Polyarginine-dna nanotube material, method for preparing same, and use thereof

Abstract

The present application relates to a kind of polyarginine-DNA nanotube material and its preparation method and application, belong to the field of biological medicine.The existing DNA nanomaterial is dependent on magnesium ion, which leads to unstable structure, low cell uptake rate and easy degradation by nuclease.The present application is formed by four DNA single strands (Y1-Y4) self-assembly according to the molar ratio 1:3:3:3 nanotube material induced by polyarginine.The material can load p65 siRNA to form a complex preparation, which is used for preparing a drug for inhibiting lung inflammation.The polyarginine-DNA nanotube material of the present application significantly improves the stability and cell uptake efficiency of the material;The higher the degree of polymerization of arginine, the stronger the anti-inflammatory activity;The complex preparation inhibits the expression of pro-inflammatory factors through the double mechanism of blocking inflammatory pathways by polyarginine and silencing p65 signal by p65 siRNA, providing an efficient delivery vector for the treatment of acute lung injury.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and relates to a polyarginine-DNA nanotube material and a preparation method and application thereof. BACKGROUND

[0002] DNA is the genetic material in the human body, and can be self-assembled into a nanostructure through the principle of base complementary pairing. The assembled DNA nanostructure has good biocompatibility, no immunogenicity and potential toxicity, and can make up for the defects of common drug delivery carriers. In addition, the DNA nanostructure has good programmability, and through the design of specific nucleic acid aptamer, targeted therapy can be achieved, and some guest molecules can be modified on the surface of the material, which retains the performance of the DNA nanostructure itself while endowing it with some new functions. The DNA nanostructure can also load interfering RNA to realize the regulation of biological signal pathways. However, there are some key problems to be solved for the DNA nanostructure to be used for disease treatment. The traditional method is to synthesize the DNA nanomaterial through magnesium ion mediation, which has magnesium ion concentration dependence. It is difficult to maintain the structural stability of the DNA nanomaterial in the low magnesium ion concentration in the physiological environment, and the magnesium ion needs a very complex annealing process, and the kinetic process control is difficult. Secondly, the negatively charged DNA has charge repulsion with the negatively charged cell membrane, resulting in low cell uptake rate. In addition, DNA is easily degraded by nucleases in the physiological environment, which hinders the function of DNA in the physiological environment.

[0003] Acute lung injury / acute respiratory distress syndrome has the characteristics of inflammation disorder, oxidative stress, alveolar-capillary barrier destruction and pulmonary edema, which seriously threatens human health. At present, there is no specific drug for treating acute lung injury / acute respiratory distress syndrome in clinic. Therefore, it is urgent to develop some potential therapeutic drugs and drug delivery carriers. SUMMARY

[0004] Therefore, one of the purposes of the present application is to provide a polyarginine-mediated nucleic acid nanomaterial with different polymerization degrees. Polyarginine is a cell-penetrating peptide with a positive charge, and the charge amount is related to the polymerization degree of polyarginine. The positively charged polyarginine can interact with the negatively charged DNA, so the polyarginine can replace the traditional magnesium ion to mediate the self-assembly of the DNA nanomaterial through electrostatic interaction. The second purpose is to provide a preparation method of the polyarginine-mediated nucleic acid nanomaterial with different polymerization degrees, and the third purpose is to provide an application of the polyarginine-DNA nanotube material in preparing a drug.

[0005] To achieve the above purposes, the present application provides the following technical solutions:

[0006] The application provides a polyarginine-DNA nanotube material, the nanotube material is assembled from four different DNA single strands under the induction of polyarginine, the molar ratio of the four DNA single strands Y1, Y2, Y3 and Y4 is 1:3:3:3, and the polyarginine forms any one of a dimer, a trimer or an octamer;

[0007] Preferably, the nucleic acid sequences of the four DNA single strands Y1, Y2, Y3 and Y4 are in sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4;

[0008] Further, the application provides a preparation method of the polyarginine-DNA nanotube material, and the steps are as follows:

[0009] S1: preparing Y1, Y2, Y3 and Y4 aqueous solutions;

[0010] S2: complementary pairing Y1, Y2, Y3 and Y4 in a polyarginine solution according to a molar concentration ratio of 1:3:3:3, and preparing a polyarginine-DNA nanotube solution after a gradient annealing or / and constant temperature annealing procedure;

[0011] Preferably, the gradient annealing procedure is as follows: 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and finally 22°C for 30 min.

