Attenuated vaccine for preventing toxoplasmosis and preparation method thereof
The CRISPR-Cas9 gene editing technology knocked out the Toxoplasma gondii PCNA1 gene to build an attenuated vaccine, solving the problems of long drug treatment and drug resistance in the existing toxoplasma gondii treatment, and achieving long-lasting immune protection and effective Toxoplasma gondii control.
Patent Information
- Application Number
- CN202510623956.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-15
- Publication Date
- 2025-08-29
Smart Images
Figure CN120550098A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of vaccines, discloses an attenuated vaccine for toxoplasmosis, and also provides a preparation method of the vaccine. Background Art
[0002] Toxoplasmosis is caused by Toxoplasma gondii ( Toxoplasma gondii , T. gondii Toxoplasmosis is a worldwide zoonotic parasitic disease caused by the toxoplasmosis toxoplasmosis virus (T. gondii), which infects humans and over 200 animal species. Currently, toxoplasmosis is primarily treated with sulfonamides, but these drugs are characterized by long treatment courses, poor efficacy, high rates of drug resistance, and frequent relapses. Vaccines, primarily inactivated and live attenuated vaccines, are only effective in the prevention and treatment of toxoplasmosis in animals.
[0003] Attenuated vaccines are primarily developed through artificial attenuation or selection, transforming wild parasite strains into non-pathogenic or attenuated strains while retaining protective immunogenicity. These strains are then used to immunize the host, leading to protective immunity. Currently, attenuated vaccines for Toxoplasma gondii, Trypanosoma cruzi, and Dictyocaulus nematodes of cattle and sheep have been successfully developed. With the advancement of CRISPR-Cas9 technology, research has also progressed on attenuated vaccines by deleting virulence genes in parasite strains. Furthermore, knocking out genes associated with virulence to attenuate parasite strains and produce attenuated vaccines is also becoming a trend in attenuated vaccine development. Summary of the Invention
[0004] The purpose of the present invention is to provide a convenient attenuated vaccine for the prevention of toxoplasmosis that is suitable for industrial production, and also discloses a method for preparing the attenuated vaccine for the prevention of toxoplasmosis.
[0005] The attenuated vaccine for toxoplasmosis described in the present invention uses the Toxoplasma RH strain to knock out the Toxoplasma PCNA1 gene through CRISPR-Cas9 gene editing technology to construct a Toxoplasma PCNA1 gene knockout strain (△TgPCNA1) as an attenuated vaccine; the Toxoplasma proliferating cell nuclear antigen 1 gene sequence is as follows: SEQ ID: TGGT1_247460.
[0006] The method for preparing an attenuated vaccine for toxoplasmosis according to the present invention comprises the following steps: The TgPCNA1 gene sequence was searched through the ToxoDB database, and the protospacer sequence containing the PAM sequence structure was found. The protospacer homologous sequences were designed and identified by sequencing. Primers were designed: TgPCNA1-CRISPR-F:tcttgccttgGTTTTAGAGCTAGAAATAGC; TgPCNA1-CRISPR-R:cgaaatggacAACTTGACATCCCCATTTAC; Mix the synthesized primers with the corresponding template for PCR reaction. Take 1 μL of PCR product, add 5 μL of 2× KLD Reaction Buffer, 1 μL of 10× KLD Enzyme Mix, and 3 μL of H2O, mix well, and incubate at room temperature for 5 minutes. Then, DH5-α competent cells were taken and the mixed product was added to the competent cells to successfully construct the pSAG1-Cas9-TgU6-ccdb-sgPCNA1 vector; Based on the gene information provided by the ToxoDB database, a pair of primers were designed in the 5' and 3' UTR regions before and after the open reading frame of the target gene: TgPCNA1-DHFR-F: ATGTTGGAAGCCAAGCTCCAGCTAGAAGCTTCGCCAGGCTGTAAATC; TgPCNA1-DHFR-R: CTCATCCATCATAGAGTCGTCCATGCCCATCCTGCAAGTGCATAGAAGG; Using the pUPRT-DHFR plasmid as a template, PCR amplification of the homologous recombination fragment of the gene was performed, and the obtained PCR products were recovered, sequenced and identified, and stored at -20°C; The above recombinant plasmid and homologous recombination fragment were mixed at 6 μg and 2 μg respectively, and diluted to 100 μl with Cytomix buffer; 7 Mix the mixed sample with 100 μl of Toxoplasma gondii; add the mixed sample to a sterile 4 mm electroporation cuvette pre-cooled at -20°C; and quickly add the sample to HTERT cells containing 1 μM pyrimethamine after electroporation. Then, the cells were passaged into HTERT cells containing 1% FBS and 1 μM pyrimethamine; Single clones were screened and expanded in 96-well plates, and then the worm genome was extracted using a blood / cell / tissue genomic DNA extraction kit; The extracted genome was identified by PCR, Western blot and immunofluorescence.
