meet the cooperation requirements between PTCD and primers / probes: The screening criteria are as follows:
[0084] 1) The complementary matching length between the last 5 bases of the 3' end of the primer and any PTCD conformation in the candidate region is <3bp;
[0085] 2) The complementary matching free energy between the full sequence of the probe and any PTCD conformation in the candidate region is > -5 kcal / mol, meaning that the full sequence of the fluorescent probe does not have any complementary relationship with any PTCD in the amplicon.
[0086] 3) The last three bases at the 3' end of the primer do not contain consecutive homologous dinucleotides AA or TT;
[0087] 4) The complementary matching length between the initial 5 bases at the 5' end of the primer and any PTCD conformation in the candidate region is less than 3 bp.
[0088] (3) Verify PCR specificity using in silico PCR tools:
[0089] 1) Use the primer-probe combination designed with the SnapGene tool to verify its characteristics and ensure that there are no adverse factors such as hairpin structures or primer dimers, and that it meets the design requirements;
[0090] 2) The primer-probe combination designed using UCSC In-Silico PCR and MFEprimer 4.2 tools was used to verify its characteristics and predict the specificity of the amplification products.
[0091] D. Using the method of this patent, candidate amplification regions are screened.
[0092] Using a kinetic folding model (AlleleID 7 software), the PTCD information of the sequence at the PCR annealing temperature (60℃) was simulated, and the candidate amplicon regions selected according to the requirements were as follows:
[0093] (1) Gene 1_KPNA6(NM_012316.4): Candidate amplicon start position 1151-1350bp, CG% = 48%, contains 2 PTCD structures, details are as follows Figure 1 As shown.
[0094] (2) Gene 2_GNA15(NM_002068.4): Candidate amplicon start position 1051-1250bp, CG% = 51%, contains 1 PTCD structure, details are as follows Figure 2 As shown.
[0095] (3) Gene 3_RREB1(NM_001003699.4): Candidate amplicon start position 741-940bp, CG% = 53%, contains 3 PTCD structures, details are as follows Figure 3 As shown.
[0096] (4) Gene 4_IFTAP(NM_001276722.2): Candidate amplicon start position 711-910bp, CG% = 42%, contains 1 PTCD structure, details are as follows Figure 4 As shown.
[0097] (5) Gene 5_CIT(NM_001206999.2): Candidate amplicon start position 5311-5510bp, CG% = 47%, contains 1 PTCD structure, details are as follows Figure 5 As shown.
[0098] (6) Gene 6_DEFA4(NM_001925.3): Candidate amplicon start position 181-380bp, CG% = 52%, contains 2 PTCD structures, details are as follows Figure 6 As shown.
[0099] (7) Gene 7_LY86(NM_004271.3): Candidate amplicon start position 281-480bp, CG% = 44%, PTCD
[0100] It contains one PTCD structure, details are as follows Figure 7 As shown.
[0101] (8) Gene 8_FCER1A(NM_001387280.1): Candidate amplicon start position 461-660bp, CG% = 44%, contains 1 PTCD structure, detailed information as follows Figure 8 As shown.
[0102] (9) Gene 9_CDIPT(NM_006319.5): Candidate amplicon start position 701-900bp, CG% = 54%, containing 1
[0103] Each PTCD structure, details are as follows: Figure 9 As shown.
[0104] (10) Gene 10_TGFBI(NM_000358.3): Candidate amplicon start position 1201-1400bp, CG% = 49%, contains 1 PTCD structure, details are as follows Figure 10 As shown.
[0105] E. Design primer-probe combinations and verify PCR specificity using in silico PCR tools.
[0106] Using the method described in this patent, primers and probes were designed using the NCBI Primer-Blast tool, and the selected primer and probe combinations are as follows:
[0107] (1) Gene 1_KPNA6(NM_012316.4)
[0108] Upstream primer (1177-1197bp): 5'-AGGGCTCAAATACAGGCTGTT-3' (CG% = 47.62%, Tm = 60.17℃)
[0109] Downstream primer (1287-1304bp): 5'-GTTCCTCCTGATGTGGCA-3' (CG% = 55.56%, Tm = 58.02℃)
[0110] Fluorescent probe (1212-1238bp): 5'-FAM-CTTCCCTGTGTTG+ATCG+AAATCCTTCA-BHQ1-3' (CG% = 44.44%, Tm = 67.88℃, the + at the beginning of the bases indicates locked nucleic acid)
[0111] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 1 As shown.
[0112] (2) Gene 2_GNA15(NM_002068.4)
[0113] Upstream primer (1149-1169bp): 5'-AACAACCAGGAGAACCGCA-3' (CG% = 52.63%, Tm = 59.98℃)
[0114] Downstream primer (1211-1232bp): 5'-CGGATGTGCTTTTGAACCAGG-3' (CG% = 52.38%, Tm = 60.58℃)
[0115] Fluorescent probe (1173-1197bp): 5'-FAM-AGGAGAGCCTCGCATTGTTTGGGAC-BHQ1-3' (CG% = 56.00%, Tm = 68.59℃)
[0116] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 2 As shown.
[0117] (3) Gene 3_RREB1(NM_001003699.4)
[0118] Upstream primer (794-813bp): 5'-CATGCAC+AGAC+ATATGAAGA-3' (CG% = 40.00%, Tm = 57.99℃, the + at the beginning of the bases indicates locked nucleic acid)
[0119] Downstream primer (859-889bp): 5'-ACAATCGCCTACGTTTCAGAG-3' (CG% = 47.62%, Tm = 58.89℃)
[0120] Fluorescent probe (835-855bp): 5'-FAM-CCTAACAGTGCCACAGCCACAG-BHQ1-3' (CG% = 59.09%, Tm = 68.17℃)
[0121] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 3 As shown.
