Anti-BAFF protein antibody pair and application thereof

Abstract

The invention relates to the technical field of biomedicine, in particular to an anti-BAFF protein antibody pair and application thereof. The antibody pair comprises two monoclonal antibodies; the monoclonal antibody comprises a heavy chain variable region and a light chain variable region; one monoclonal antibody in the monoclonal antibody pair is named as a 6F10 antibody, and the other monoclonal antibody is named as a 2F2 antibody. Wherein the 6F10 antibody is used as a capture antibody, and the 2F2 antibody is used as a labeled antibody. Results of the embodiment of the invention show that the antibody pair can be used for monitoring the BAFF level of a patient so as to detect the graft rejection condition of an organism, thereby providing powerful support for clinical diagnosis and treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to an anti-BAFF protein antibody pair and applications thereof. Background Art

[0002] B cell activating factor (BAFF), also known as BLS, TALL-1, THANK, or TNFSF13B, is a ligand of the tumor necrosis factor (TNF) family and plays a key role in the development and survival of B cells. BAFF can form a homotrimer or a heterodimer with the related protein APRIL. It is produced by various hematopoietic cells, and its soluble form can be released by activated neutrophils.

[0003] BAFF is first synthesized and localized on the cell membrane. It is then processed by furin hydrolase to form soluble BAFF (sBAFF). sBAFF binds to BAFF receptors (BAFF-R), transmembrane activator and calcium-modulating cyclophilin ligand interactor (TACI), and B cell maturation antigen (BCMA) receptors on target cell membranes as trimers or multimers, modulating downstream signaling pathways and promoting B cell survival, proliferation, antigen presentation, and differentiation into plasma cells. Mice overexpressing BAFF exhibit an increase in B cell numbers, impairing germinal center formation and size, and inducing autoimmune symptoms. Furthermore, BAFF can stimulate T cell differentiation toward Th1 and promote the proliferation of Treg cells. Studies have shown that elevated BAFF levels may exacerbate many autoimmune diseases. Therefore, BAFF is considered a potential therapeutic target for autoimmune diseases.

[0004] Multiple studies have shown that BAFF levels are significantly higher in hematopoietic stem cell transplantation (HSCT) patients who develop graft-versus-host disease (GVHD) than in controls. In solid organ transplantation, BAFF can be used as a predictor of graft rejection risk. Preoperative BAFF levels are significantly higher in presensitized renal transplant recipients than in non-presensitized recipients, and BAFF levels are significantly negatively correlated with graft survival. A MATA analysis of 1,302 renal transplant recipients from nine clinical studies found that the incidence of antibody-mediated rejection (ABMR) was significantly higher in the high-BAFF group than in the low-BAFF group. Studies of Chinese patients have also shown a similar trend, with BAFF levels showing dynamic changes. A prediction model based on the maximum rate of change in BAFF peak values ​​between one week and three months after surgery can effectively predict the occurrence of DSA and ABMR. Measuring a patient's BAFF level can monitor graft rejection.

[0005] Therefore, there is an urgent need to develop a substance that can detect BAFF levels to provide favorable support for clinical diagnosis and treatment. Summary of the Invention

[0006] The present invention aims to provide an anti-BAFF protein antibody pair and its application. The antibody pair provided by the present invention can specifically bind to the BAFF protein, thereby achieving quantitative detection of the BAFF protein expression level.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides an anti-BAFF protein antibody pair, comprising two monoclonal antibodies; the monoclonal antibodies comprising a heavy chain variable region and a light chain variable region; the heavy chain variable region comprising a heavy chain HCDR1, a heavy chain HCDR2, and a heavy chain HCDR3; the light chain variable region comprising a light chain LCDR1, a light chain LCDR2, and a light chain LCDR3;

[0009] One of the monoclonal antibodies in the antibody pair is the 2F2 antibody, and the sequence information of the 2F2 antibody is as follows:

[0010] The amino acid sequence of the heavy chain HCDR1 is shown in SEQ ID NO.1;

[0011] The amino acid sequence of the heavy chain HCDR2 is shown in SEQ ID NO.2;

[0012] The amino acid sequence of the heavy chain HCDR3 is shown in SEQ ID NO. 3;

[0013] The amino acid sequence of the light chain LCDR1 is shown in SEQ ID NO.4;

[0014] The amino acid sequence of the light chain LCDR2 is shown in SEQ ID NO.5;

[0015] The amino acid sequence of the light chain LCDR3 is shown in SEQ ID NO.6;

[0016] The other monoclonal antibody in the antibody pair is 6F10 antibody, and the sequence information of the 6F10 antibody is as follows:

[0017] The amino acid sequence of the heavy chain HCDR1 is shown in SEQ ID NO.7;

[0018] The amino acid sequence of the heavy chain HCDR2 is shown in SEQ ID NO.8;

[0019] The amino acid sequence of the heavy chain HCDR3 is shown in SEQ ID NO.9;

[0020] The amino acid sequence of the light chain LCDR1 is shown in SEQ ID NO.10;

[0021] The amino acid sequence of the light chain LCDR2 is shown in SEQ ID NO.11;

[0022] The amino acid sequence of the light chain LCDR3 is shown in SEQ ID NO.12.