[0007] Vaccine immune effect testing:
[0008] Mice were immunized with 1000 cells of the prepared △TgPCNA1 strain via intraperitoneal injection. A PBS group and a blank control group were also established. On day 40 after immunization, male and female mice were co-housed and inoculated with wild-type Toxoplasma gondii via intraperitoneal injection for challenge testing. Cytokine levels and survival rates were evaluated.
[0009] The △TgPCNA1 attenuated vaccine used for the prevention of toxoplasmosis can resist the attack of a certain dose of Toxoplasma gondii on mice. The IL-12 secretion reached its peak on the day, and the difference was extremely significant compared with the first day (P<0.001); the IFN-γ reached its peak on the day, and the difference was extremely significant compared with the first day (P<0.001), showing a good anti-Toxoplasma effect.
[0010] In eukaryotic cells, PCNA phosphorylation occurs upon EGFR activation, promoting vital processes such as DNA replication and cell proliferation. Two PCNA proteins exist in Toxoplasma gondii: TgPCNA1 and TgPCNA2. Studies have shown that TgPCNA1 is expressed at higher levels than TgPCNA2. TgPCNA1 is concentrated in the nucleus during all cell cycle stages, while TgPCNA2 is concentrated only in the nucleus during S phase and is evenly distributed throughout the cell during mitosis and early G1 phase. TgPCNA1 has a CRISPR score of -4.69 on the ToxoDB website.
[0011] The positive effects of the present invention are: using CRISPR-cas9 gene knockout technology to prepare attenuated vaccines for the prevention of toxoplasmosis, the attenuated Toxoplasma gondii can reproduce limitedly in the host body, simulate the natural infection process, effectively stimulate cellular immunity and humoral immunity, and provide more comprehensive protection; compared with inactivated vaccines or subunit vaccines, attenuated vaccines can often induce more lasting immunity; attenuated strains contain multiple antigens and can provide cross-protection against similar parasite species or parasites at different developmental stages; using CRISPR-cas9 gene knockout technology to prepare, no complicated antigen purification or adjuvants are required, and it is suitable for promotion in resource-limited areas; preventing toxoplasmosis through immunization can reduce the use of anti-Toxoplasma drugs and alleviate the problem of drug resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 PCR identification of the △TgPCNA1 strain; Figure 2 Western blot identification of the △TgPCNA1 strain; Figure 3 Immunofluorescence identification of △TgPCNA1 strain; Figure 4 Cytokine detection for mice immunized with the △TgPCNA1 strain; Figure 5To detect the survival rate of mice immunized with △TgPCNA1 strain; Figure 6 To detect the parasite load in the viscera of mice immunized with the △TgPCNA1 strain; Figure 7 To test the survival rate of offspring mice immunized with △TgPCNA1 strain; Figure 8 This is to detect the worm load in the viscera of the offspring of mice immunized with the △TgPCNA1 strain. DETAILED DESCRIPTION
[0013] The present invention is further described by way of examples below, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or alteration of the present invention that can be easily implemented by a person skilled in the art will fall within the scope of the claims of the present invention. Example 1
[0014] The TgPCNA1 gene sequence was searched using the ToxoDB database. A protospacer containing a PAM sequence was identified. Homologous sequences before and after the protospacer were designed and identified by sequencing. The synthesized primers were mixed with the corresponding template and PCR reactions were performed under the following conditions: 98°C for 30 seconds; 98°C for 10 seconds; 61°C for 30 seconds; 72°C for 4 minutes, 25 cycles; 72°C for 2 minutes; and 4°C for ∞. The primers are as follows: TgPCNA1-CRISPR-F:tcttgccttgGTTTTAGAGCTAGAAATAGC; TgPCNA1-CRISPR-R:cgaaatggacAACTTGACATCCCCATTTAC; Take 1 μL of PCR product, add 5 μL of 2× KLD Reaction Buffer, 1 μL of 10× KLD Enzyme Mix, and 3 μL of H2O, mix well, and incubate at room temperature for 5 minutes. Then, take DH5-α competent cells, add the above mixed product to the competent cells, incubate on ice for 30 minutes, in a 42°C water bath for 30 seconds, and incubate on ice again for 5 minutes. Next, perform transformation experiments, extract endotoxin-free plasmids, and finally successfully construct the pSAG1-Cas9-TgU6-ccdb-sgPCNA1 vector.