[0122] (4) Gene 4_IFTAP(NM_001276722.2)
[0123] Upstream primer (773-794bp): 5'-ACGGAAGAGATACTTGGAGATG-3' (CG% = 45.45%, Tm = 57.58%℃)
[0124] Downstream primer (866-890bp): 5'-GCTCTTTGATGTTCTCTATCTCTGC-3' (CG% = 44.00%, Tm = 60.07℃)
[0125] Fluorescent probe (831-857bp): 5'-FAM-ATGACAATGTGATGCTAACCTC CAAGT-BHQ1-3' (CG% = 40.74%, Tm = 66.43℃)
[0126] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 4 As shown.
[0127] (5) Gene 5_CIT(NM_001206999.2)
[0128] Upstream primer (5380-5402bp): 5'-CATCCGGAAAGAGATAGAGACCT-3' (CG% = 47.83%, Tm = 59.38℃)
[0129] Downstream primer (5470-5491bp): 5'-CGTGTACTGCTTCATGTCGATT-3' (CG% = 45.45%, Tm = 59.58℃)
[0130] Fluorescent probe (5409-5434bp): 5'-FAM-CCTGCAGCTGTATCCACTTCAC CAAT-BHQ1-3' (CG% = 50.00%, Tm = 68.71%℃)
[0131] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 5 As shown.
[0132] (6) Gene 6_DEFA4(NM_001925.3)
[0133] Upstream primer (256-276bp): 5'-CAGGTTTCAGGCTCAACAAGG-3' (CG% = 52.38%, Tm = 59.90℃)
[0134] Downstream primer (341-361bp): 5'-TGAAACTCACACCACCAATGA-3' (CG% = 42.86%, Tm = 58.22℃)
[0135] Fluorescent probe (313-339bp): 5'-FAM-CGAACAGAACTTCGTGTTGGG AACTGC-BHQ1-3' (CG% = 51.85%, Tm = 67.11℃)
[0136] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 6 As shown.
[0137] (7) Gene 7_LY86(NM_004271.3)
[0138] Upstream primer (348-370bp): 5'-TCTGCCCAAGTTTTCTTTCTGT-3' (CG% = 40.91%, Tm = 58.88℃)
[0139] Downstream primer (427-451bp): 5'-CTGGTATTCTCCCTGAGGAATAGTA-3' (CG% = 44.00%, Tm = 59.23℃)
[0140] Fluorescent probe (382-408bp): 5'-FAM-AGGAGAGCAGATTTACTATGCT GGGCC-BHQ1-3' (CG%=51.86%, Tm=69.63°C)
[0141] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 7 As shown.
[0142] (8) Gene 8_FCER1A(NM_001387280.1)
[0143] Upstream primer (544-564bp): 5'-GAACCTACTACTGTACGGGCA-3' (CG% = 52.38%, Tm = 59.42℃)
[0144] Downstream primer (615-632bp): 5'-CTTCTCACGCGGAGCTTT-3' (CG% = 55.56%, Tm = 58.20℃) Fluorescent probe (583-609bp): 5'-FAM-ATGAGTCTGAGCCCCTCAA CATTACTG-BHQ1-3'
[0145] (CG%-48.15%, Tm=67.88℃)
[0146] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 8 As shown.
[0147] (9) Gene 9_CDIPT(NM_006319.5)
[0148] Upstream primer (786-803bp): 5'-TGCTCTGTTCACCTTGTG-3' (CG% = 50.00%, Tm = 57.23℃)
[0149] Downstream primer (860-880bp): 5'-GTCCCACAGAGCCAACTAAAG-3' (CG% = 52.38%, Tm = 59.08℃)
[0150] Fluorescent probe (815-841bp): 5'-FAM-AGCTCTTCTACTGCCTCCTCT ACCTGT-BHQ1-3' (CG% = 51.85%, Tm = 68.53℃)
[0151] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 9 As shown.
[0152] (10) Gene 10_TGFBI(NM_000358.3)
[0153] Upstream primer (1268-1288bp): 5'-CGGCAATCATCTCTCTGGAAG-3' (CG% = 52.38%, Tm = 59.02℃)
[0154] Downstream primer (1326-1345bp): 5'-GGAGGGGTTCCATCTTTGAATAC-3' (CG% = 47.83%, Tm = 59.32℃)
[0155] Fluorescent probe (1296-1320bp): 5'-FAM-TTGACCCTCCTGGCTCCCCTGAAT-BHQ1-3' (CG% = 58.33%, Tm = 68.14℃)
[0156] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 10 As shown.
[0157] (11) Verify PCR specificity using in silico PCR tools.
[0158] The designed primer-probe combination was validated using the SnapGene tool to ensure it was free of hairpin structures, primer dimers, and other adverse factors, meeting design requirements. The UCSC In-Silico PCR and MFEprimer 4.2 tools were then used to validate the characteristics of the designed primer-probe combination and predict the specificity of the amplification products. The primers and probes in the designed primer-probe combination passed the validation, indicating no risk of non-specific amplification.
[0159] F. Using a fluorescent qPCR system, verify the dynamic amplification efficiency of primer and probe combinations in PCR.
[0160] (1) Experimental method:
[0161] 3) Preparation of linear DNA standards: Linear DNA standards were synthesized using chemical synthesis methods and diluted to the ideal concentration with nuclease-free water for use in subsequent singleton qPCR experiments;
[0162] 4) Prepare single-color fluorescent qPCR reaction system according to experimental requirements (Table 2);
[0163] 5) After completing the preparation of the fluorescent qPCR reaction system, set up and run the qPCR instrument. The qPCR reaction conditions are shown in Table 3.
[0164] 6) Examine the amplification curve and evaluate the PCR amplification efficiency; calculate the threshold cycle number (Ct value) to evaluate the PCR amplification efficiency and reaction sensitivity.
