Reagent composition, kit and use for liver cancer detection

Abstract

This invention relates to the field of biodetection technology, and discloses a reagent composition, kit, and uses for liver cancer detection. The reagent composition provided by this invention includes a detection... FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The combination of primers and probes for gene methylation status enables the detection of methylation status of specific target sequences in the aforementioned liver cancer characteristic genes, achieving high sensitivity and specificity for liver cancer detection. The reagent composition of this invention allows for non-invasive liver cancer screening, and compared to conventional liver ultrasound and alpha-fetoprotein (AFP) testing, it significantly improves detection sensitivity, increases the accuracy of early liver cancer screening, and substantially reduces the rates of misdiagnosis and missed diagnosis.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a reagent composition, kit, and application for liver cancer detection. Background Technology

[0002] Primary liver cancer is one of the most common malignant tumors, and early detection and diagnosis are crucial for improving the overall survival rate of liver cancer. Currently, various methods for liver cancer detection and screening exist, but they still have many limitations. For example, liver ultrasound combined with alpha-fetoprotein (AFP) testing is the most widely used liver cancer screening method, offering advantages such as low cost, low equipment requirements, and ease of implementation across regions with varying medical conditions. However, ultrasound examination is easily affected by the operator's skill and experience, as well as the patient's condition (e.g., obesity), while AFP levels are related to the size of liver cancer lesions and the degree of vascular invasion. Studies have found that approximately 30-40% of liver cancer patients are AFP negative. Clinical statistics show that the sensitivity of liver ultrasound combined with AFP testing for early liver cancer detection is only 63%, indicating a certain rate of misdiagnosis and missed diagnosis. Commonly used diagnostic methods for liver cancer also include imaging examinations such as CT and magnetic resonance imaging (MRI), but these methods are complex to operate, require sophisticated equipment, and are not suitable for large-scale screening. A biopsy is the gold standard for diagnosing liver cancer, as it can clarify the nature of the lesion and the molecular subtype of liver cancer. However, it is an invasive procedure and carries the risk of tumor rupture, bleeding, and dissemination. Moreover, this method cannot be used for early screening of liver cancer.

[0003] Therefore, there is an urgent need to develop non-invasive, convenient, and highly accurate early screening technologies to compensate for the shortcomings of existing methods and improve the early diagnosis rate of liver cancer. Summary of the Invention

[0004] The purpose of this invention is to overcome the aforementioned problems in the prior art and provide a reagent composition, kit, and application for liver cancer detection. The composition provided by this invention detects the methylation level of specific genes, exhibiting high detection specificity and sensitivity, enabling efficient liver cancer screening.

[0005] To achieve the above objectives, the present invention provides a reagent composition for liver cancer detection, the reagent composition comprising a combination of primers and probes:

[0006] (1) Detection FAM109B Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:7-8, and probes with nucleotide sequences as shown in SEQ ID NO:9;

[0007] (2) Detection RIMS2Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:10-11, and probes with nucleotide sequences as shown in SEQ ID NO:12;

[0008] (3) Detection SNX31 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:13-14, and probes with nucleotide sequences as shown in SEQ ID NO:15; and / or primers with nucleotide sequences as shown in SEQ ID NO:25-26, and probes with nucleotide sequences as shown in SEQ ID NO:27;

[0009] (4) Detection FAR1 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:16-17, and probes with nucleotide sequences as shown in SEQ ID NO:18;

[0010] (5) Primers and probes for detecting the methylation status of the FLJ26850 gene: primers with nucleotide sequences as shown in SEQ ID NO:19-20, and probes with nucleotide sequences as shown in SEQ ID NO:21.

[0011] A second aspect of the present invention provides a reagent kit for detecting liver cancer, the reagent kit comprising the reagent composition described in the first aspect.

[0012] A third aspect of the present invention provides the use of the reagent composition described in the first aspect in the preparation of a product for screening liver cancer.

[0013] Through the above technical solution, the present invention can achieve at least the following beneficial effects:

[0014] (1) When the present invention performs combined detection of specific liver cancer characteristic genes, it has a good screening effect on liver cancer, and the detection stability, specificity and sensitivity are all at a high level.

[0015] (2) The composition of the present invention can be used for non-invasive early screening and diagnosis of liver cancer, which is beneficial to improving patient compliance, reducing the difficulty of detection, and has the potential for clinical application and promotion.