[0023] Preferably, the amino acid sequence of the heavy chain sequence of the 2F2 antibody is shown as SEQ ID NO.13; the amino acid sequence of the light chain sequence of the 2F2 antibody is shown as SEQ ID NO.14; the amino acid sequence of the heavy chain sequence of the 6F10 antibody is shown as SEQ ID NO.15; and the amino acid sequence of the light chain sequence of the 6F10 antibody is shown as SEQ ID NO.16.

[0024] The present invention also provides a nucleotide molecule encoding the amino acid sequence of the above-mentioned 2F2 antibody or 6F10 antibody.

[0025] Preferably, the nucleotide molecule encoding the heavy chain sequence of the 2F2 antibody is shown as SEQ ID NO.17; the nucleotide molecule encoding the light chain sequence of the 2F2 antibody is shown as SEQ ID NO.18; the nucleotide molecule encoding the heavy chain sequence of the 6F10 antibody is shown as SEQ ID NO.19; and the nucleotide molecule encoding the light chain sequence of the 6F10 antibody is shown as SEQ ID NO.20.

[0026] The present invention also provides a biomaterial, which comprises one of the following substances:

[0027] (1) a nucleotide molecule encoding the amino acid sequence of the 2F2 antibody or the 6F10 antibody;

[0028] (2) a vector comprising the nucleotide molecule described in (1);

[0029] (3) A host cell comprising (1) the nucleotide molecule and / or (2) the vector or transformed or transfected by (1) the nucleotide molecule and / or (2) the vector.

[0030] Preferably, the vector is a vector plasmid, a phage vector, a viral vector or an artificial chromosome vector.

[0031] Preferably, the host cell is a microbial cell, an insect cell or a non-insect animal cell.

[0032] The present invention also provides a kit for detecting BAFF protein, which comprises the above-mentioned antibody pair.

[0033] Preferably, the 2F2 antibody is a labeling antibody, and the 6F10 antibody is a capture antibody.

[0034] The present invention also provides the use of the above antibody pair in preparing a reagent for detecting BAFF protein.

[0035] Beneficial effects of the present invention:

[0036] The anti-BAFF antibody pair provided by the present invention, with 6F10 and 2F2 serving as the capture and labeling antibodies, respectively, exhibits high specificity and good sensitivity for BAFF protein. This antibody pair enables quantitative detection of BAFF protein, thereby monitoring transplant rejection, providing strong support for clinical diagnosis and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0038] Figure 1 Binding curves of anti-human BAFF protein antibodies 2F2 and 6F10 to BAFF;

[0039] Figure 2 This is a diagram showing the pairing results of the anti-human BAFF protein antibodies 2F2 and 6F10;

[0040] Figure 3 This is the standard curve for BAFF protein detection. DETAILED DESCRIPTION

[0041] The present invention provides an anti-BAFF protein antibody pair, wherein the 6F10 antibody serves as a capture antibody and the 2F2 antibody serves as a labeling antibody, and can achieve quantitative detection of the BAFF protein. The anti-BAFF protein antibody pair is a highly sensitive monoclonal antibody targeting the BAFF protein.

[0042] In a first aspect, the present application provides an anti-BAFF protein antibody pair, using the following technical solution:

[0043] An anti-BAFF protein antibody pair, comprising two monoclonal antibodies; the monoclonal antibodies comprising a heavy chain variable region and a light chain variable region; the heavy chain variable region comprising a heavy chain HCDR1, a heavy chain HCDR2, and a heavy chain HCDR3; and the light chain variable region comprising a light chain LCDR1, a light chain LCDR2, and a light chain LCDR3;

[0044] One of the monoclonal antibodies in the antibody pair is named 2F2 antibody, and the sequence information of the 2F2 antibody is as follows:

[0045] The heavy chain HCDR1 comprises the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO.1, or an amino acid sequence comprising the above sequence;

[0046] The heavy chain HCDR2 comprises the amino acid sequence shown in SEQ ID NO. 2, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 2, or an amino acid sequence comprising the above sequence;

[0047] The heavy chain HCDR3 comprises the amino acid sequence shown in SEQ ID NO. 3, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 3, or an amino acid sequence comprising the above sequence;

[0048] The light chain LCDR1 comprises the amino acid sequence shown in SEQ ID NO. 4, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 4, or an amino acid sequence comprising the above sequence;

[0049] The light chain LCDR2 comprises the amino acid sequence shown in SEQ ID NO. 5, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 5, or an amino acid sequence comprising the above sequence;

[0050] The light chain LCDR3 comprises the amino acid sequence shown in SEQ ID NO. 6, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 6, or an amino acid sequence comprising the above sequence;

[0051] The other monoclonal antibody in the antibody pair is named 6F10 antibody, and the sequence information of the 6F10 antibody is as follows:

[0052] The heavy chain HCDR1 comprises the amino acid sequence shown in SEQ ID NO. 7, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 7, or an amino acid sequence comprising the above sequence;

[0053] The heavy chain HCDR2 comprises the amino acid sequence shown in SEQ ID NO. 8, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 8, or an amino acid sequence comprising the above sequence;

[0054] The heavy chain HCDR3 comprises the amino acid sequence shown in SEQ ID NO. 9, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 9, or an amino acid sequence comprising the above sequence;

[0055] The light chain LCDR1 comprises the amino acid sequence shown in SEQ ID NO. 10, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 10, or an amino acid sequence comprising the above sequence;

[0056] The light chain LCDR2 comprises the amino acid sequence shown in SEQ ID NO. 11, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 11, or an amino acid sequence comprising the above sequence;

[0057] The light chain LCDR3 includes the amino acid sequence shown in SEQ ID NO. 12, or an amino acid sequence having one or two conservative amino acid substitutions compared to the sequence shown in SEQ ID NO. 12, or an amino acid sequence comprising the above sequence.

[0058] In some alternative embodiments, the antibody pair comprises a heavy chain variable region and a light chain variable region; wherein:

[0059] The heavy chain sequence of the 2F2 antibody comprises the amino acid sequence shown in SEQ ID NO. 13, and the light chain sequence of the 2F2 antibody comprises the amino acid sequence shown in SEQ ID NO. 14. The heavy chain sequence of the 6F10 antibody comprises the amino acid sequence shown in SEQ ID NO. 15, and the light chain sequence of the 6F10 antibody comprises the amino acid sequence shown in SEQ ID NO. 16.

[0060] The antibody pair described in the present application comprises at least a heavy chain variable region and a light chain variable region, both of which comprise the above-mentioned complementarity determining regions (CDRs) and an intervening framework region (FR), and the arrangement of each domain is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4; wherein one or more amino acid substitutions, deletions or insertions or any combination thereof occur in the framework regions FR1, FR2, FR3 and FR4.

[0061] In some optional embodiments, the antibody includes any form of a monoclonal antibody, a single-chain antibody, a bifunctional antibody, a single-domain antibody, a nanobody, a fully or partially humanized antibody, or a chimeric antibody;

[0062] And / or, the antibody is selected from Fab, Fab', Fab'-SH, (Fab')2, Fv, scFv, BsFv, dsFv or (dsFv)2 fragment.

[0063] In some alternative embodiments, the antibody further comprises a human or murine constant region. In other alternative embodiments, the antibody further comprises a human or murine heavy chain constant region and / or a light chain constant region. In other alternative embodiments, the antibody comprises an IgG, IgA, IgM, IgD, or IgE heavy chain constant region and / or a kappa or lambda type light chain constant region.

[0064] In some alternative embodiments, the antibody is a murine, chimeric or humanized monoclonal antibody.

[0065] In some optional embodiments, the heavy chain constant region of the monoclonal antibody is of IgG1, IgG2, IgG3 or IgG4 subtype.

[0066] In some alternative embodiments, the antibody is a monoclonal antibody.

[0067] In some alternative embodiments, the antibody is an IgG antibody.

[0068] In a second aspect, the present application provides a biomaterial, comprising:

[0069] (1) A nucleotide molecule encoding the anti-BAFF protein antibody pair. The nucleotide molecule encoding the heavy chain sequence of the 2F2 antibody includes the nucleotide sequence shown in SEQ ID NO.17; the nucleotide molecule encoding the light chain sequence of the 2F2 antibody includes the nucleotide sequence shown in SEQ ID NO.18. The nucleotide molecule encoding the heavy chain sequence of the 6F10 antibody includes the nucleotide sequence shown in SEQ ID NO.19; the nucleotide molecule encoding the light chain sequence of the 6F10 antibody includes the nucleotide sequence shown in SEQ ID NO.20;

[0070] SEQ ID NO.17: CAGGTCCAGTTGCAGCAGTCTGGAGCTGAACTGGTAAGGCCTGGGACTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACGCCTTCACTTACTACTGGCTTGGTTGGATAAAACAGAGGCCTGGACATGGACTTGAGTGGGTTGGAGATATCTTCCCTGGAAGTGGTACT ACTCACTACAGTGAGAAATTCAAGGGCAAAGCCACACTGACTGCAGACAGATCCTCGACCACAGCCTATATGCAGCTCAGTGGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGTGCAAGAGAAGGGGACGGGTTTCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA;

[0071] SEQ ID NO.18:GACATTGTGATGACCCAGTCTCCCAAATTCATGTCCACATCAGTAGGAGACAGGGTCAGCATCACCTGCAAGGCCAGTCAGGATGTGGGTACTGCTGTAGCCTGGTATCAAAAAAAACCAGGCCAATCTCCTAAACTACTGATTTACTGGGCATCCACCCGGCACACCGGAGTCCCTGATCGCTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATTAACAATGTGCAGTCTGAAGACTTGGCAGATTGTTTCTGTCAGCAATATAGGAGCTATCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA;