[0165] Table 2. Single-fluorescent qPCR reaction system
[0166] Components Volume of each reaction <![CDATA[TaqMan TM Premixed liquid 10μl ROX reference dye 0.4μl 10μM upstream primer 1.8μl 10μM upstream primer 1.8μl 10μM fluorescent probe 0.5μl Nuclease-free water 3.5μl <![CDATA[DNA (1X10 7 copies / μL or 1X10 6 copies / μL)]]> 2μl Total volume 20μl
[0167] Table 3. qPCR reaction conditions
[0168]
[0169]
[0170] (2) Experimental results:
[0171] 1) Use amplification curves to evaluate the dynamic amplification results of PCR: such as Figure 11 As shown, the 10 sets of probes and primers designed by this patent method all exhibited a single and steep exponential growth curve of fluorescence signal when detecting DNA standards of different genes, and the amplification curve showed a typical "S" shape and reached the upper plateau phase, indicating that the primer and probe combinations used in the amplification process have high specificity and PCR amplification efficiency.
[0172] 2) Among them, the slope of the exponential growth curve of RREB1 is relatively flat compared to the other 9 genes. The speculated reason is that the RREB1 gene itself has a higher CG% percentage, therefore the number of PTCDs (3) in its amplicon region is also higher than that of other genes (≤2). This also proves the necessity of amplicon screening and controlling the number of PTCDs within it. Since the RREB1 candidate amplicon region contains 3 PTCDs, two additional constraints were added when designing this primer probe: (A)
[0173] (A) The last three bases at the 3' end of the primer do not contain consecutive AA or TT; (B) The complementary matching length between the initial five bases at the 5' end of the primer and PTCD is less than 3 bp. Under these constraints, the exponential growth curve of RREB1 also exhibits a typical "S" shape.
[0174] The formation of the plateau phase also suggests that even when amplifying templates with high CG%, excellent PCR amplification efficiency can be maintained after increasing the restrictions on primer-probe-PTCD interactions.
[0175] G. Using a dPCR system, verify the PCR amplification efficiency of the primer and probe combination.
[0176] (1) Test methods
[0177] 1) Preparation of linear DNA standards: Linear DNA standards were synthesized using chemical synthesis methods and diluted to the ideal concentration with nuclease-free water for use in subsequent singlet dPCR experiments;
[0178] 2) Prepare singleton dPCR reaction systems according to experimental requirements (Table 4);
[0179] 3) After completing the preparation of the singlet dPCR reaction system, set up and run the dPCR instrument. The specific singlet dPCR reaction conditions are shown in Table 5.
[0180] 4) Check the resolution of fluorescence signals and evaluate dPCR amplification efficiency: Calculate the average copy number of each reaction unit using the Poisson distribution formula to evaluate dPCR amplification efficiency and reaction sensitivity.
[0181] Table 4. Singlet dPCR reaction system
[0182]
[0183]
[0184] Table 5. Singlet dPCR reaction conditions
[0185]
[0186] (2) Test Results
[0187] like Figure 12 As shown, in the singlet dPCR experiment, for DNA standards of different genes (all 1000 copies / μL), the probes and primers designed by this patented method could detect positive fluorescent signals and achieve clear separation from negative signals. No obvious raindrop phenomenon was observed. The success rate of probe and primer design by this method is 100%.
[0188] As shown in Table 6, the corresponding copy numbers of the probes and primer combinations designed using this patented method were calculated, and the deviations in detection recovery rates between the detected values and the preset values (1000 copies / μL) were all between 90% and 110%. Note: The primers and probes designed using this method possess stable dPCR amplification efficiency.
[0189] Table 6. Results and recovery rate analysis of singlet dPCR assays using patented primer and probe design.
[0190]
[0191]
[0192] H. Conclusion
[0193] The method proposed in this application, through optimized primer and probe design, circumvents the secondary structure of the target nucleic acid, enabling the stable generation of highly efficient amplification elements and improving the efficiency and sensitivity of singlet fluorescent qPCR and dPCR. Dual-system validation showed a 100% success rate, demonstrating the feasibility and effectiveness of this patented solution and suggesting its potential for widespread application in gene expression analysis, gene mutation detection, and other fields.
[0194] Example 2: Comparative Study of Primers Designed Using the Patented Method and Conventional Methods in a Fluorescent qPCR System A. Overview of Experimental Design
[0195] Design parallel control experiments and use single and multiplex fluorescent qPCR systems to complete the detection performance study of the method of this patent (including PCR amplification efficiency, repeatability, accuracy and detection range, etc.) to verify the technical advantages of this patent in complex qPCR systems (multi-target parallel).
[0196] (1) Patented method test group
[0197] Primers and probes were designed using the method described in Example 1 of this patent. Three immunoreaction markers (one each for high, medium, and low expression levels) were selected to construct a validation model with more than four gradient expression characteristics. The expression levels were measured and compared with conventional design methods to evaluate the amplification efficiency and sensitivity of singleton and multiplex fluorescent qPCR.
[0198] (2) Control group 1 (to verify the necessity of amplicon screening)
[0199] Primers and fluorescent probes were designed using conventional methods, targeting highly complex amplicon regions (PTCD>3, CG%>55%). The designed primer-probe combinations should not exhibit the PTCD-primer-probe interactions restricted by this patent. Due to the limited PCR amplicon length (<200bp), candidate regions meeting the PTCD>3 requirement are relatively rare; therefore, only one typical target was selected for inclusion in this study.
[0200] (3) Control group 2 (verifying the necessity of optimizing the interaction relationship)
[0201] Using conventional primer-probe methods, appropriate primer-probe combinations were designed for low-complexity amplicon regions (PTCD ≤ 3, CG% ≤ 55%). The primers and probes must exhibit an interaction between the PTCD and the primer / probe. Two other typical targets were selected for inclusion in this group.
[0202] (4) Verification Platform
[0203] The detection performance of the experimental group and the control group in parallel detection of multiple targets was tested using singlet qPCR (with DNA standards diluted in more than 4 gradients as detection templates) and multiplex fluorescent qPCR system (with healthy human cell cDNA samples diluted in more than 4 gradients as detection templates).