[0016] (3) When using the composition / kit of the present invention for liver cancer screening, it has high detection sensitivity and specificity for both tissue samples and plasma samples, and high cancer type specificity. Compared with existing liver cancer detection and screening methods, it reduces the misdiagnosis rate and missed diagnosis rate. Attached Figure Description

[0017] Figure 1This is a graph showing the results of quantitative real-time PCR detection of a positive control with a methylation ratio of 0.5% and a reaction concentration of 10 ng / mL, using the kit from the preparation example in Example 1.

[0018] Figure 2 This is a graph showing the results of quantitative real-time PCR detection of a negative control (20 ng / reaction) using the kit from the preparation example in Example 1. Detailed Implementation

[0019] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0020] In this invention, "methylation level" and "methylation status" both refer to the methylation status of the target sequence in the marker gene (which may include whether the target sequence in the marker gene is methylated, the degree of methylation, etc.), have similar meanings, and can be used interchangeably.

[0021] Studies have shown that methylation of specific genes is closely related to cancer development. Currently, the number of genes considered associated with liver cancer is relatively limited, and most detection schemes target the methylation of single genes. However, research has found that some genes exhibit methylation in multiple cancer types, making it easy to misdiagnose by detecting the methylation level of a single gene. Therefore, the screening effect for liver cancer remains unsatisfactory, with frequent cases of missed screening and false positives, necessitating the use of multiple detection methods for combined diagnosis. Through long-term research, the inventors of this invention have ingeniously discovered that a combined detection method targeting the methylation levels of several specific genes among liver cancer-related characteristic genes has excellent sensitivity and specificity, thereby effectively improving the screening accuracy.

[0022] Based on this, a first aspect of the present invention provides a composition for detecting liver cancer, the composition comprising a reagent for detecting the methylation state of a liver cancer characteristic gene or a fragment thereof, wherein the characteristic gene includes FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 Gene.

[0023] The gene names involved in this invention have general meaning in the art, and their complete sequences can be obtained through conventional methods in the art, such as by querying public bioinformatics databases like NCBI. For example, FAM109BThe complete gene sequence can be found in GenBank accession number: NG_132550.1; RIMS2 The complete gene sequence can be found in GenBank accession number: NG_053027.1; SNX31 The complete gene sequence can be found in GenBank accession number: AP001205.3; FAR1 The complete gene sequence can be found in GenBank accession number: NG_041826.1; FLJ26850 The complete gene sequence can be found in Genbank accession number: NG_141873.1.

[0024] The composition provided by this invention can target the complete FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The methylation level of a gene can be detected, or the methylation level of a specific segment (e.g., a single segment or multiple segments) within the aforementioned gene can be detected. The inventors discovered in their research that, for FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 Detecting and analyzing the methylation levels of specific regions within a gene can achieve liver cancer screening with high sensitivity and specificity. Compared to detecting the entire gene, detection of specific regions is simpler and easier; therefore, this invention preferably uses a method targeting specific regions in the composition. FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 A reagent for detecting the methylation level of specific regions in a gene.

[0025] According to some preferred embodiments of the present invention, the reagent used to detect the methylation status of hepatocellular carcinoma (HCC) characteristic genes or fragments thereof is a reagent used to detect the methylation status of CpG island regions or fragments thereof in HCC characteristic genes. CpG is an abbreviation for cytosine (C)-phosphate (p)-guanine (G), and a "CpG island" refers to a region on the genome rich in CpG dinucleotides.

[0026] The composition provided by this invention can detect the methylation level in the complete sequence of the CpG island region in the aforementioned genes, or it can detect the methylation level in a portion of the region (such as a single fragment or multiple fragments).

[0027] According to some particularly preferred embodiments of the present invention, the reagent used to detect the methylation status of liver cancer characteristic genes or their fragments is a reagent used to detect the methylation status of gene fragments (also referred to as "target sequences" or "target marker sequences" in the present invention) with nucleotide sequences such as SEQ ID NO:1-5.

[0028] The composition of the present invention can detect the methylation level of the target sequence described above, or it can detect the methylation level of a segment in a characteristic gene that has at least 80% homology to the target sequence (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 100%, or any range consisting of any two of the above values, or any intermediate value within that range). For example, it can detect the methylation level of a gene fragment that contains additional nucleotides on top of the above sequence.

[0029] According to a preferred embodiment of the present invention, the composition further includes a reagent for detecting an internal standard. An "internal standard" refers to a non-target gene (or fragment thereof) that is detected together with the target gene (or a fragment thereof). Adding an internal standard reagent during detection can further improve detection accuracy. Typically, a known conserved gene from the target analyte (e.g., the sample used for detection) can be selected as the internal standard.

[0030] Preferably, the internal label is at least one of the housekeeping genes. "Housekeeping genes," also known as "family-managing genes" or "housekeeping genes," are a class of genes that are stably expressed in all cells.