[0072] SEQ ID NO.19:GAGGTTCAGCTGCAGCAGTCTGGGGCAGAGGTTGTGATGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAAAATTGAAGACACCTATATATACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGGTTGATCCTGCGAATGGTAATACTATATATGACCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACGCATCCTCCAAAACAGGCTTCCTGCGGCTCAACAGCCTGACATCTGACGACACTGCCGTCTATTACTGTGGTAGAAGTTTCCCCGGTAGTAGCTATGCTATGGACTATTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCCAAAACGACACCCCCATCTGAC;

[0073] SEQ ID NO.20: GATGTTGTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAGATCTGGTCAGAGCCTTGTTCACAGTAATGGAAACACCTATTTACATTGGTACCTGCAGAAGCCAGGCCAGTTCCCAAAGCTCCTGATCTACAAAGTTTCC AACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTTACACTCAAGATCAGCAGAGTGGAGGCTGAGGATCTGGGAGTTTATTTCTGCTCTCAAAGTACACATGTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAACGGGCTGATGC.

[0074] (2) A vector comprising the nucleotide molecule described in (1);

[0075] (3) A host cell comprising the nucleotide molecule described in (1) and / or the vector described in (2), or the host cell is transformed or transfected with the nucleic acid molecule described in (1) and / or the vector described in (2).

[0076] Among them, based on the amino acid sequence involved in the antibody described in the first aspect, those skilled in the art can obtain a nucleotide molecule encoding the antibody described in the first aspect. Due to the degeneracy of codons, the nucleotide sequence of a nucleotide molecule is not unique, and all nucleic acid molecules capable of encoding the antibody described in the first aspect are within the scope of protection of this application.

[0077] In some optional embodiments, the vector includes but is not limited to a plasmid vector, a phage vector, a viral vector, an artificial chromosome vector, and the like.

[0078] In some alternative embodiments, the host cell includes but is not limited to a microbial cell, an insect cell or a non-insect animal cell.

[0079] In some alternative embodiments, the host cell is selected from a prokaryotic cell or a eukaryotic cell.

[0080] In some optional embodiments, the host cell is selected from yeast cells, CHO cells, 293 cells (human embryonic kidney 293 cells) or plant cells.

[0081] In a third aspect, the present application provides an antibody conjugate, comprising the antibody described in the first aspect, and a label conjugated to the antibody described in the first aspect.

[0082] In some optional embodiments, the label is selected from at least one of an enzyme label, a biotin label, a fluorescent dye label, a chemiluminescent dye label, and a radioactive label.

[0083] In a fourth aspect, the present application provides use of the antibody described in the first aspect, and / or the biomaterial described in the second aspect, and / or the antibody conjugate described in the third aspect in the preparation of a product for detecting BAFF protein.

[0084] In a fifth aspect, the present application provides a detection reagent for detecting BAFF protein, wherein the reagent comprises the antibody described in the first aspect, and / or the biomaterial described in the second aspect, and / or the antibody conjugate described in the third aspect.

[0085] In a sixth aspect, the present application provides a detection kit for detecting BAFF protein, wherein the kit comprises the antibody described in the first aspect, and / or the biological material described in the second aspect, and / or the antibody conjugate described in the third aspect.

[0086] In some optional embodiments, the detection kit is selected from an enzyme-linked immunosorbent assay kit, a fluorescent immunoassay kit, or a chemiluminescent immunoassay kit.

[0087] Definitions or general explanations of terms:

[0088] The practice of the present application will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art.

[0089] The term “and / or” used in this application should be understood to mean any one of the optional items or a combination of any two or more of the optional items.

[0090] As used herein, “comprise” or “comprising” means including stated elements, integers or steps, but not excluding any other elements, integers or steps.

[0091] As used herein, “antibody (Ab)” is an immunoglobulin with immune function (i.e., capable of specifically binding to an antigen) secreted by lymphocytes after antigen stimulation. Antibodies have a tetrameric structure, and the antibody comprises two identical heavy chains (H chains) and two identical light chains (L chains). Among them, the region where the amino acid sequence of the antibody heavy chain and light chain changes greatly near the N-terminal end is called the variable region (V region), wherein the heavy chain and light chain variable regions (hypervariable region, HVR) are the sites that complementarily bind to the antigen epitope, so they are called the complementarity determining region (CDR), which are represented by HVR1 (CDR1), HVR2 (CDR2) and HVR3 (CDR3), respectively, wherein CDR3 changes the most; the region where the amino acid sequence of the antibody heavy chain and light chain is relatively constant near the C-terminal end is called the constant region (C region).

[0092] As used herein, "complementarity determining region" or "CDR region" or "CDR" or "hypervariable region" are used interchangeably and are regions of an antibody variable domain that are highly variable in sequence and form structurally defined loops ("hypervariable loops") and / or contain antigen-contacting residues ("antigen contact points"). CDRs are primarily responsible for binding to antigenic epitopes.