[0204] (5) Experimental evaluation strategy:
[0205] The amplification efficiency of dynamic PCR was evaluated using amplification curves; the detection performance of quantitative PCR was evaluated using standard curves, coefficient of variation, and detection linear range.
[0206] B. Design primers and probes, and use in silico tools to evaluate PCR specificity.
[0207] (1) Patented method test group
[0208] The experimental group used the method in Example 1 to design primers and probes, and obtained 3 sets of primer-probe combinations (KPNA6, GNA15, RREB1). The naming rule for each gene was "Test-gene name".
[0209] 1)Test_KPNA6(NM_012316.4)
[0210] The candidate amplicon starts at 1151-1350 bp, has a CG% of 48%, and contains two PTCD structures.
[0211] Upstream primer (1177-1197bp): 5'-AGGGCTCAAATACAGGCTGTT-3' (CG% = 47.62%, Tm = 60.17℃)
[0212] Downstream primer (1287-1304bp): 5'-GTTCCTCCTGATGTGGCA-3' (CG% = 55.56%, Tm = 58.02℃)
[0213] VIC-labeled fluorescent probe (1212-1238bp): 5'-VIC-CTTCCCTGTGTTG+ATCG+AAATCCTTCA-BHQ1-3' (CG% = 44.44%, Tm = 67.88℃, the + at the beginning of the bases indicates locked nucleic acid)
[0214] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 1 As shown.
[0215] 2) Test_GNA15(NM_002068.4)
[0216] The candidate amplicon starts at 1051-1250 bp, has a CG% of 51%, and contains one PTCD structure.
[0217] Upstream primer (1149-1169bp): 5'-AACAACCAGGAGAACCGCA-3' (CG% = 52.63%, Tm = 59.98℃)
[0218] Downstream primer (1211-1232bp): 5'-CGGATGTGCTTTTGAACCAGG-3' (CG% = 52.38%, Tm = 60.58℃)
[0219] Cy5-labeled fluorescent probe (1173-1197bp): 5'-Cy5-AGGAGAGCCTCGCATTGTTTGGGAC-BHQ3-3' (CG% = 56.00%, Tm = 68.59℃)
[0220] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 2 As shown.
[0221] 3)Test_RREB1(NM_001003699.4)
[0222] The candidate amplicon starts at 741-940 bp, has a CG% of 53%, and contains three PTCD structures.
[0223] Upstream primer (794-813bp): 5'-CATGCAC+AGAC+ATATGAAGA-3' (CG% = 40.00%, Tm = 57.99℃, the + at the beginning of the bases indicates locked nucleic acid)
[0224] Downstream primer (859-889bp): 5'-ACAATCGCCTACGTTTCAGAG-3' (CG% = 47.62%, Tm = 58.89℃)
[0225] FAM-labeled fluorescent probe (835-855bp): 5'-FAM-CCTAACAGTGCCACAGCCACAG-BHQ1-3' (CG% = 59.09%, Tm = 68.17℃)
[0226] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 3 As shown.
[0227] (2) Control group 1:
[0228] KPNA6 was selected as the control group target to validate the necessity of amplicon screening. The candidate amplicon regions selected in this group contain four PTCD structures. The naming convention for each gene in this group is "Ctrl-gene name".
[0229] 1)Ctrl_KPNA6(NM_012316.4)
[0230] The candidate amplicon starts at 801-1000 bp, has a CG% of 56%, and contains 4 PTCD structures.
[0231] Upstream primer (820-840bp): 5'-AAGGTCTCTCCTTGTTTGCCT-3' (CG% = 47.62%, Tm = 59.75℃)
[0232] Downstream primer (924-945bp): 5'-GACTGCCTGGATCTTCTCATTG-3' (CG% = 50.00%, Tm = 59.31℃)
[0233] VIC-labeled fluorescent probe (852-877bp): 5'-VIC-CCTACTCTTCAGCAGCGACTCGGACT-BHQ1-3' (CG% = 57.69%, Tm = 68.02℃)
[0234] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 13 As shown.
[0235] (3) Control group 2:
[0236] GNA15 and RREB1 were selected as control group targets to verify the necessity of interaction optimization. The naming convention for each gene in this group is "Ctrl-gene name".
[0237] 1) Ctrl-GNA15(NM_002068.4)
[0238] The candidate amplicon starts at 1271-1470 bp, has a CG% of 55%, and contains two PTCD structures.
[0239] Upstream primer (1309-1327bp): 5'-TTTCCAGGGCCCTAAGCAG-3' (CG% = 57.89%, Tm = 59.82℃)
[0240] Downstream primer (1423-1439bp): 5'-TGAAGAGGCGTCGGGAT-3' (CG% = 58.82%, Tm = 57.96℃)
[0241] Cy5 fluorescent probe (1364-1389bp): 5'-Cy5-AGGAGAGCCTCGCATTGTTTGGGAC-BHQ3-3' (CG% = 57.69%, Tm = 69.86℃)
[0242] The relationship between primers, probes, and candidate amplicon PTCD is as follows: Figure 14 As shown.
[0243] 2) Ctrl-RREB1(NM_001003699.4)
[0244] The candidate amplicon starts at 5001-5200 bp, has a CG% of 55%, and contains three PTCD structures.
[0245] Upstream primer (5061-5081bp): 5'-CAGCAAGGCAGACAAGAGGAA-3' (CG% = 58.00%, Tm = 60.22℃)
[0246] Downstream primer (5150-5167bp): 5'-ATGGCCTTTCCCCTGTGT-3' (CG% = 55.56%, Tm = 58.90℃)
[0247] FAM fluorescent probe (5098-5119bp): 5'-FAM-TGCAACAAGCGGTTCTGGTCGC-BHQ1-3' (CG% = 59.09%, Tm = 68.14℃)
[0248] The relationship between primers, probes, and candidate amplicon (CG% = 55.00%) PTCD is as follows: Figure 15As shown.