[0012] Preferably, the constant temperature annealing procedure is as follows: placing the single-stranded DNA solution at any one of 37°C or 45°C for 30-90 min, mixing the DNA solution, and then placing the DNA solution at the same constant temperature of 37°C or 45°C for 30-90 min.

[0013] Preferably, the polymeric degree of the polyarginine is dimer, trimer and octamer respectively, the concentration of the dimeric polyarginine is 100 µM-50 mM, the concentration of the trimeric polyarginine is 1 µM-1 mM, and the concentration of the octamer polyarginine is 100 µM-10 µM.

[0014] Further, the application provides an application of the polyarginine-DNA nanotube material in preparing a drug delivery material.

[0015] Preferably, the application of the polyarginine-DNA nanotube material is in preparing a lung inflammation drug preparation.

[0016] Further, the application provides a pulmonary inflammation drug preparation, which comprises the polyarginine-DNA nanotube material, and further comprises p65 siRNA, and the molar ratio of Y1, Y2, Y3, Y4 and p65 siRNA is 1:3:3:3:3.

[0017] Preferably, the nucleic acid sequence of the p65 siRNA is shown in SEQ ID NO: 5.

[0018] The application has the following beneficial effects:

[0019] The nanocomposite preparation of the application enhances the cell uptake rate and anti-inflammatory effect through arginine polymerization, and regulates the anti-inflammatory effect by changing the degree of polymerization. After loading p65 siRNA, the synergistic effect of polyarginine and p65 siRNA is finally exerted to effectively inhibit the inflammatory response. The DNA nanotube structure mediated by polyarginine of different degrees of polymerization is composed of two hollow three-arm nanotube structures. Each arm has a functional site and a p65 siRNA for base pairing, so the polyarginine-mediated DNA nanotube structure can finally load 6 p65 siRNAs.

[0020] 1) The self-assembled DNA nanomaterial retains the programmability of traditional nucleic acid nanomaterials, and can be modified to load other therapeutic molecules such as p65 siRNA, which has great potential in the treatment of genetic diseases. 2) Compared with the nanotube constructed by traditional magnesium ions, the cell uptake rate of arginine polymerization is significantly improved, and the uptake of 2R, 3R, 8R assembled nanotube is increased by 2.02, 1.96, and 2.85 times. Compared with the nanotube constructed by traditional magnesium ions, the cell anti-inflammatory effect of arginine polymerization is significantly improved, such as for IL-6, the cell experiment proves that the mRNA expression level of 2R, 3R, 8R assembled nanotube is down-regulated by 15.7%, 36.1%, and 44.4%. 3) The self-assembled DNA nanomaterial mediated by polyarginine has excellent stability under physiological temperature conditions, and has good biocompatibility and no cytotoxicity, which greatly improves the possibility of clinical application. 4) The prepared polyarginine-DNA nanotube has good stability in serum at 37℃, which can ensure that it is not degraded before acting on target cells, thereby better exerting the effect. 5) The application loads p65 siRNA in the DNA nanotube skeleton through base complementary pairing to form a ternary complex system of "polyarginine-DNA-siRNA". This system realizes double anti-inflammatory mechanism: polyarginine directly blocks the activation of p65 siRNA specific silencing NF-κB pathway key node to inhibit IL-1β, IL-6 pro-inflammatory factor expression.

[0021] Additional advantages, objects, and features of the application will be apparent to those skilled in the art upon examination of the following specification. It is intended that the application not be limited by the disclosure therein, but include all changes which come within the scope of the appended claims. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to make the objectives, technical solutions and advantages of the present application clearer, the preferred embodiments of the present application will be described in detail below with reference to the drawings, in which:

[0023] Figure 1 Schematic diagram of self-assembly process of polyarginine-DNA nanotube loaded with p65 siRNA and its treatment of acute lung injury;

[0024] Figure 2 PAGE diagram of dimeric (A), trimeric (B), and octameric (C) arginine-DNA nanotubes; PAGE diagram of dimeric (D), trimeric (E), and octameric (F) arginine-mediated DNA nanotubes at different concentrations;

[0025] Figure 3 Particle size detection results of dimeric (A), trimeric (B), and octameric (C) arginine-DNA nanotubes;

[0026] Figure 4 PAGE diagram of thermal stability of dimeric (A), trimeric (B), and octameric (C) arginine-DNA nanotubes;