[0093] The "monoclonal antibody" used in this application is a specific antibody produced by B lymphocytes under the stimulation of specific antigens, which has an identical chemical structure and is complementary to the antigenic determinant.

[0094] As used herein, "amino acid difference" refers to amino acid modification (such as amino acid methylation modification) or amino acid replacement.

[0095] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0096] The recombinant human BAFF protein of the present invention was purchased from GenScript Biotechnology Co., Ltd. (Cat. No. Z02976); HRP-labeled goat anti-mouse IgG antibody was purchased from Jackson ImmunoResearch (Cat. No. 115-035-062); microspheres coupled to capture antibodies were purchased from Luminex (Cat. No. MC10053-1); recombinant human BAFF protein was purchased from GenScript Biotechnology Co., Ltd. (Cat. No. Z02976); R-phycoerythrin-streptavidin conjugate was purchased from Wuhan Tri-Eagle Biotechnology Co., Ltd. (Cat. No. PF00021).

[0097] Unless otherwise specified, the production processes, experimental methods or detection methods involved in the embodiments of the present invention are all conventional methods in the prior art, and their names and / or abbreviations are conventional names in the field and are very clear and unambiguous in the relevant fields of use. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment to implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0098] The various instruments, equipment, raw materials or reagents used in the embodiments of the present invention are not particularly limited in their sources and are all conventional products that can be purchased through regular commercial channels or prepared according to conventional methods well known to those skilled in the art.

[0099] Example 1 Preparation of anti-BAFF protein antibodies

[0100] The anti-BAFF protein antibody is a monoclonal antibody obtained by using recombinant human BAFF protein as an immunogen and conventional mouse immunization and ELISA screening. The specific method includes the following steps:

[0101] (1) Animal immunization: 6- to 8-week-old female BALB / c mice (i.e., inbred mice, BALB / c mice are bred by full-sib mating, have a highly consistent genetic background, and have little difference between individuals) were selected. Recombinant human BAFF protein was diluted to 1 mg / mL and mixed with an equal volume of Freund's adjuvant for emulsification before immunization.

[0102] The initial immunization dose was 50 μg / mouse, and subsequent immunizations were 25 μg / mouse. The interval between immunizations was two weeks. After three immunizations, blood was drawn from the submandibular vein of the mice, and the antibody titer of the mouse immune response to recombinant human BAFF protein was measured by ELISA. After five immunizations, the mice were sacrificed by cervical dislocation, and the spleens were removed aseptically and a single-cell suspension was prepared for later use.

[0103] (2) Cell fusion: Mouse spleen cells and SP2 / 0 cells (full name: SP2 / 0-Ag14 cells; SP2 / 0 cells are obtained by fusion of immune BALB / c mouse spleen cells and P3X63Ag8 myeloma cells, belonging to the B cell hybridoma cell line) were mixed in a centrifuge tube at a ratio of 5:1, centrifuged and the supernatant discarded. The centrifuge tube was placed in a 37°C water bath and gently shaken. The fusion agent PEG1500 solution (50%, sterile) was slowly added within 1 minute and allowed to stand for 1 minute. Then, 2 mL of IMEM culture medium was added while shaking, and the addition should be completed within 2 minutes. Then, 10 mL of IMEM culture medium was slowly added, centrifuged at 800 rpm, and the supernatant discarded. IMEM culture medium containing dual antibodies and 10% FBS was added to the centrifuge tube, and the cells were plated on a 96-well plate. The 96-well plate was placed in a 37°C cell culture incubator and cultured. The monoclonal growth was observed after 10 days.

[0104] (3) ELISA screening of positive supernatants and clones: BAFF protein was prepared into a concentration of 0.5 μg / mL using coating solution, and plated at 50 μL / well, incubated at 2-8°C overnight. The next day, shake off the unbound antigen in the plate, add 200 μL PBS-T to each well to wash the plate, and pat dry on paper. Add 200 μL blocking solution (PBS containing 1% (w / v) BSA) to each well and incubate at room temperature for 60 min. Dilute the primary antibody according to the dilution requirements and methods of the specific experiment and incubate at room temperature for 60 min. Shake off the unbound primary antibody liquid in the plate, wash the plate 3 times with PBS-T (wash the plate), and pat dry on paper. Add 50 μL of HRP secondary antibody at the working concentration to each well and incubate at 37°C for 30 min. Shake off the unbound secondary antibody liquid in the plate, wash the plate 3 times with PBS-T (wash the plate), and pat dry on paper. Add 50 μL of TMB colorimetric reagent to each well and allow to react at room temperature for 5 min. Then, add 50 μL of stop solution to terminate the reaction. Detect the OD value at 450 nm using a microplate reader in absorbance mode and process the data.

[0105] (4) Antibody V gene analysis: DNA sequencing of PCR products was performed, and the sequencing results were compared with each other to obtain the sequence information of the target antibody. The target antibodies were all monoclonal antibodies against BAFF protein.