[0249] (4) Use in silico PCR tools to verify PCR specificity.
[0250] 1) Method:
[0251] The primers and probes of the experimental and control groups were characterized using SnapGene and MFEprimer 4.2 tools to ensure the absence of adverse factors such as hairpin structures and primer dimers. The primers and probes of the experimental and control groups were computer-simulated and verified using UCSC In-Silico PCR and MFEprimer 4.2 tools to predict the specificity of the amplification products.
[0252] 2) Results:
[0253] The primers and probes of the experimental and control groups were verified by computer simulation. The primers and probes of each group passed the verification and there was no risk of non-specific amplification.
[0254] C. The detection performance of each primer and probe group was verified using singlet and multiplex fluorescent qPCR systems.
[0255] (1) Preparation of linear DNA standards: Linear DNA standards were synthesized using chemical synthesis methods and diluted to the ideal concentration.
[0256] For use in subsequent singleton qPCR experiments;
[0257] (2) Preparation of human genomic cDNA test samples: 100 million human peripheral blood nucleated cells were taken, and RNA was extracted according to the operating procedure of the RNA extraction kit; the quality and concentration of RNA were evaluated by Nanodrop;
[0258] (3) Take a sample that meets the RNA quality assessment standard, complete the cDNA transcription according to the operating procedure of the cDNA reverse transcription kit, and dilute it for later use;
[0259] (4) Prepare the fluorescent qPCR reaction system (Table 7) according to the experimental requirements. To evaluate the amplification efficiency and sensitivity of qPCR, set up serially diluted DNA or cDNA templates, with a dilution range covering 2.70 × 10⁻⁶. 0 ~2.70×10 -4 ng / μL. The system using one primer / probe combination with a DNA template is for the singlet fluorescence qPCR evaluation platform; the system using three primer / probe combination with a cDNA template is for the multiplex fluorescence qPCR evaluation platform.
[0260] (5) After completing the preparation of the fluorescent qPCR reaction system, set up and run the qPCR instrument. The specific qPCR reaction conditions are shown in Table 8.
[0261] (6) Check the amplification curve and evaluate the PCR amplification efficiency: calculate the threshold cycle number (Ct value) and evaluate the PCR amplification efficiency; (7) Calculate the threshold cycle number (Ct value) and evaluate the PCR amplification efficiency and reaction sensitivity.
[0262] Table 7. Fluorescent qPCR reaction system
[0263] Components Volume of each reaction <![CDATA[TaqMan TM Premixed liquid 10μl ROX reference dye 0.4μl 10μM upstream primer (1 or 3 primers) 1.8μl 10μM upstream primer (1 or 3 primers) 1.8μl 10μM fluorescent probes (1 or 3 strips) 0.5μl Nuclease-free water 3.5μl <![CDATA[DNA or cDNA template (2.70X10 0 ~2.70X10 -4 ng / μL)]]> 2μl Total volume 20μl
[0264] Table 8. qPCR reaction conditions
[0265]
[0266] D. Test Results
[0267] (1) Amplification curves are used to evaluate dynamic amplification efficiency.
[0268] 1) Evaluation criteria:
[0269] When the amplification curve shows a clear "S" shape and has a single, steep exponential growth curve of fluorescence signal, it indicates that the PCR reaction is proceeding normally and the amplification efficiency is high.
[0270] 2) Results:
[0271] like Figure 16 The results showed that in the singlet qPCR system, regardless of which gene's DNA standard was being detected, especially when detecting standards at low concentrations (e.g., 10–100 copies / μL), a single and steep exponential growth curve of fluorescence signal was observed in all three sets of probes and primers (experimental group) designed using the method of this patent, and the amplification curve exhibited a distinct "S" shape. However, primers and probes designed using conventional methods, whether in control group one or control group two, did not show a distinct S-shaped amplification curve when detecting low concentration standards (e.g., 10–100 copies / μL), and the curve overlap was poor.
[0272] In addition, such as Figure 17 Results A show that in the multiplex qPCR system, the three sets of probes and primers designed using this patented method (experimental group) all exhibited a clear "S"-shaped amplification curve in the same multiplex PCR tube; however, the primers and probes designed using conventional methods (control group) did not show a clear S-shaped amplification curve. Because different fluorescent groups were used to detect the three target genes, inconsistencies in the intensity of the plateau phase occurred when analyzing multiplex data simultaneously. Therefore, data using the same fluorescent label will be compared one by one in subsequent analyses (see details). Figure 17 B-17D).
[0273] Using Cy5, VIC, and FAM fluorescent labeling as grouping rules, a comparison of the performance of the experimental and control groups in detecting the same target revealed that the cDNA sample concentration at 2.7 × 10⁻⁶ was significantly better. -2 ~2.7×10 -4 At ng / μL, a single and steep exponential growth curve of fluorescence signal was still observed in the experimental group, and the amplification curve showed a clear "S" shape. However, no obvious S-shaped amplification curve was observed in either control group 1 or control group 2, and the curves had poor overlap (see details). Figure 17 (B-17D). This suggests that probes and primers designed using this patented method have higher amplification efficiency in singleton or multiplex qPCR reactions.
[0274] (2) Standard curves are used to quantitatively assess amplification efficiency.
[0275] 1) Evaluation criteria:
[0276] Plot a standard curve with the logarithm of the standard concentration (lgX) on the x-axis and Ct values on the y-axis. Fit the standard curve using a linear fitting method (such as the least squares method) to obtain the linear equation y = kx + b, where k is the slope. k reflects the amplification efficiency. Ideally, the slope should be between -3.58 and -3.1. The amplification efficiency can be calculated using the formula: E = 10(-1 / slope) - 1. An amplification efficiency between 90% and 110% represents acceptable amplification efficiency.