[0031] According to a particularly preferred embodiment of the present invention, the internal standard is... ACTB The gene (whose complete sequence can be found in the Gene Bank accession number: NC_000007.14) or a fragment thereof. ACTB The gene is the gene that encodes human cytoskeleton actin (β-Actin).

[0032] Preferably, the target sequence of the internal standard is as shown in SEQ ID NO:6.

[0033] In this invention, the reagents used to detect the methylation level of the characteristic gene and (optionally) the internal standard can be conventional reagents used in methods capable of performing the corresponding detections in the art. For example, detection can be performed using amplification-sequencing, biochips, quantitative PCR for methylation, etc. Correspondingly, the reagents commonly used in the above-mentioned methods can be used in the composition of this invention.

[0034] For example, when using methylation quantitative PCR for detection, according to a preferred embodiment of the present invention, the composition includes nucleic acid primers and probes. "Methylation quantitative PCR" refers to a method that involves converting the region to be detected by sulfite conversion or digesting it with a methylation-sensitive restriction endonuclease, followed by quantitative PCR detection using primers and probes specifically designed for the detection target, thereby determining the methylation level of the region to be detected.

[0035] Any nucleic acid primers and probes capable of detecting the aforementioned characteristic genes and (optionally) internal standards are applicable to this invention. "Primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of primer extension products complementary to the nucleic acid strand—that is, in the presence of nucleotides and an inducer such as DNA or RNA polymerase and at suitable temperature and pH—can serve as a synthesis initiation site. Primers typically contain at least about 9, 10, 15, 20, or 25 or more nucleotides. "Probe" refers to a nucleic acid sequence that hybridizes to a target sequence under specified conditions and can be used to detect the presence of that target sequence. The probe is a fragment that hybridizes to at least 15 nucleotides in the target sequence of the target gene under stringent conditions. For better detection results, according to a particularly preferred embodiment of the invention, the composition comprises a combination of the following primers and probes:

[0036] (1) Detection FAM109B Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:7-8, and probes with nucleotide sequences as shown in SEQ ID NO:9;

[0037] (2) Detection RIMS2 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:10-11, and probes with nucleotide sequences as shown in SEQ ID NO:12;

[0038] (3) Detection SNX31 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:13-14, and probes with nucleotide sequences as shown in SEQ ID NO:15; and / or primers with nucleotide sequences as shown in SEQ ID NO:25-26, and probes with nucleotide sequences as shown in SEQ ID NO:27;

[0039] (4) Detection FAR1 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:16-17, and probes with nucleotide sequences as shown in SEQ ID NO:18;

[0040] (5) Detection FLJ26850 Primers and probes for genotyping: primers with nucleotide sequences as shown in SEQ ID NO:19-20, and probes with nucleotide sequences as shown in SEQ ID NO:21.

[0041] Preferably, the composition further includes:

[0042] (5) Detection of internal standard ( ACTB Primers and probes for the gene: primers with nucleotide sequences as shown in SEQ ID NO:22-23, and probes with nucleotide sequences as shown in SEQ ID NO:24.

[0043] According to a preferred embodiment of the present invention, the probe is modified with a reporter group (usually located at the 5' end), preferably a fluorescent reporter group. Any fluorescent reporter group commonly used in the art can be used in the present invention, such as ATTO 425, HEX, FAM, ROX, CY5, Quasar705, AF405, etc.

[0044] According to a preferred embodiment of the present invention, the probe is further modified with a fluorescence quenching group (typically located at the 3' end). Any quenching group commonly used in the art for use with a fluorescent reporter group is applicable to the present invention. For example, it can be BHQ-0, BHQ-1, BHQ-2, SQ1, SQ2, etc. Those skilled in the art are familiar with the pairing between fluorescent groups and their corresponding fluorescence quenching groups, and will not be elaborated further here.

[0045] According to some preferred embodiments of the present invention, the composition further includes a negative control reagent and / or a positive control reagent.

[0046] The negative control reagent refers to the unmethylated target gene (such as the aforementioned characteristic gene or its fragment). In the composition provided by the present invention, the negative control may contain only one verified unmethylated characteristic gene or its fragment, or it may contain multiple verified unmethylated characteristic genes or their fragments.

[0047] A positive control reagent refers to a target gene known to be methylated (such as the aforementioned characteristic gene or its fragment). In the composition provided by the present invention, the positive control may contain only one verified methylated characteristic gene or its fragment, or it may contain multiple verified methylated characteristic genes or their fragments.

[0048] In the composition provided by the present invention, both the negative control and the positive control can be obtained by conventional means, such as by artificial synthesis.