[0027] Figure 5 (A) Cytotoxicity of dimeric, trimeric, and octameric arginine-DNA nanotubes (the concentration of nanotubes was 900 nM); Figure 5 (B) PAGE diagram of trimeric arginine-DNA nanotubes carrying p65 siRNA;

[0028] Figure 6 Laser confocal observation of cell uptake of polyarginine-DNA nanotubes (A) and qualitative and quantitative results thereof by flow cytometry (B);

[0029] Figure 7 Influence results of different polymerization degrees of arginine on gene expression of inflammatory factors IL-Iβ (A) and IL-6 (B) of macrophage RAW 264.7; influence results of different polymerization degrees of arginine-DNA nanotubes on gene expression of inflammatory factors IL-Iβ (C) and IL-6 (D) of macrophage RAW 264.7; influence results of trimeric arginine-DNA nanotubes loaded with p65 siRNA on gene expression of phosphorylated p65 protein (E), and inflammatory factors IL-Iβ (F) and IL-6 (G) of macrophage RAW 264.7;

[0030] Figure 8 The imaging results of the trimer arginine-DNA nanotube loaded with p65 siRNA in the distribution of mouse heart, liver, spleen, lung, kidney tissue at different time points (A); the imaging results of the trimer arginine-DNA nanotube loaded with p65 siRNA in the mouse lung tissue at different time points (B) and the statistical results of fluorescence intensity (C);

[0031] Figure 9 The schematic diagram of the trimer arginine-DNA nanotube loaded with p65 siRNA for treating acute lung injury in mice (A); the detection results of inflammatory factors IL-Iβ (B), IL-6 (C) and protein concentration (D) in the bronchoalveolar lavage fluid; the detection results of the peak expiratory flow (E) and airway resistance (F) of mice; the detection results of the wet weight and dry weight ratio of mouse lung tissue (G); the HE staining results of mouse lung tissue (H). DETAILED DESCRIPTION

[0032] The present application will be described in more detail by the following specific examples, and those skilled in the art can easily understand other advantages and effects of the present application from the disclosure of the specification. The present application can also be implemented or applied by other different specific embodiments, and various modifications or changes can be made to the details in the specification based on different views and applications without departing from the spirit of the present application. It should be noted that the drawings provided in the following examples only illustrate the basic concept of the present application in a schematic manner, and the following examples and features in the examples can be combined with each other without conflict.

[0033] The drawings are only used for exemplary illustration, and the representation is only a schematic diagram, not a physical diagram, and cannot be understood as a limitation of the present application; in order to better illustrate the embodiments of the present application, some components in the drawings may be omitted, enlarged or reduced, and do not represent the size of the actual product; for those skilled in the art, it is understandable that some known structures and their descriptions in the drawings may be omitted.

[0034] The same or similar reference numerals in the drawings of the embodiments of the present application correspond to the same or similar components; in the description of the present application, it should be understood that if the terms "upper", "lower", "left", "right", "front", "back" and the like indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, only for the convenience of describing the present application and simplifying the description, and do not indicate or imply that the devices or elements referred to must have a particular orientation, be constructed and operated in a particular orientation, therefore the terms describing the positional relationship in the drawings are only used for exemplary illustration, and cannot be understood as a limitation of the present application, for those skilled in the art, the specific meaning of the above terms can be understood according to the specific situation.

[0035] The materials used in the embodiments of the present application are as follows:

[0036] Y1: GTAGGTTTTTTCAACCGAGGCACCATCGTAGGTTTTTTCTTCCGAGGCACCATC

[0037] GTAGGTTTTTTCTTGCCACCGACCATC (SEQ ID NO: 1);

[0038] Y2: AATCCAGACCAACAATAATTTGCAAGCCTACGATGGACACGGTAACGAC (SEQ ID NO: 2);

[0039] Y3: ACCGTGTGGAAGCTAGTCGTT (SEQ ID NO: 3);

[0040] Y4: TAGCAACCTCCGTG (SEQ ID NO: 4) was synthesized by Shanghai Biotech Co., Ltd.

[0041] p65 siRNA: TTATTGTTGGTCTGGATTCGCTT (SEQ ID NO: 5) was synthesized by Jiayi Technology Co., Ltd.

[0042] Arginine was purchased from Shanghai Biotech Co., Ltd.

[0043] Fetal bovine serum and phosphate buffer solution (PBS) were purchased from Hyclone, USA. LPS was purchased from Sigma, USA.

[0044] RAW264.7 cells were purchased from American Type Culture Collection; DMEM medium was a product of Gibco.