[0277] 2) Results:
[0278] like Figure 18 As shown in Tables 9 and 10, regardless of which gene's DNA standard was being detected, the slopes of the standard curves obtained using the three sets of probes and primers designed under this patented method (experimental group) ranged from -3.583 to -3.273; while the slopes of the control group standard curves ranged from -3.735 to -3.076. This indicates that the slope range of the experimental group is closer to the ideal slope of -3.32. Furthermore, the amplification efficiency of the experimental group, calculated using the formula, ranged from 90.15% to 102.81%; while the amplification efficiencies of control groups one and two ranged from 85.24% to 111.40%. This demonstrates that the amplification efficiencies of the experimental group were all between 90% and 110%, exhibiting excellent amplification efficiency. Moreover, the advantages of this patented method are even more pronounced in multiplex qPCR systems.
[0279] Table 9. Comparison of detection results between the experimental group and the control group using the singlet qPCR system.
[0280]
[0281]
[0282]
[0283] Table 10. Comparison of detection results between the experimental group and the control group using the multiplex qPCR system.
[0284]
[0285]
[0286]
[0287] (3) The coefficient of variation (CV) is used to assess the reproducibility of quantitative detection.
[0288] 1) Evaluation criteria:
[0289] Calculate the Ct value based on the amplification curve. Then, use the standard curve to calculate the corresponding sample concentration for the Ct value. The detection concentration CV% of three replicate tests should be less than 10%, indicating that the sample detection repeatability is acceptable.
[0290] 2) Results:
[0291] As shown in Tables 9 and 10, when detecting the same concentration of DNA (singleton qPCR system) or cDNA standards (multiplex qPCR system), the probe and primer combinations designed using this patented method (experimental group) all yielded lower Ct values. Furthermore, using a standard curve to calculate the sample concentration corresponding to the Ct value, it was found that when detecting low concentration samples (e.g., 10 copies / μL DNA or 2.7 × 10⁻⁶), the Ct values were lower. -3 When using ng / μL cDNA, both control group 1 and control group 2 methods showed either no detection or a CV% greater than 10%. However, the experimental groups all met the reproducibility evaluation criteria. This suggests that the probes and primers designed using this patented method exhibit superior reproducibility in singleton or multiplex qPCR reactions.
[0292] (4) Linear detection range is used to evaluate the sensitivity and accuracy of quantitative detection.
[0293] 1) Evaluation criteria:
[0294] When the standard curve covers the concentrations of more than four standards, calculate the coefficient of determination (R²) of the standard curve. 2 R 2 If the value is greater than 0.98 and the CV% of repeatability samples for each concentration is less than 10%, then the range of standard sample concentrations covered is the linear detection range of this method. Where R... 2 The closer to 1, the better the accuracy; the wider the linear detection range, the higher the sensitivity.
[0295] 2) Results:
[0296] like Figure 18 As shown in Table 9, when R is satisfied 2 Under the conditions that the concentration is greater than 0.98 and the CV% of reproducibility for each concentration is less than 10%, the experimental group can cover the detection range of KPNA6, GNA15 and RREB1 by singlet qPCR. 1 ~10 6 The detection range was between copies / μL, while the control group's detection range was only 10. 2 ~10 6 Between copies / μL.
[0297] In addition, such as Figure 18 As shown in Table 10, the experimental group could detect concentrations of KPNA6, GNA15, and RREB1 using multiplex qPCR, all within a range of 2.7 × 10⁻⁶. 0 ~2.7×10 -3 The detection range was ng / μL, while the control group's detection range was only 2.7 × 10⁻⁶ ng / μL. 0 ~2.7×10 -1 ng / μL. This suggests that the probe-primer combination designed using this patented method exhibits a wider detection linearity range in singleton or multiplex qPCR systems, meaning it possesses superior detection sensitivity and accuracy, especially for low-concentration target samples.
[0298] E. Conclusion
[0299] In singleton and multiplex fluorescent qPCR systems, especially in actual clinical use scenarios (multiplex fluorescent qPCR systems), this patented method shows significant advantages over conventional methods, exhibiting higher dynamic amplification efficiency and more robust quantitative performance.
[0300] Example 3: Comparative Study of Primers Designed Using the Patented Method and Conventional Methods in dPCR Systems
[0301] A. Overview of Experimental Design
[0302] Design parallel control experiments and use singlet and multiplex fluorescent dPCR systems to complete the detection performance study (including PCR amplification efficiency and accuracy) of the method of this patent, so as to verify the technical advantages of this patent in complex dPCR systems (multi-target parallel).
[0303] (1) Patented method test group
[0304] Primers and probes were designed using the method described in Example 1 of this patent. Three immunoreaction markers (one each of high, medium, and low expression levels) were selected to construct a validation model with gradient expression characteristics. Expression levels were measured and compared with conventional design methods to evaluate the amplification efficiency and sensitivity of singleton and multiplex fluorescent dPCR.
[0305] (2) Control group 1 (to verify the necessity of amplicon screening)
[0306] Primers and fluorescent probes were designed using conventional methods, targeting highly complex amplicon regions (PTCD>3, CG%>55%). The designed primer-probe combinations should not exhibit PTCD interactions. Due to the limited PCR amplicon length (<200bp), candidate regions meeting the PTCD>3 condition are relatively rare; therefore, only one typical target was selected for inclusion in this study.
[0307] (3) Control group 2 (verifying the necessity of optimizing the interaction relationship)
[0308] Using conventional primer-probe methods, appropriate primer-probe combinations were designed for low-complexity amplicon regions (PTCD ≤ 3, CG% ≤ 55%). The primers and probes must exhibit an interaction between the PTCD and the primer / probe. Two other typical targets were selected for inclusion in this group.
[0309] (4) Verification Platform
[0310] The detection performance of the experimental group and the control group in parallel detection of multiple targets was tested using singlet dPCR (1000 copie / μL DNA standard as detection template) and multiplex fluorescent dPCR system (4 or more gradient dilutions of healthy human cell RNA samples as detection template).