[0015] Based on the gene information provided by the ToxoDB database, a pair of primers were designed in the 5' and 3' UTR regions before and after the open reading frame of the target gene. The primer sequences are as follows: TgPCNA1-DHFR-F: ATGTTGGAAGCCAAGCTCCAGCTAGAAGCTTCGCCAGGCTGTAAATC; TgPCNA1-DHFR-R: CTCATCCATCATAGAGTCGTCCATGCCCATCCTGCAAGTGCATAGAAGG; Using the pUPRT-DHFR plasmid as a template, PCR amplification of the homologous recombination fragment was performed. The PCR reaction conditions were: 98°C for 2 minutes; 98°C for 10 seconds; 56°C for 5 seconds; 72°C for 5 minutes, 30 cycles; 72°C for 5 minutes; 4°C for ∞. The resulting PCR product was recovered, sequenced, and stored at -20°C.
[0016] The above recombinant plasmid and homologous recombination fragment were mixed at 6 μg and 2 μg respectively, and diluted to 100 μl with Cytomix buffer; 7 Toxoplasma gondii were mixed thoroughly with 100 μl of cultured cells. The mixed sample was added to a sterile 4 mm electroporation cuvette pre-chilled at -20°C. After electroporation, the sample was quickly added to HTERT cells containing 1 μM pyrimethamine (transfection and extraction reagents: K₂HPO₄, 1 M; KH₂PO₄, 1 M; EGTA, 2 mM; KCl, 120 mM; CaCl₂, 0.15 mM; HEPES, 25 mM; MgCl₂, 5 mM; electroporation procedure: voltage 1500 V; capacitance 25 μF; resistance 50 Ω; volume 4 mm). The cells were then passaged into HTERT cells containing 1% FBS and 1 μM pyrimethamine. Single colonies were screened and expanded in 96-well plates. The parasite genome was then extracted using a blood / cell / tissue genomic DNA extraction kit. The extracted genome was identified by PCR, western blot, and immunofluorescence.
[0017] PCR reaction system: template 10μl, H2O 10μl, upstream and downstream primers 2.5μl each, PrimeSTAR DNA polymerase 25μl. Reaction conditions: 98℃, 2min; 98℃, 10s; 56℃, 5s; 72℃, 5min; 72℃, 5min; 4℃, ∞( Figure 1 ).
[0018] The single clones successfully identified by PCR were amplified and cultured, and then the total protein of the parasites was extracted for western blot analysis. The protein extraction steps were as follows: the escaped parasites were filtered through a 5μm filter for purification, followed by centrifugation. 50μl of cell lysis buffer and 1μl of nuclease were added. After standing at room temperature for 5 minutes, the protein concentration was measured and the protein sample was prepared for western blot analysis ( Figure 2 ).