[0049] A second aspect of the present invention provides a kit for screening liver cancer, the kit comprising the composition described in the first aspect.

[0050] The kit provided by this invention may contain only the core reagents for detecting liver cancer (such as primers and probes used in the aforementioned characteristic gene detection), or it may further contain other conventional reagents required for the detection process (such as buffer systems, enzymes, nucleotides, and other reagents required for PCR detection; or reagents required for sample pretreatment steps such as nucleic acid extraction, purification, and methylation detection). Any reagent commonly used in the field for characteristic gene detection can be applied to this invention, and those skilled in the art can select and adjust it according to the actual detection technology used.

[0051] According to some preferred embodiments of the present invention, the kit further includes at least one of an enzyme, a buffer, a magnesium source, and deoxyribonucleoside triphosphates (dNTPs).

[0052] Preferably, the enzyme comprises a methylation-sensitive restriction endonuclease and / or a DNA polymerase. Any enzyme suitable for use in methylation-based quantitative PCR is applicable to this invention. Preferably, the methylation-sensitive restriction endonuclease comprises at least one of HpaII, HinP1I, and HhaI. Any DNA polymerase available in the art for methylation-based quantitative PCR can be used in this invention; for example, conventional DNA polymerases or hot-start DNA polymerases (such as Taq polymerase) can be used.

[0053] Preferably, the magnesium source comprises a water-soluble inorganic Mg salt. Typically, the magnesium source can be provided in aqueous solution form, such as Mg... 2+ Magnesium chloride, magnesium sulfate, magnesium nitrate, etc., with concentrations of 1-6 mM.

[0054] More preferably, the kit also includes reagents for nucleic acid extraction and / or purification.

[0055] The reagents used for nucleic acid extraction and / or purification are primarily used to extract nucleic acids from samples, and the extracted nucleic acids are further detected using the reagents contained in the kit of this invention for detecting the methylation level of characteristic genes. Any reagents in the art that can be used to extract / purify nucleic acids from biological samples are applicable to this invention; they can be purchased directly from commercial sources or prepared according to existing technology. Biological samples can be test samples collected from subjects in need, such as at least one of histological sections, tissue biopsies / paraffin-embedded tissues, cells, blood samples (such as whole blood, plasma, etc.).

[0056] In this invention, there are no particular restrictions on the concentration of the various reagents contained in the kit, and they can be adjusted according to actual testing needs.

[0057] To achieve better detection results (such as improved sensitivity, specificity, and accuracy), according to some preferred embodiments of the present invention, the reagents included in the kit contain Mg. 2+ The final concentration of the primer can be 1-6 mM; the final concentration of the dNTPs can be 1-80 mM; the final concentration of the methylation-sensitive restriction endonuclease can be 0.01-30 U / μL; the final concentration of the primer can be 0.1-40 μM; and the final concentration of the probe can be 0.1-20 μM. The final concentrations of primers and probes refer to the final concentration of one primer / probe.

[0058] The present invention further provides a method for detecting liver cancer, the method comprising detecting a sample using the composition described in the first aspect or the kit described in the second aspect.

[0059] The methods provided by this invention can be diagnostic or non-diagnostic. For example, a diagnostic method may include using the compositions or kits provided by this invention to test samples from subjects in need and determine whether they pose a risk of liver cancer, thereby determining subsequent treatment plans (e.g., whether to conduct further diagnosis and testing, whether to conduct further treatment, etc.). As another example, a non-diagnostic method may include using the compositions or kits provided by this invention to test samples in research or non-diagnostic testing, such as using the compositions or kits provided by this invention to test samples in liver cancer mechanism research, drug development, etc.

[0060] A third aspect of the present invention provides the use of the composition described in the first aspect in the preparation of a product for screening liver cancer.

[0061] The fourth aspect of the present invention provides for FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The use of reagents for combined detection of gene methylation status in the preparation of products for liver cancer detection.

[0062] According to some preferred embodiments of the present invention, the product for screening liver cancer may be a reagent kit.

[0063] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0064] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents are of analytical grade.

[0065] Preparation Example

[0066] 1. Identify the target gene and prepare the target sequence and primers and probes for detecting the target sequence.

[0067] by FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The combination of genes serves as a characteristic gene, and its target sequence is shown below:

[0068] GGATCGCCCTCTTGGGCTTCGGTGCGATCGGCGGCGGGAGGTGAGAGTGGGCCCGGCGGGCTCCGGGAGGAGGTGGCCCCAGGGAAGGTGTGGCCGCGGGGAAGTGGCGGCGAACAGCCCCGACGCGAGGACG GGGAAACCAAGGCGGCAGCCAGGGAGACCCTGACCGAGGTGACCTCTGTTTAGGGCGACAACCGGGTTGGGGCTCCCCGCAGTGGCCACTGGCCCGGCGGTCCCGCACCCCCAGCCCGCCTCTCCTCCA (SEQ ID NO:1, FAM109B (Target sequence of the gene).