[0106] As shown in Table 1, antibody 2F2 has a heavy chain variable region with the amino acid sequence set forth in SEQ ID NO. 13 and a light chain variable region with the amino acid sequence set forth in SEQ ID NO. 14. The amino acid sequences of the complementarity determining regions (CDR1, CDR2, and CDR3) in the heavy chain variable region are set forth in SEQ ID NOs. 1, 2, and 3, respectively. The amino acid sequences of the complementarity determining regions (CDR1, CDR2, and CDR3) in the light chain variable region are set forth in SEQ ID NOs. 4, 5, and 6, respectively.

[0107] The 6F10 antibody has a heavy chain variable region with the amino acid sequence set forth in SEQ ID NO. 15 and a light chain variable region with the amino acid sequence set forth in SEQ ID NO. 16. The amino acid sequences of the complementarity determining regions (CDR1, CDR2, and CDR3) in the heavy chain variable region are set forth in SEQ ID NOs. 7, 8, and 9, respectively. The amino acid sequences of the complementarity determining regions (CDR1, CDR2, and CDR3) in the light chain variable region are set forth in SEQ ID NOs. 10, 11, and 12, respectively.

[0108] Table 1 Sequence information of amino acid sequences SEQ ID NO. 1 to 16

[0109]

[0110] Example 2 Affinity experiment of anti-BAFF protein antibody and BAFF protein

[0111] This example uses an ELISA method to detect the affinity between anti-BAFF protein antibodies and BAFF protein, which specifically includes the following steps:

[0112] (1) Coating: BAFF protein was prepared with coating solution at 0.5 μg / mL, and 50 μL / well was plated. Incubate at 2-8°C overnight. The next day, remove unbound antigen from the plate.

[0113] (2) Washing: Add 200 μL of PBS-T to each well and pat dry on paper. Repeat the above steps for a total of 3 washes.

[0114] (3) Blocking: Add 200 μL of blocking solution (PBS containing 1% (w / v) BSA) to each well and incubate at room temperature for 60 min.

[0115] (4) Wash the plate: Repeat step (2).

[0116] (5) Primary antibody incubation: Add 50 μL of anti-BAFF protein antibody solution to each well and incubate at room temperature or 37°C for 30 to 60 minutes. The preparation process of the anti-BAFF protein antibody is as follows: dilute the anti-BAFF protein antibody to 1000 ng / mL of anti-BAFF protein antibody solution (numbered S1) with PBS-T in a centrifuge tube, and prepare 8 centrifuge tubes containing 100 μL of diluent (numbered S2 to S9 in sequence). Pipette 50 μL of anti-BAFF protein antibody solution from the centrifuge tube numbered S1 into the centrifuge tube numbered S2 and mix thoroughly by pipetting. Pipette 50 μL of anti-BAFF protein antibody solution from the centrifuge tube numbered S2 into the centrifuge tube numbered S3 and mix thoroughly by pipetting, and so on until S9. The anti-BAFF antibody gradient concentrations were: 1000.00, 333.33, 111.11, 37.04, 12.35, 4.12, 1.23, 0.41, and 0.14 ng / mL. PBS-T was used as a blank.

[0117] (6) Wash the plate: Repeat step (2).

[0118] (7) Secondary antibody incubation: Add 50-100 μL of HRP secondary antibody at working concentration to each well and incubate at room temperature or 37°C for 30-60 min.

[0119] (8) Wash the plate: Repeat step (2).

[0120] (9) Color development: Add 50–100 μL of TMB color developer to each well and incubate at room temperature or 37°C in the dark for 5–15 min.

[0121] (10) Termination: Add 50-100 μL of stop solution to each well and tap the ELISA plate gently.

[0122] (11) Detection: Detect the OD value at 450 nm using a microplate reader in absorbance mode. Plot the affinity curve between the anti-BAFF monoclonal antibody and BAFF protein using the concentration of the anti-BAFF protein antibody as the horizontal axis and the OD value at 450 nm as the vertical axis.

[0123] EC 50 Half-maximal effective concentration (Half-Maximal Effective Concentration) is an important parameter in pharmacology and biology, used to describe the concentration of a drug or compound required to produce 50% of the maximum effect on a biological system.

[0124] The results are as follows Figure 1 As shown, the EC values ​​of the monoclonal antibodies 2F2 and 6F10 against BAFF protein of the present invention are 50The concentrations of these antibodies were 10.05 ng / mL and 21.18 ng / mL, respectively. Both antibodies have high specificity and affinity for BAFF protein, enabling quantitative detection of BAFF.

[0125] Example 3 Screening of capture-labeled antibody pairs against human BAFF protein based on the double antibody sandwich method

[0126] The detection process for the quantitative detection of BAFF using the double antibody sandwich method to detect anti-human BAFF protein antibodies specifically includes the following steps:

[0127] (1) Preparation of capture microbead working solution: Remove the anti-human BAFF protein antibody-coupled microbeads from the refrigerator and shake them in the dark at room temperature for 10 to 30 minutes. Prepare the microbead working solution in PBS-T, assuming approximately 1000 microbeads per well.