[0019] The monoclonal clones successfully identified by PCR and Western blot were identified by immunofluorescence using anti-TgPCNA1 protein polyclonal antibody as the primary antibody ( Figure 3 ). The identification primer sequences are as follows: TgPCNA1-validate-F:CTGGCAATCCACTGCCACAAGG; TgPCNA1-validate-R:CAGACACGAGTGAGACAGAAGTGAC.
[0020] The medical effects of the present invention are demonstrated by the following experimental examples:
[0021] Ten 6-8-week-old C57BL / 6 mice were intraperitoneally injected with 1000 ΔTgPCNA1 parasites. Blood samples were collected from the tail vein of the mice on days 20, 40, 60, and 80 after immunization. Serum samples were separated and stored at 80°C. ELISA was used to determine the expression of Toxoplasma gondii cytokines, including IL-12 p40, TNF-α, IFN-γ, IgG, IgG1, and IgG2a.
[0022] Forty 6-8-week-old C57BL / 6 mice were divided into six groups of 10 mice each. Four groups were immunized with 1000 ΔTgPCNA1 parasites. On days 20, 40, 60, and 80 after immunization, mice in the fifth group were intraperitoneally injected with 1000 wild-type Toxoplasma gondii. The sixth group served as a negative control. Following injection, the mice's survival status was monitored and recorded twice daily, and parasite load in their tissues and organs was measured.
[0023] Ten 6-8 week old C57BL / 6 female mice were intraperitoneally injected with 1000 ΔTgPCNA1 strain parasites. Forty days after ΔTgPCNA1 immunization, the female mice were co-caged (one female and one male per cage for three days). Once a vaginal plug was observed, the female mice were isolated and counted as day 0. On day 10, they were inoculated with 100 Toxoplasma tachyzoites per mouse. The pups were observed for an additional 40 days after birth, and the survival time and survival rate of the female mice and their offspring were recorded. At the end of the experiment, the surviving female mice and their offspring were sacrificed, and brain tissue was removed and genomic DNA extracted. Fluorescence quantitative PCR was used to measure the Toxoplasma load in the mouse brains to determine the immune efficacy of the vaccine.
[0024] △TgPCNA1 strain immunization 20, 40, 60, and 80 days after the mice were immunized with the tail vein, and the serum was separated. The serum levels of IL-12 p40, TNF-α, IFN-γ, IgG, IgG1, and IgG2a were detected by double-antibody sandwich ELISA. The results showed that the secretion levels of IL-12 p40, TNF-α, IFN-γ, IgG, and IgG2a reached their peak on the 60th day (IL-12p40: ****P<0.0001, TNF-α: ***P<0.001, IFN-γ: ***P<0.001, IgG: ***P<0.001, IgG2a: ***P<0.001) Figure 4 , Table 1).
[0025] Table 1 Changes in serum cytokine titers in mice in each group
[0026] The mice were observed for 40 days after being inoculated with the wild-type Toxoplasma strain, and their survival status was recorded. The results showed that the survival rate of mice inoculated with the wild-type Toxoplasma strain reached 20% 20 days after immunization with the △TgPCNA1 strain; the survival rate of mice inoculated with the wild-type Toxoplasma strain reached 50% 40 days after immunization; the survival rate of mice inoculated with the wild-type Toxoplasma strain reached 100% 60 days after immunization; and the survival rate of mice inoculated with the wild-type Toxoplasma strain reached 60% 80 days after immunization. This shows that after mice are immunized with the △TgPCNA1 strain as an attenuated vaccine, they can develop immune protection against infection with the wild-type Toxoplasma strain, and the survival rate of mice inoculated with the wild-type Toxoplasma strain is the highest 60 days after immunization with the △TgPCNA1 strain ( Figure 5 Tissues of surviving mice were collected, and the genomes were extracted. Fluorescence quantitative analysis was then used to detect the number of Toxoplasma gondii in the heart, liver, spleen, lung, kidney, and brain. The results showed that the number of Toxoplasma gondii in the heart, liver, spleen, kidney, and brain of the mice in the vaccine group was reduced, and the difference was significant compared with the infected group (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001) ( Figure 6).