[0069] GGCGGCGGCACTGAGCGGCGGCGGCGCAGGGCGCGCGGGCCTTCCGGCCGACTCCATCGACCCAAGGGGCGGCGGCGGTGGCGGCGGCTGAGCGACCCTGGGCCGGGCGCGTGATGAGGAGGGGCCGGCGCCAGACCCC GCTGCACGTCGGAGCTCGCCTGGATCCGGGCGTTGGCAGCCGAAGGGCCCTGGCCCCGGGACTCTCCGCCGCTAGCCCCGTCATATCTTCTCCGCTTTCGCTTCTCCACTCTAGCCGGGGGTGGGGTGGGTGGGG (SEQ ID NO:2, RIMS2 (Target sequence of the gene).

[0070] ACCGGGATACAGAAATGCATCTTCATGGCTGAGCGGTGTCTTGGGAGTAGCGCTGGGAACCCGACCTGCGGCGGCGGGCGGTGCGCGGCTCTGAACTCGGCAGCGGTGGACGCAGCGCGGCCTGCCACGCGACTCAGAGCGAACCCCGGCGCCCGCTCTCGCCGGCCGGGGACATCTACAGGTGGGGCCGGGGCCGGGCCGCGCCGCCTCCCAGTCCCCGCCCCATCCAGCCCCGCCGCTCTGGTCCCGGGATAGGTGGCGCCTGGGGCTGGGGCG (SEQ ID NO:3, SNX31 Target sequence of the gene);

[0071] CCGTGGAGGCTCCAGGGGTCCGTAGAGCTCTTCGCTCTCACCGACCCGGGCCACACCCGCCAAGCTGGTAGTTCTCCGAACGGATCCCTCACGCCCAGCAATGGCCGGAGGGCCCCCGGGCCCCACCATAATAGCGCTAAGCACGCCACAATGGCAGCCCCGCTGTCTCCCGCGCGGGCCTCGCTGCGTGCTCCCAACCTTGGGAGTTGGCGCCCCTCCCGCGCGACGGACAGCCGGGCGTGGCCCTGGGCGCGACCCGACAGGACGCCAGCAGCCGGCGG (SEQ ID NO:4, FAR1 Target sequence of the gene);

[0072] ACGTTCTGTAAGCCCCGCCCCCACTGCGTGCGGGCGGCTTTTGTCTCCACGGCAACCGTCAACTCTGGAAACGCCTGTCTTTCTCCATGGCAACTGTCTACGCCGCAGGCTGGAGCTGCCCATTACCGGAGCCCGTAAGCAGTATGGGTGCTGGACAAACAGCGTGATCGGGTCGTAAAACTTGGTGGAAAACGAATATTAGAGCACAAGGAAGGAAAAACCGGGCTGGGTGGGACTGAAATAGTTGATGTGAGGGAAGATTTCTCAAAGGGAGACTATTTTTTTATTGTTTG (SEQID NO:5, FLJ26850(Target sequence of the gene).

[0073] by ACTB Using genes as internal standards further improves detection accuracy. The target sequences of the internal standards are shown below:

[0074] TTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGA ATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCTCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGA (SEQ ID NO:6, ACTB (Target sequence of the gene)

[0075] The primers and probes used for detection are shown in Table 1, and all were synthesized by Hunan Kangde Biotechnology Co., Ltd. In Table 1, primers marked with "F" are upstream primers, primers marked with "R" are downstream primers, and probes are marked with "P".

[0076] Table 1

[0077]

[0078] 2. Prepare the unit reaction reagent kit for PCR reaction.

[0079] Prepare the corresponding reagents according to the required amount of reagents for the unit reaction reagent kits (i.e., reagent kits used to test one sample in one PCR reaction) in Table 2.

[0080] Table 2

[0081]

[0082] In Table 2, the PCR amplification buffer was purchased from Hunan Kangde Biotechnology Co., Ltd., catalog number PCR buffer (S10); the Taq enzyme was purchased from Feipeng Biotechnology Co., Ltd.; the methylation-sensitive restriction endonuclease mix was purchased from Hunan Kangde Biotechnology Co., Ltd., catalog number MRE S01, catalog number ME012-01; the reagents were packaged separately according to the “PCR reaction solution” and “enzyme” in the table, that is, the PCR reaction solution is a mixture of the listed components, and the enzyme is a mixture of the listed enzymes.