[0311] (5) Trial evaluation strategy
[0312] The separation degree of negative and positive fluorescent droplets (i.e., signal-to-noise ratio) was used to evaluate PCR amplification efficiency; the detection recovery rate was used to evaluate the performance of quantitative PCR.
[0313] B. Design primers and probes, and use in silico tools to evaluate PCR specificity.
[0314] The patented method included three experimental groups, control group 1 and control group 2, with the same gene fragments as in Example 2. The primers and probes for the experimental and control groups were validated using SnapGene and MFEprimer 4.2 to ensure the absence of hairpin structures, primer dimers, and other adverse factors. Computer simulations were performed using UCSC In-Silico PCR and MFEprimer 4.2 to predict the specificity of the amplification products.
[0315] The primers and probes of the experimental and control groups were verified by computer simulation. The primers and probes of each group passed the verification and there was no risk of non-specific amplification.
[0316] C. The detection performance of each primer and probe group was verified using singlet and multiplex fluorescent dPCR systems.
[0317] (1) Preparation of linear DNA standards: Linear DNA standards are synthesized using chemical synthesis methods and diluted to the ideal concentration for use in subsequent single dPCR experiments;
[0318] (2) Preparation of human genomic RNA test sample: Take 10 million human peripheral blood nucleated cells and complete RNA extraction according to the operating procedure of the RNA extraction kit; dilute to the ideal concentration for subsequent multiplex dPCR test;
[0319] (3) Based on experimental requirements, the theoretical detection concentration of the DNA standard was set at 1000 cpoies / μL, and a singlet dPCR reaction system was prepared (Table 11).
[0320] (4) After completing the preparation of the single dPCR reaction system, set up and run the dPCR instrument. The specific single dPCR reaction conditions are shown in Table 12.
[0321] (5) Prepare a one-step multiplex dPCR reaction system according to experimental needs (Table 13); In order to evaluate the amplification efficiency of dPCR when detecting different target concentrations, four concentration gradients of 5, 10, 15 and 20 ng / μL were set to prepare RNA templates for testing.
[0322] (6) After completing the preparation of the one-step multiplex dPCR reaction system, set up and run the dPCR instrument. The specific conditions for the one-step multiplex dPCR reaction are shown in Table 14.
[0323] (7) Check the separation of fluorescence signals and evaluate the dPCR amplification efficiency;
[0324] (8) Calculate the average copy number of each reaction unit using the Poisson distribution formula to evaluate dPCR amplification efficiency and reaction sensitivity.
[0325] Table 11. Singlet dPCR reaction system
[0326] Components Volume of each reaction 5X DNA dPCR Mix 7μl 0.6 μM upstream primer / 0.6 μM downstream primer / 0.2 μM fluorescent probe 0.7μl Nuclease-free water 22.3μl DNA standards (1000 copies / μL) 5μl Total volume 35μl
[0327] Table 12. Singlet dPCR reaction conditions
[0328]
[0329] Table 13. One-step multiplex dPCR reaction system
[0330]
[0331] Table 14. Conditions for one-step multiplex dPCR reaction
[0332]
[0333] D. Test Results
[0334] (1) The degree of separation between negative and positive droplets is used to assess amplification efficiency.
[0335] 1) Evaluation criteria
[0336] The separation of fluorescence signals was examined, showing clear separation between positive and negative fluorescence with no intermediate signals (raindrops). The signal-to-noise ratio (SNR) was calculated by statistically analyzing the average fluorescence intensity of positive and negative droplets, using the formula: average fluorescence intensity of positive droplets / average fluorescence intensity of negative droplets. A higher SNR indicates better separation.
[0337] 2) Results
[0338] like Figure 19 and Figure 20 As shown, in both singlet and multiplex dPCR experiments, regardless of the DNA standard being detected, especially when detecting low-concentration standards, the positive fluorescence signals (shown as red droplets) detected by the three sets of probes and primers (experimental groups) designed using this patented method showed clear separation from the negative fluorescence signals (shown as blue droplets), with no obvious raindrop observed. However, primers and probes designed using conventional methods all exhibited varying degrees of high negative fluorescence signals or overly diffuse positive fluorescence signals.
[0339] As shown in Tables 15 and 16, the signal-to-noise ratio (SNR) results calculated using the formula are as follows: In the singlet dPCR system, the SNR of the experimental group ranged from 3.23 to 36.07, while the SNR of the control group ranged from only 2.53 to 14.70; in the one-step multiplex dPCR system, the SNR of the experimental group ranged from 2.67 to 21.35, while the SNR of the control group ranged from only 2.15 to 8.08. Clearly, the experimental group showed a higher SNR, indicating that the detection resolution (sensitivity) of the experimental group was far superior to that of the control group, meaning it possessed higher amplification efficiency in both singlet and multiplex dPCR reactions.
[0340] Table 15. Comparison of detection results between the experimental group and the control group using the singlet dPCR system.
[0341]
[0342] Table 16. Comparison of detection results between the experimental group and the control group using the one-step multiplex dPCR system.
[0343]
[0344]
[0345] (2) Detection recovery rate is used to evaluate the accuracy of quantitative detection.
[0346] 1) Evaluation criteria
[0347] The quantitative result of the calculated test value should deviate from the preset value. If the deviation is between 95% and 105%, it indicates that the sample test accuracy is qualified.
[0348] 2) Results
[0349] As shown in Table 15, in the singlet dPCR system, when detecting 1000 copies / μL of DNA standard, the recovery rate calculated using the probe and primer combination designed by this patented method (experimental group) was between 96.96% and 102.47%, which met the evaluation requirements, i.e., the deviation between the quantitative result and the preset value was between 95% and 105%. However, the recovery rate calculated by the conventional method (control group) was between 52.94% and 90.19%, and the deviation between its quantitative result and the preset value was larger.