[0128] (2) Preparation of human BAFF protein solution: Recombinant human BAFF protein was diluted with PBS-T to a concentration of 5 ng / mL.

[0129] (3) Sample addition: Add 50 μL of microbead working solution and 50 μL of BAFF protein dilution solution to each well and incubate at 500-800 rpm for 1-2 hours at room temperature in the dark.

[0130] (4) Washing: Place the 96-well plate on a magnetic plate for 3 minutes and spin dry. Add 150 μL of PBS-T to each well and tap the plate. Place the plate on a magnetic plate for 3 minutes and spin dry. Repeat the above steps 2 times for a total of 3 washes.

[0131] (5) Incubation of biotinylated anti-human BAFF protein antibody: Dilute the biotinylated anti-human BAFF protein antibody according to the dilution requirements and methods of the specific experiment, add 50-100 μL of biotinylated anti-human BAFF protein antibody working solution to each well, and incubate at room temperature in the dark at 500-800 rpm for 0.5-1 hour.

[0132] (6) Washing: Repeat step (4).

[0133] (7) Incubation of R-phycoerythrin-streptavidin conjugate: Dilute the R-phycoerythrin-streptavidin conjugate according to the dilution requirements and methods of the specific experiment. Add 50-100 μL of R-phycoerythrin-streptavidin conjugate working solution to each well and incubate at 500-800 rpm at room temperature in the dark for 0.5-1 hour.

[0134] (8) Washing: Repeat step (4).

[0135] (9) Detection: Add 100 μL PBS-T to each well, gently tap to mix, and measure the fluorescence value on a multifunctional flow cytometer (Luminex 200).

[0136] The results are as follows Figure 2 As shown, the anti-BAFF monoclonal antibodies 6F10 and 2F2 of the present invention can be used as capture antibodies and labeling antibodies, respectively, to achieve quantitative detection of BAFF.

[0137] Example 4 Detection kit for detecting human BAFF protein based on double antibody sandwich immunofluorescence assay

[0138] The working principle of the kit of this embodiment for detecting anti-human BAFF protein based on the double antibody sandwich method is as follows: microspheres coupled with capture antibodies are added to a 96-well plate; human BAFF protein standards or test samples are added to the microwells of the 96-well plate, and the human BAFF protein in the standards or test samples binds to the capture antibodies on the microspheres; biotin-labeled antibodies against human BAFF protein are added to the microwells of the 96-well plate, allowing the biotin-labeled antibodies to bind to the human BAFF protein to form a capture antibody-human BAFF protein-labeled antibody complex; PE-labeled secondary antibodies are added to the microwells of the 96-well plate; fluorescence values ​​are measured on a multifunctional flow cytometer (NovaPlex-1200), and the concentration of human BAFF protein in the test sample is calculated by plotting a standard curve.

[0139] The detection kit is based on the double antibody sandwich method to detect human BAFF protein, which specifically includes the following steps:

[0140] (1) Preparation of capture microbead working solution: Remove the capture antibody-coupled microbeads from the refrigerator and shake them in the dark at room temperature for 10 to 30 minutes. Prepare the microbead working solution in PBS-T, assuming approximately 1000 microbeads per well.

[0141] (2) Preparation of BAFF protein standard: Dilute recombinant human BAFF protein to 5000 pg / mL BAFF protein standard solution with PBS-T in a centrifuge tube (numbered S1), and prepare 6 centrifuge tubes filled with 150 μL PBS-T (numbered S2 to S7). Pipette 75 μL BAFF protein standard solution from the centrifuge tube numbered S1 into the centrifuge tube numbered S2 and mix thoroughly. Pipette 75 μL BAFF protein standard solution from the centrifuge tube numbered S2 into the centrifuge tube numbered S3 and mix thoroughly, and so on until S7. The gradient concentrations of the BAFF protein standard are: 5000.00, 1666.67, 555.56, 185.19, 61.73, 20.58 and 6.86 pg / mL.

[0142] (3) Preparation of test samples: Dilute the blood sample to be tested 3 to 10 times with PBS-T in a centrifuge tube.

[0143] (4) Sample addition: First add 50 μL of microbead working solution to each well, then add 50 μL of standard or sample to be tested, and incubate at room temperature in the dark at 500-800 rpm for 1-2 hours.

[0144] (5) Washing: Place the 96-well plate on a magnetic plate for 3 minutes and spin dry. Add 150 μL of PBS-T to each well and tap the plate. Place the plate on a magnetic plate for 3 minutes and spin dry. Repeat the above steps 2 times for a total of 3 washes.

[0145] (6) Biotin antibody incubation: Dilute the biotin antibody according to the dilution requirements and methods of the specific experiment, add 50-100 μL of biotin antibody working solution to each well, and incubate at room temperature in the dark at 500-800 rpm for 0.5-1 hour.

[0146] (7) Washing: Repeat step (5).