[0083] 3. Prepare control reagents

[0084] Negative controls: Nucleic acid sequences of SEQ ID NO:1-5 that are artificially synthesized and verified by sequencing to be unmethylated, with a concentration of 2 ng / µL for each negative control.

[0085] Positive controls: These are mixtures of standard methylated human genomic DNA and unmethylated human genomic DNA of the target gene, including: 10% standard methylated human genomic DNA at a concentration of 1 ng / µL; 1% standard methylated human genomic DNA at a concentration of 1 ng / µL; and 0.5% standard methylated human genomic DNA at a concentration of 1 ng / µL.

[0086] 4. Prepare the reagent kit

[0087] According to the target detection capacity of a single kit, combine and package the reagents prepared in steps 1-3.

[0088] Example 1

[0089] The kit prepared in this example was used to detect gene methylation levels in standards to determine its sensitivity and specificity. The standards served as both positive and negative controls in the kit.

[0090] Specific testing methods include:

[0091] Take a unit reaction reagent kit, mix the reagents in the PCR tube, add 10 μL of standard, mix well, and then place the PCR tube in the Hongshi Real-Time PCR Analyzer. Perform the PCR reaction according to the reaction conditions in Table 3.

[0092] Table 3

[0093]

[0094] Based on the fluorescent labeling group on the probe, the FAM channel (Reportere: FAM, Quencher: None) is selected for detection. FAM109B Select the ROX channel (Reportere:ROX, Quencher:None) for detection. RIMS2 Select the HEX channel (Reporter: HEX, Quencher: None) for detection. SNX31 Select the AF405 channel (Reporter: AF405, Quencher: None) for detection. FAR1 Select the ATTO 425 channel (Reporter: ATTO 425, Quencher: None) for detection. FLJ26850 Select the CY5 channel (Reportere:CY5, Quencher:None) to detect the internal standard.

[0095] After the reaction is complete, the instrument automatically saves the results, which can be automatically analyzed using the instrument's built-in software (or manually adjusted for the baseline start value, end value, and threshold line value). The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the number of cycles required for the fluorescence signal in the PCR reaction tube to reach the set threshold).

[0096] Figure 1 and Figure 2 The detection results for the positive control (10 ng / reaction, methylation ratio of 0.5%) and the negative control (20 ng / reaction) are shown respectively. As can be seen from the figure, the positive control showed obvious amplification curves for all target genes, while the negative control showed only an amplification curve for the internal standard. This indicates that the kit of the present invention has excellent specificity, and the fact that it can detect even at such a low final concentration in the positive control demonstrates its excellent sensitivity.

[0097] Example 2

[0098] The kit prepared in the example was used to test actual samples to verify its detection effect on liver cancer.

[0099] The test samples used in this embodiment were all clinical samples collected from Xiangya Hospital of Central South University. The research content of this embodiment has obtained informed consent from the relevant personnel.

[0100] The clinical samples used in this embodiment include 200 clinical plasma samples (including 90 liver cancer patients, 70 hepatitis B patients, and 40 other cancer patients) and paraffin section samples of cancer tissue from 50 liver cancer patients.

[0101] Specific testing and verification methods include:

[0102] (1) Sample processing

[0103] Nucleic acid (cfDNA) was extracted from plasma samples using a plasma cell-free DNA extraction kit (Sansure Biotech, S4008); nucleic acid was extracted from liver cancer tissue samples using a paraffin section extraction kit (Nanjing Novizan Biotech, DM601-01).

[0104] (2) Sample testing and result analysis

[0105] Following the method described in Example 1, methylation fluorescent PCR was performed on the nucleic acids extracted from each sample. A Ct value ≤ 32 for each target was considered positive; otherwise, it was considered negative. The detection sensitivity and specificity for different types of samples were then calculated using the following formula, and the results are shown in Table 4.