[0027] In the present invention, the abortion rate, survival time and survival rate of mother mice and offspring mice were observed and recorded respectively to evaluate the protective effect of the vaccine on mother mice and offspring mice. The day when the mother mouse was infected with Toxoplasma gondii was recorded as day 0, and the records were kept for 40 consecutive days until the end of the experiment. The offspring mice were observed and recorded from birth, and the observations were kept for 40 consecutive days until the end of the experiment. The results showed that the abortion rate of mother mice in the infected group was 57.2%, while the abortion rate of mother mice in the vaccine group was 22.2%, which was higher than that of the control group (as shown in Table 2). The survival rate of the offspring mice was also improved (as shown in Table 7, the infection group was 20%, and the immunization group was 86.2%) ( Figure 7 ), indicating that the vaccine group can improve the survival rate of mice and pups.
[0028] Table 2 Statistics of abortion rate of mother mice and survival rate of offspring mice in each group
[0029] Tissues of surviving mice were collected, and the genome was extracted. Fluorescence quantitative analysis was used to detect the number of Toxoplasma gondii in the heart, liver, spleen, lung, kidney, and brain. The results showed that the number of Toxoplasma gondii in the heart, liver, spleen, kidney, and brain of the mice in the vaccine group was reduced, and the difference was significant compared with the infected group (*P<0.05, **P<0.01). Figure 8 ).
Claims
1. A attenuated vaccine for toxoplasmosis, characterized in that: The Toxoplasma gondii RH strain was used to knock out the Toxoplasma PCNA1 gene through CRISPR-Cas9 gene editing technology to construct a Toxoplasma PCNA1 gene knockout strain (△TgPCNA1) as a attenuated vaccine; the Toxoplasma proliferating cell nuclear antigen 1 gene sequence is as follows: SEQ ID: TGGT1_247460.
2. The method for preparing a toxoplasmosis attenuated vaccine according to claim 1, comprising the following steps: The TgPCNA1 gene sequence was searched through the ToxoDB database, and the protospacer sequence containing the PAM sequence structure was found. The protospacer homologous sequences were designed and identified by sequencing. Primers were designed: TgPCNA1-CRISPR-F:tcttgccttgGTTTTAGAGCTAGAAATAGC; TgPCNA1-CRISPR-R:cgaaatggacAACTTGACATCCCCATTTAC; Mix the synthesized primers with the corresponding template for PCR reaction. Take 1 μL of PCR product and add 5 μL of 2×KLD Reaction Buffer, 1 μL of 10×KLD Enzyme Mix, and 3 μL of H2O. Mix well and incubate at room temperature for 5 minutes. Then, DH5-α competent cells were taken and the mixed product was added to the competent cells to successfully construct the pSAG1-Cas9-TgU6-ccdb-sgPCNA1 vector; Based on the gene information provided by the ToxoDB database, a pair of primers were designed in the 5' and 3' UTR regions before and after the open reading frame of the target gene: TgPCNA1-DHFR-F: ATGTTGGAAGCCAAGCTCCAGCTAGAAGCTTCGCCAGGCTGTAAATC; TgPCNA1-DHFR-R: CTCATCCATCATAGAGTCGTCCATGCCCATCCTGCAAGTGCATAGAAGG; Using the pUPRT-DHFR plasmid as a template, PCR amplification of the homologous recombination fragment of the gene was performed, and the obtained PCR products were recovered, sequenced and identified, and stored at -20°C; The above recombinant plasmid and homologous recombination fragment were mixed at 6 μg and 2 μg respectively, and diluted to 100 μl with Cytomix buffer; 7 Mix the mixed sample with 100 μl of Toxoplasma gondii; add the mixed sample to a sterile 4 mm electroporation cuvette pre-cooled at -20°C; and quickly add the sample to HTERT cells containing 1 μM pyrimethamine after electroporation. Then, the cells were passaged into HTERT cells containing 1% FBS and 1 μM pyrimethamine; Single clones were screened and expanded in 96-well plates, and then the worm genome was extracted using a blood / cell / tissue genomic DNA extraction kit; The extracted genome was identified by PCR, Western blot and immunofluorescence.