[0045] TRIzol reagent was purchased from Thermo Fisher Scientific (China) Co., Ltd.

[0046] IL-1β and IL-6 ELISA kits were purchased from Shanghai Biotech Co., Ltd.

[0047] Example 1 Self-assembly of DNA nanotubes mediated by polyarginine with different polymerization degrees

[0048] The single-stranded DNA Y1, Y2, Y3, Y4 were diluted with sterile and enzyme-free deionized water, and their concentrations were quantified using Nanodrop, then they were added to a sterile and enzyme-free centrifuge tube according to the molar concentration ratio of 1:3:3:3, and then a certain concentration of dimer, trimer and octamer arginine was added, and the final volume of the system was 50 μL. Then it was annealed as follows: 95 °C for 5 min, 65 °C for 30 min, 50 °C for 30 min, 37 °C for 30 min, and then 22 °C for 30 min. The polyarginine-DNA nanotube preparation mediated by dimer, trimer and octamer arginine was electrophoresed in 6% non-denaturing PAGE gel, and then the picture was scanned by a scanner. The results show that dimer (2R), trimer (3R) and octamer (8R) arginine can well synthesize nanotubes (such as Figure 2 ). The particle size of the prepared nanotube preparation was analyzed using a nanoparticle size and Zeta potential analyzer. NT 2R , NT 3R , NT 8R have no significant difference (such as Figure 3 ), because the particle size of the synthesized nanoparticles is mainly determined by the length of the DNA chain, and 2R, 3R, 8R have no significant effect on the particle size.

[0049] Example 2 Thermal stability of polyarginine-DNA nanotube

[0050] The DNA nanotube preparations mediated by arginine of different polymerization degrees and TAE-Mg 2+ were mixed with 10% FBS (fetal bovine serum) at a volume ratio of 1:9, and then electrophoresis was carried out in 37 °C electrophoresis solution. The picture was scanned by a scanner. The results show that the synthesized nanotubes have good thermal stability at 37 °C (such as Figure 4 ).

[0051] Example 3 Study on the cytotoxicity of polyarginine-DNA nanotube

[0052] Mouse monocyte macrophage leukemia cells RAW 264.7 were inoculated in a 24-well plate at 1×10 5 cells per well, and cultured in a 37 °C, 5% CO2 cell incubator overnight. Then dimer, trimer and octamer arginine-mediated polyarginine-DNA nanotube preparations were added to each well of cells, with 3 parallel samples in each group, and cultured for 24 h. MTS reagent was used to detect cell proliferation, and the cytotoxicity of nanotube preparation was evaluated. The results show that polyarginine-DNA nanotube has no obvious cytotoxicity (such as Figure 5 A).

[0053] Example 4 Preparation of p65 siRNA loaded polyarginine-DNA nanotube

[0054] The DNA single-stranded Y1, Y2, Y3, Y4 solution was added to a sterile enzyme-free centrifuge tube in a 1:3:3:3 molar concentration ratio, and then a certain concentration of arginine trimer was added, and the final volume of the system was 50 μL. Then it was annealed as follows: 95 °C for 5 min, 65 °C for 30 min, 50 °C for 30 min, 37 °C for 30 min, and then 22 °C for 30 min. Subsequently, p65 siRNA was added to the above system so that the ratio of Y1:Y2:Y3:Y4:p65 siRNA was 1:3:3:3:3. After 30 min at 37 °C, the p65 siRNA loaded polyarginine-DNA nanotube preparation was obtained, and the PAGE gel result showed that the molecular weight of the p65 siRNA loaded polyarginine-DNA nanotube was larger and the electrophoretic displacement was shorter (as shown in Figure 5 B).

[0055] Example 5 Study on the cellular uptake behavior of polyarginine-DNA nanotube

[0056] Mouse monocyte macrophage leukemia cells RAW 264.7 were inoculated in a 24-well plate at 1 × 10 5 cells per well, and cultured overnight in a 37 °C, 5% CO2 cell incubator. Then Cy5 fluorescently labeled dimeric, trimeric and octameric arginine-mediated assembly polyarginine-DNA nanotube preparations were added to each well of cells, respectively, and cultured in a 37 °C, 5% CO2 cell incubator for 6 h. RAW 264.7 without any treatment and with arginine treatment were used as control groups, respectively. After washing with PBS, the fluorescence of the cells in each group was observed using a confocal fluorescence microscope. At the same time, the fluorescence intensity of the cells in each group was detected using a cell flow cytometer, and quantitative statistics were performed. The results showed (as shown in Figure 6 ) that the cellular uptake of the octamer arginine-mediated assembly DNA nanotube by macrophages was greater than that of the trimer arginine and dimer arginine-mediated assembly DNA nanotube, and the reason was that octamer arginine was a cell-penetrating peptide that had a good effect on promoting cellular uptake.