[0106] Tissue sample detection sensitivity (%) = (Number of positive detections / Total number of positive cases) × 100%

[0107] Plasma sample testing sensitivity (%) = (Number of positive detections / Total number of positive cases) × 100%

[0108] Plasma sample testing specificity (%) = (Total number of negative detections / Total number of negative samples) × 100%

[0109] Table 4

[0110]

[0111] Based on the test results in Table 4, the cancer type specificity was calculated using the following formula (where negative samples represent the total number of samples from all non-liver cancer patients):

[0112] Cancer type specificity (%) = (Number of negative detections in other cancer patients / Total number of other cancer patients) × 100% = 90.0%

[0113] The test results above show that, using... FAM109B , RIMS2 , SNX31 , FAR1, FLJ26850 The five-target biomarker combination exhibits extremely high sensitivity (98.0%) in detecting liver cancer tissue samples, indicating that these five biomarkers are liver cancer tissue-specific methylation genes closely related to liver cancer. Therefore, using this method for liver cancer screening results in high accuracy and a low false negative rate. Furthermore, the detection of plasma samples from other cancer patients using the target biomarker combination of this invention achieves a specificity of 90.0%, demonstrating good cancer-specificity and a low false positive rate. The detection sensitivity of plasma samples using the target biomarker combination of this invention reaches 90.0%, and the specificity reaches 92.7%, outperforming ultrasound and AFP detection, thus providing an effective and accurate new method for liver cancer screening and diagnosis.

[0114] Example 3

[0115] The clinical samples used in Example 2 were tested according to the method in Example 2, except that the kit used to detect marker genes was used instead of the method described in Example 2. SNX31 The primers and probes for the target sequence were replaced with the primers and probes in Table 5 below (the primers and probes for other marker genes and internal standards remain unchanged. In Table 5, those marked with "F" are upstream primers, those marked with "R" are downstream primers, and those marked with "P" are probes).

[0116] Table 5

[0117]

[0118] The detection results of each clinical sample were judged and analyzed using the method described in Example 2, and the detection sensitivity and specificity of different types of samples were calculated. For details, please refer to Table 6.

[0119] Table 6

[0120]

[0121] Comparative Example 1

[0122] The clinical samples used in Example 2 were tested according to the method in Example 2, except that the target sequence was replaced with the following target sequence ( FLJ26850 (The gene and internal standard target sequences remain unchanged). The primers and probes for these target sequences are shown in Table 7 below (the primers and probes for the internal standard remain unchanged. In Table 7, those marked with "F" are upstream primers, those marked with "R" are downstream primers, and those marked with "P" are probes).

[0123] GGAAGGCCATTCTAGGCTGCAGGAACTGCAAGGGCAAAGGCTCTGAGGCGGGAGCCAGGTTCATGGGCAGATGTTTGAGGACACCTCCGGCTTCCAGGGCCTTCCAGAAGTTCCAGTCTCTTGGGTTTGGTTGTGCATTC CTGCGACCTTCACCGCAGGCCTCCTCCTCCACCCACTAGTGCAGAGCCTGGGGGCTGCCGGTGGGTTTCAGGCCAGGGAAGCAGAAATGGGTAATTTCCAGAGCCAGAAATCAGCCGACCCCGGTGGCCCGGTGGG (SEQ ID NO:28, FAM109B (Target sequence for gene substitution)

[0124] GACACCCCAGGGACCCTTCCTCCCTCCTCACGTTCTCCCTCCTTCCAGGATCCCGCCCCGACACTTCGGGGCCCTCCCGCTACGCGCACTCTTTCTCCTCAGGTCCTGACACCTGGGCGCCCCCTCCCTGTCACCCACCTTCAGCTCCAGCCCTGACTCTCGGGCGCCTTGCCACCCTTACGCTCCCCGCCCCGCCCCGGTCCCTCGGGCGCCCCCACTCGCCGCCTCTACCTCCCTACCTGCTACACCTGGCACCCCTGCCCCCACCCCTGCTCATAC (SEQ ID NO:29, RIMS2 Replacement target sequence of the gene)

[0125] GCGGGCACTGAAATGGGGCCCAGCATAGCCCCAGCGCCCTGCCAGGCGGCGCTAGCGGGGATCACCCGGCTGCAACTGCGAGGGGCTTGGAAGAATCACCTGCGCCCGGTTCCCTCATCTCACAGCTGTAGGCGACCAGGAGCCGCAGCATGCATTCATCCAACTGTATGCCAAGCAATTCAGTTCATCCTTACCAGGACCCTGTTTCACAATAGGAAGCCCGAGGCCGTGAAAGGCCCAGTGTCTTGCCAGAGTCAGAGGAACAGAGCGCTTTGG (SEQ ID NO:30, SNX31 Replacement target sequence of the gene)

[0126] GCTCGGGCTGCAGGCCTGGCCGAGGCGGGGGCGCCGACCAGCCGTCCCGCCCCCGCCCCCGCCCGGGTACGCCCAGAAGTGAGGGCGCCCGCCTCACCCCGGGTGGTCTCTGCCCCTCTTTGCCCCGCCGCCGCCCTTCACAGGGCCGGGACCGCGTGGGGGACGTACGGTGGGGCCTGGTTTGCAGCCGCGGAGCCCGGGGAGCCGCCTGGGGTGGGAGGCCGCTAGAGGTGGCGAAGGTGGGGCGGGGTGGTTAGCCGAGCAGCGGGCTCCGCG (SEQ ID NO:31, FAR1 Replacement target sequence of the gene)

[0127] Table 7

[0128]

[0129] The detection results of each clinical sample were judged and analyzed using the method described in Example 2, and the detection sensitivity and specificity of different types of samples were calculated. For details, please refer to Table 8.