[0350] Furthermore, in the one-step multiplex dPCR system, because RNA samples were used for measurement, accurate theoretical values for the tested samples could not be obtained. However, referring to the results in Table 11 of Example 2, it can be seen that in RNA samples, regardless of the detection method used, the Ct values of the three targets (KPNA6, GNA15, and RREB1) within the highest concentration detection range were relatively close, ranging from 23.77 to 26.30. This suggests that the expression levels of these three targets in biological samples are not significantly different. This situation is consistent with the results of the experimental group, where the detection values within the highest concentration detection range were between 4745.58 and 6127.08. In contrast, the detection values of the control group were between 1040.50 and 5304.74, showing more significant fluctuations, and the values obtained for GNA15 and RREB1 were much lower than those for other targets (see Table 16).
[0351] This suggests that probes and primers designed using this patented method exhibit higher and more stable amplification efficiency, better sensitivity, lower fluctuations, and better accuracy in singleton or multiplex dPCR reactions.
[0352] E. Conclusion
[0353] In both singlet and one-step multiplex dPCR systems, this patented method exhibits significant advantages over conventional methods, demonstrating higher amplification efficiency and more robust absolute quantification performance.
Claims
1. A method for designing multiplex qPCR and dPCR primers and probes based on PCR template dynamic conformation (PTCD), comprising the following steps: S1. Screening amplicon region: input target nucleic acid sequence information, use model to simulate PTCD information of the sequence at PCR experiment annealing temperature; S2. Identify and screen candidate amplicon region, the sequence of which meets the following conditions: S2.1 Within the flanking region of 200 bp at 5' and 3' end of the candidate region, the number of single-stranded nonlinear conformations, including hairpin structure, stem-loop structure and G-quadruplex, is ≤3; S2.2 The CG content of the candidate region is ≤55%; S3. Design primer-probe combination that meets S3.1, S3.2, S3.3 and / or S3.4 conditions based on the interaction between PTCD and primer-probe: S3.1 The length of complementary matching of the last 5 bases at the 3' end of the primer with any PTCD conformation in the candidate region is <3 bp; S3.2 The complementary matching free energy of the whole sequence of the probe with any PTCD conformation in the candidate region is >-5 kcal / mol, i.e. the whole sequence of the probe does not exist complementary condition with any PTCD in the amplicon; S3.3 The last 3 bases at the 3' end of the primer do not contain consecutive homologous dinucleotide AA or TT; S3.4 The length of complementary matching of the initial 5 bases at the 5' end of the primer with any PTCD conformation in the candidate region is <3 bp; S4. Complete the final design by combining conventional primer-probe parameters, including length, Tm value, GC% and dimer formation; S5. Verify PCR specificity by using in silico PCR tool. 2.The method of claim 1, wherein the model in step S1 is selected from steady-state model and / or kinetic folding model. 3.The method of claim 1, wherein the simulation in step S1 is performed by simulation tool selected from one or more of AlleleID 7.3, Beacon Designer and / or NUPACK. 4.The method of claim 1, wherein the model simulation in step S1 is simulation of PTCD at actual experiment setting annealing temperature. 5.The method of claim 4, wherein the accuracy rate of the conformation prediction result of the model is ≥80% when simulating PTCD at actual experiment setting annealing temperature. 6.The method of claim 1, wherein the condition in step S3 is only effective when the number of single-stranded nonlinear conformations in the candidate region meets the threshold value. 7.The method of claim 6, wherein when the threshold value is the number of single-stranded nonlinear conformations in the candidate region is ≤2, the conditions of S3.1 and S3.2 need to be met. 8.The method of claim 6, wherein when the threshold value is the number of single-stranded nonlinear conformations in the candidate region is equal to 3, all the conditions of S3.1-S3.4 need to be met. 9.Application of the method of claim 1 in designing primers and probes.
10. A primer and probe composition obtained by the method of claim 1; the primer and probe composition circumvents the secondary structure of the target nucleic acid; the primer and probe composition of Test_KPNA6, Test_GNA15 and Test_RREB1 are the upstream and downstream primers and probes of the corresponding sequences; specifically as follows: Test_KPNA6: The candidate amplicon starts at 1151-1350 bp, CG%=48%, containing 2 PTCD structures; Upstream primer: 5'- AGGGCTCAAATACAGGCTGTT -3'; Downstream primer: 5'- GTTCCTCCTGATGTGGCA -3'; VIC-labeled fluorescent probe: 5'- VIC-CTTCCCTGTGTTG+ATCG+AAATCCTTCA -BHQ1-3'; the "+" before the bases represents a locked nucleic acid; Test_GNA15: The candidate amplicon starts at 1051-1250 bp, CG%=51%, containing 1 PTCD structure; Upstream primer: 5'- AACAACCAGGAGAACCGCA -3'; Downstream primer: 5'- CGGATGTGCTTTTGAACCAGG -3'; Cy5-labeled fluorescent probe: 5'- Cy5-AGGAGAGCCTCGCATTGTTTGGGAC -BHQ3-3'; Test_RREB1: The candidate amplicon starts at 741-940 bp, CG%=53%, containing 3 PTCD structures; Upstream primer: 5'- CATGCAC+AGAC+ATATGAAGA -3'; the "+" before the bases represents a locked nucleic acid; Downstream primer: 5'- ACAATCGCCTACGTTTCAGAG -3'; FAM-labeled fluorescent probe: 5'-FAM-CCTAACAGTGCCACAGCCACAG-BHQ1-3'.
Citation Information
Patent Citations
Super-multiplex primer design method
CN112687337A
Primer probe design method for improving PCR amplification efficiency
CN113234794A
Method and system for designing ultra-multiple specific PCR (Polymerase Chain Reaction) primer group
CN115851891A
bPrimer batch PCR primer design method based on Primer 3
CN105718759A
Multiple digital PCR primer probe design and evaluation method for target pathogen or drug-resistant gene
CN118782142A