[0057] Example 6 Study on the effect of polyarginine-DNA nanotube on the inflammatory level of cells

[0058] Mouse monocyte macrophage leukemia cells RAW 264.7 were inoculated in a 24-well plate at 1 × 10 5The cells were cultured overnight at 37 °C in a 5% CO2 cell incubator. Then the dimeric, trimeric and octameric arginine-mediated assembled polyarginine-DNA nanotube formulations were added to RAW 264.7 cells respectively, the cells without any treatment were used as control group, cultured for 24 h, washed with PBS, then 1 μg mL-1 LPS was added and cultured for 6 h, the cells without any treatment and the cells with only LPS were used as control group. After washing with PBS for 3 times, the RNA was extracted using TRIzol reagent, and then the mRNA expression levels of pro-inflammatory factors IL-1β, IL-6 and p65 of RAW264.7 cells under different conditions were detected using real-time fluorescent quantitative PCR. The primer sequences of GAPDH, IL-1β, IL-6 and p65 are as follows:

[0059] GAPDH: Forward: AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 6),

[0060] Reverse: GGGGTCGTTGATGGCAACA (SEQ ID NO: 7);

[0061] IL-1β: Forward: TCGCAGCAAAGATCCACACAG (SEQ ID NO: 8),

[0062] Reverse: ATCTTTTGGGGTCCGTC AACT (SEQ ID NO: 9);

[0063] IL-6: Forward: CTCCCAACAGACCTGTCTATAC (SEQ ID NO: 10),

[0064] Reverse: CCATTGCACAACTCTTTTCTCA (SEQ ID NO: 11);

[0065] p65: Forward: AGGCTTCTGGGCCTTATGTG (SEQ ID NO: 12),

[0066] Reverse: TGCTTCTCTCGCCAGGAATAC (SEQ ID NO: 13).

[0067] The results show (as shown in Figure 7 ) that the anti-inflammatory effect is better as the polymerization state becomes larger. However, there is no obvious difference in the anti-inflammatory effect between octa-arginine and tri-arginine. After adding p65 siRNA, the p65 mRNA expression level can be down-regulated, which can further play a synergistic role in reducing pro-inflammatory factors with tri-arginine.

[0068] Example 7 Study on the biodistribution of polyarginine-DNA nanotube in mice in vivo

[0069] 50 μL LPS (5 mg / kg) was injected into the trachea of anesthetized mice. After 2 h, the p65 siRNA-loaded triarginine-DNA nanotube preparation (the concentrations of injected triarginine and p65 siRNA were 3.6 mg / kg and 2.5 mg / kg, respectively) was injected into the trachea of mice, and at the time points of 0.5 h, 1 h, 3 h, 6 h, 12 h, and 24 h, 4 parallel samples were collected from each group, and the heart, liver, spleen, lung, kidney, and other major organs of mice were imaged using a multi-mode animal live imaging system, focusing on the distribution of the nanotube preparation in the lung. The imaging results (as shown in FIG. 6) showed that the p65 siRNA-loaded triarginine-DNA nanotube preparation had the highest distribution content in the lung tissue, and the nanotube preparation remained in the lung tissue for more than 24 h, which was conducive to the effect of the nanomedicine in the lung. Figure 8

[0070] Example 8 Study on the treatment of acute lung injury in mice by polyarginine-DNA nanotube

[0071] The mice were randomly divided into 6 groups, which were marked as PBS group, LPS group, TAE-Mg 2+ mediated DNA nanotube group, TAE-Mg 2+ mediated DNA nanotube group (loaded with p65 siRNA), triarginine-DNA nanotube group, and triarginine-DNA nanotube group (loaded with p65 siRNA). 50 μL LPS (5 mg / kg) was injected into the trachea of anesthetized mice (the PBS group was not injected with LPS). After 2 h, PBS and the preparations of the above groups were injected into the mice of the respective groups through the tail vein. After 24 h, the intubation needle was inserted into the trachea of the mice under anesthesia, the ventilation function of the mice was detected using the flexiVent FX system, and the flexiWare v7.2 software was used for analysis.