[0130] Table 8

[0131]

[0132] A comparison of the data in Tables 4, 6, and 8 shows that when the combination of liver cancer characteristic genes selected in this invention is tested, changes in the target sequences of each gene or changes in the primers and probes targeting the same target sequence will lead to significant changes in detection sensitivity and specificity. Moreover, such changes in detection results are difficult to predict and cannot be inferred from existing detection results.

[0133] Comparative Example 2

[0134] The clinical samples used in Example 2 were tested, and the testing and judgment methods were the same as in Example 2. The difference was that the target gene was selected... FAM109B , RIMS2 , SNX31 , FAR1, FLJ26850 and SEPT9 The combination of 4 or 5 genes was used to compare the diagnostic performance of different target genes in combination for liver cancer.

[0135] FAM109B Gene, RIMS2 Gene, SNX31 Gene, FAR1 Genes and FLJ26850 The target sequences of the gene are shown in SEQ ID NO:1-5, and their primers and probes are detailed in Table 1. SEPT9 The target sequence of the gene is Genbank ID NG_011683.2 (96463-96594), and its primers and probes are shown in Table 9 below.

[0136] Table 9

[0137]

[0138] Note: ME-SEPT9-P is modified with a fluorescent reporter group at the 5' end and a corresponding fluorescent quencher group at the 3' end. The specific modified group depends on the fluorescent reporter group modified on the probes of other genes being detected together (so that the fluorescent reporter group modified on this probe is detected in a different channel than the fluorescent reporter group modified on the probes of other genes).

[0139] The detection sensitivity and specificity of plasma samples when combined with different target gene combinations were calculated using the method described in Example 2. The results are detailed in Table 10.

[0140] Table 10

[0141]

[0142] As can be seen from Table 10, the detection results of different target gene combinations in the above-mentioned target gene joint detection system are different. Among them, the target gene combination selected in this invention ( FAM109B, RIMS2, SNX31, FAR1 and FLJ26850 The detection sensitivity and specificity of this combination are the highest. In other words, among these combined detection systems, the false negative rate and false positive rate are the lowest when using this combination for liver cancer screening. This indicates that the combined detection of this gene combination for liver cancer screening is more suitable for promotion and application in clinical and research work.

[0143] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A reagent composition for liver cancer detection, characterized in that, This reagent composition comprises a combination of the following primers and probes: (1) Detection FAM109B Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:7-8, and probes with nucleotide sequences as shown in SEQ ID NO:9; (2) Detection RIMS2 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:10-11, and probes with nucleotide sequences as shown in SEQ ID NO:12; (3) Detection SNX31 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:13-14, and probes with nucleotide sequences as shown in SEQ ID NO:15; and / or primers with nucleotide sequences as shown in SEQ ID NO:25-26, and probes with nucleotide sequences as shown in SEQ ID NO:27; (4) Detection FAR1 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:16-17, and probes with nucleotide sequences as shown in SEQ ID NO:18; and (5) Detection FLJ26850 Primers and probes for gene methylation status: primers with nucleotide sequences as shown in SEQ ID NO:19-20, and probes with nucleotide sequences as shown in SEQ ID NO:

21.

2. The reagent composition according to claim 1, characterized in that, The reagent composition further includes primers and probes for detecting an internal standard, the target sequence of which is shown in SEQ ID NO:

6.

3. The reagent composition according to claim 2, characterized in that, The primers and probes for detecting the internal standard include primers with nucleotide sequences as shown in SEQ ID NO:22-23, and probes with nucleotide sequences as shown in SEQ ID NO:

24.

4. The reagent composition according to any one of claims 1-3, characterized in that, The probe is modified with a fluorescent reporter group and / or a fluorescent quencher group.

5. A reagent kit for liver cancer detection, characterized in that, The kit comprises the reagent composition according to any one of claims 1-4.

6. The reagent kit according to claim 5, characterized in that, The kit also includes at least one of an enzyme, a buffer solution, a magnesium source, and deoxyribonucleoside triphosphate.

7. Use of the reagent composition according to any one of claims 1-4 in the preparation of a product for screening liver cancer.

Images