[0147] (8) Incubation of R-phycoerythrin-streptavidin conjugate: Dilute the R-phycoerythrin-streptavidin conjugate according to the dilution requirements and methods of the specific experiment. Add 50-100 μL of R-phycoerythrin-streptavidin conjugate working solution to each well and incubate at 500-800 rpm at room temperature in the dark for 0.5-1 hour.

[0148] (9) Washing: Repeat step (5).

[0149] (10) Detection: Add 50-100 μL PBS-T to each well, gently tap to mix, and measure the fluorescence value on a multifunctional flow cytometer (NovaPlex-1200).

[0150] Among them, the standard curve for detecting human BAFF protein is as follows Figure 3 shown.

[0151] The kit of this example detects the concentration of human BAFF protein in blood samples numbered 1# to 8#, and the detection results are shown in Table 2.

[0152] Table 2 Human BAFF protein concentration in blood samples 1# to 8#

[0153]

[0154] As can be seen from Table 2, using the anti-human BAFF protein antibody pair of the present invention, the detection kit of the present application is suitable for detecting blood samples or samples from other tissue sources, and has clinical application prospects.

[0155] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. An anti-BAFF protein antibody pair, characterized in that: The antibody pair comprises two monoclonal antibodies; the monoclonal antibodies comprise a heavy chain variable region and a light chain variable region; the heavy chain variable region comprises a heavy chain HCDR1, a heavy chain HCDR2 and a heavy chain HCDR3; the light chain variable region comprises a light chain LCDR1, a light chain LCDR2 and a light chain LCDR3; One of the monoclonal antibodies in the antibody pair is the 2F2 antibody, and the sequence information of the 2F2 antibody is as follows: The amino acid sequence of the heavy chain HCDR1 is shown in SEQ ID NO.1; The amino acid sequence of the heavy chain HCDR2 is shown in SEQ ID NO.2; The amino acid sequence of the heavy chain HCDR3 is shown in SEQ ID NO. 3; The amino acid sequence of the light chain LCDR1 is shown in SEQ ID NO.4; The amino acid sequence of the light chain LCDR2 is shown in SEQ ID NO.5; The amino acid sequence of the light chain LCDR3 is shown in SEQ ID NO.6; The other monoclonal antibody in the antibody pair is 6F10 antibody, and the sequence information of the 6F10 antibody is as follows: The amino acid sequence of the heavy chain HCDR1 is shown in SEQ ID NO.7; The amino acid sequence of the heavy chain HCDR2 is shown in SEQ ID NO.8; The amino acid sequence of the heavy chain HCDR3 is shown in SEQ ID NO.9; The amino acid sequence of the light chain LCDR1 is shown in SEQ ID NO.10; The amino acid sequence of the light chain LCDR2 is shown in SEQ ID NO.11; The amino acid sequence of the light chain LCDR3 is shown in SEQ ID NO.

12.

2. The antibody pair according to claim 1, characterized in that The amino acid sequence of the heavy chain sequence of the 2F2 antibody is shown in SEQ ID NO.13; the amino acid sequence of the light chain sequence of the 2F2 antibody is shown in SEQ ID NO.14; the amino acid sequence of the heavy chain sequence of the 6F10 antibody is shown in SEQ ID NO.15; and the amino acid sequence of the light chain sequence of the 6F10 antibody is shown in SEQ ID NO.

16.

3. A nucleotide molecule, characterized in that The nucleotide molecule encodes the amino acid sequence of the 2F2 antibody or 6F10 antibody according to claim 1 or claim 2.

4. The nucleotide molecule according to claim 3, characterized in that The nucleotide molecule encoding the heavy chain sequence of the 2F2 antibody is shown in SEQ ID NO.17; the nucleotide molecule encoding the light chain sequence of the 2F2 antibody is shown in SEQ ID NO.18; the nucleotide molecule encoding the heavy chain sequence of the 6F10 antibody is shown in SEQ ID NO.19; and the nucleotide molecule encoding the light chain sequence of the 6F10 antibody is shown in SEQ ID NO.

20.

5. A biomaterial, characterized in that The biological material includes one of the following substances: (1) A nucleotide molecule encoding the amino acid sequence of claim 1 or claim 2; (2) a vector comprising the nucleotide molecule described in (1); (3) A host cell comprising (1) the nucleotide molecule and / or (2) the vector or transformed or transfected by (1) the nucleotide molecule and / or (2) the vector.

6. The biomaterial according to claim 5, characterized in that: The vector is a vector plasmid, a phage vector, a virus vector or an artificial chromosome vector.

7. The biomaterial according to claim 5, characterized in that The host cell is a microbial cell, an insect cell or a non-insect animal cell.

8. A kit for detecting BAFF protein, characterized in that: The kit comprises the antibody pair according to claim 1 or claim 2.

9. The kit according to claim 8, characterized in that The 2F2 antibody is a labeled antibody, and the 6F10 antibody is a capture antibody.

10. Use of the antibody pair according to claim 1 or claim 2 in preparing a reagent for detecting BAFF protein.

Images