[0072] The mice were randomly divided into 6 groups, which were marked as PBS group, LPS group, TAE-Mg 2+ mediated DNA nanotube group, TAE-Mg 2+ ​DNA nanotube group (loaded with p65 siRNA), triargin-DNA nanotube group, triargin-DNA nanotube group (loaded with p65 siRNA). 50 μL LPS (5 mg / kg) was injected into the trachea of anesthetized mice (the PBS group was not injected with LPS). After 2 h, PBS and the preparations of each group were injected into the tail vein of mice in the respective group. After 24 h, the lung tissues of mice in each group were collected, fixed in 4% paraformaldehyde for 24 h, embedded and sectioned, and then subjected to HE staining analysis. The results showed (as shown in Figure 9 ) The triargin-DNA nanotube group (loaded with p65 siRNA) significantly reduced lung pathological damage.

[0073] The mice were randomly divided into 6 groups, respectively, and labeled as PBS group, LPS group, TAE-Mg 2+ DNA nanotube group, TAE-Mg 2+ DNA nanotube group (loaded with p65 siRNA), triargin-DNA nanotube group, triargin-DNA nanotube group (loaded with p65 siRNA). 50 μL LPS (5 mg / kg) was injected into the trachea of anesthetized mice (the PBS group was not injected with LPS). After 2 h, PBS and the preparations of each group were injected into the tail vein of mice in the respective group. After 24 h, the lung tissues of mice in each group were collected, fixed in 4% paraformaldehyde for 24 h, embedded and sectioned, and then subjected to HE staining analysis. The results showed (as shown in Figure 9 G) The triargin-DNA nanotube group (loaded with p65 siRNA) significantly reduced lung pathological damage.

[0074] In order to collect the lung alveolar lavage fluid of the mice, the tracheal intubation needle was inserted into the trachea of the mice, and then 500 μL of pre-cooled PBS solution was injected into the trachea of the mice, and the lung was gently pressed, and the lung alveolar lavage fluid was withdrawn. The lung alveolar lavage fluid was centrifuged, and the supernatant was taken, and the protein concentration in the lung alveolar lavage fluid was detected by BCA method. The levels of inflammatory factors IL-1β and IL-6 in the lung alveolar lavage fluid were detected by ELISA kit. The results showed (as shown in Figure 9 A, B) The triargin-DNA nanotube group (loaded with p65 siRNA) significantly reduced lung pathological damage.

[0075] Finally, it is to be explained that the above embodiments are only used to illustrate the technical solutions of the present application but not to limit the present application. Although the present application is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or equivalently replaced without departing from the purpose and scope of the technical solutions, and all should be covered in the scope of the claims of the present application.

Claims

1. A pharmaceutical preparation for pulmonary inflammation, characterized by: The pharmaceutical preparation comprises polyarginine-DNA nanotube material and p65 siRNA, the nanotube material is assembled by four DNA single strands: Y1, Y2, Y3, Y4, the nucleic acid sequences of which are SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 in turn, under the induction of polyarginine; the polyarginine forms any one of dimer, trimer or octamer, the molar ratio of Y1, Y2, Y3, Y4 to p65 siRNA is 1:3:3:3:3, and the nucleic acid sequence of the p65 siRNA is shown in SEQ ID NO:

5.

2. The pulmonary inflammatory drug formulation according to claim 1, characterized in that The preparation method of the polyarginine-DNA nanotube material is as follows: S1: preparing Y1, Y2, Y3, Y4 aqueous solution; S2: complementary pairing Y1, Y2, Y3, Y4 in polyarginine solution according to the molar concentration ratio of 1:3:3:3, and preparing the polyarginine-DNA nanotube material after gradient annealing or / and constant temperature annealing program.

3. The pulmonary inflammatory drug formulation according to claim 2, characterized in that: The gradient annealing program is: 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, and finally 22°C for 30 min. The constant temperature annealing program is: single-stranded DNA solution is placed at any one of 37°C or 45°C for 30-90 min, then the DNA solution is mixed, and then placed at the same constant temperature of 37°C or 45°C for 30-90 min.

4. The pulmonary inflammatory drug formulation according to claim 2, characterized in that: The polymerization degree of the polyarginine is dimer, trimer and octamer respectively, the concentration of the dimeric arginine is 100 μM-50 mM, the concentration of the trimeric arginine is 1 μM-1 mM, and the concentration of the octamer arginine is 100 nM-10 µM.

Images