A KASP molecular marker for identifying soybean protein content and its application

Abstract

The application discloses a KASP molecular marker for identifying soybean protein content and an application thereof, relates to the field of biotechnology, and uses of a SNP site. The SNP site takes a soybean Wm82.a2.v1 genome sequence as a reference genome, is the 42148495th SNP on a 9th chromosome of the soybean, corresponds to the 20th base from the 5' end of a sequence shown in SEQ ID NO:1, and is TT homozygosis. When the site is TT homozygosis, the corresponding genotype is A; when the site is AA homozygosis, the corresponding genotype is B. The use is as follows: screening or auxiliary screening of soybeans with different protein contents. The high and low of the soybean protein contents are as follows: the soybean with the genotype A homozygosis is higher than or higher than the soybean with the genotype B homozygosis. The application has important theoretical significance and economic value for using a molecular marker to assist in selecting soybean germplasm or breeding offspring materials with a high protein content.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a KASP molecular marker for identifying soybean protein content and its application. Background Technology

[0002] Soybean (Glycine max (Linn.) Merr.) is an important food and oilseed crop in my country. With socio-economic development and the continuous improvement of people's living standards, my country's soybean consumption is increasing, leading to a severe supply-demand imbalance. Soybean protein is a nutritious and healthy plant protein, one of its main functions being to provide a sufficient number of essential amino acids (nearly 20 kinds). It has high nutritional value and is one of the few plant proteins that can replace animal protein, making it a preferred protein source for humans and livestock. Soybean protein can provide the essential amino acids needed by humans and is cholesterol-free, effectively preventing cardiovascular disease. The vast majority of soybean protein worldwide is processed into soybean meal for livestock feed, especially poultry and pig soybean meal. Studies show that in the United States and the European Union, poultry and livestock industries consume approximately 77% and 68% of the total soybean meal, respectively. Molecular markers for molecular-assisted breeding of soybeans still need further development. Cultivated soybeans undergo selection, resulting in genetic diversity far lower than wild soybeans. By exploring and developing molecular markers related to soybean protein content in wild soybeans and applying them to modern breeding processes, it is of great scientific significance for fully utilizing the excellent genetic information of wild soybeans and thus cultivating high-yield and high-quality new soybean varieties. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a KASP molecular marker for identifying soybean protein content and its application.

[0004] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0005] The purpose of the SNP site is as follows: the SNP site is the 42,148,495th SNP on soybean chromosome 9, with the soybean Wm82.a2.v1 genome sequence as the reference genome. It corresponds to the 20th base from the 5' end of the sequence shown in SEQ ID NO: 1. When this site is homozygous for TT, the corresponding genotype is A; when this site is homozygous for AA, the corresponding genotype is B.

[0006] The purpose is to screen or assist in the screening of soybeans with different protein contents, where the protein content is ranked as follows: soybeans homozygous for genotype A have higher or higher protein content than soybeans homozygous for genotype B.

[0007] A method for screening or assisting in screening different protein contents in soybeans includes the following steps: detecting whether the genotype of the soybean to be tested is TT or AA, wherein the protein content of soybeans with genotype TT is greater than that of soybeans with genotype AA.

[0008] The soybean with genotype TT is the soybean with genotype TT homozygous based on the T20A SNP site;

[0009] The soybean with genotype AA is the soybean with a genotype of AA homozygous based on the T20A SNP site;

[0010] The T20A SNP site is the 42,148,495th SNP on soybean chromosome 9, with the soybean Wm82.a2.v1 genome sequence as the reference genome, corresponding to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0011] More preferably, the step of detecting whether the genotype of the soybean to be tested is TT or AA is as follows:

[0012] (a1) Using the genomic DNA of the soybean to be tested as a template, PCR amplification was performed using primer combinations to obtain PCR amplification products;

[0013] The primer combination consists of the upstream primer 9PC-3-FAM shown in SEQ ID NO: 2, the upstream primer 9PC-3-VIC shown in SEQ ID NO: 3, and the downstream primer 9PC-3-R shown in SEQ ID NO: 4;

[0014] (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected by an instrument. The genotype of the soybean to be tested is obtained according to the color of the fluorescence signal. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 9PC-3-FAM and shows red fluorescence, the soybean sample to be tested is of TT genotype. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 9PC-3-VIC and shows blue fluorescence, the soybean sample to be tested is of AA genotype.

[0015] More preferably, the step of detecting whether the genotype of the soybean to be tested is TT or AA is as follows:

[0016] (b1) Using the genomic DNA of the soybean to be tested as a template, PCR amplification was performed using primer combinations to obtain PCR amplification products;

[0017] The primer combination consists of the upstream primer 9PC-3-FAM shown in SEQ ID NO: 2, the upstream primer 9PC-3-VIC shown in SEQ ID NO: 3, and the downstream primer 9PC-3-R shown in SEQ ID NO: 4;

[0018] (b2) Take the PCR amplification product obtained in step (b1) and sequence it;

[0019] (b3) Based on the sequencing results obtained in step (b2), obtain the genotype of the soybean to be tested.

[0020] A kit for identifying or assisting in the identification of soybean protein content, comprising a primer combination for detecting whether the soybean to be tested has the genotype TT or genotype AA;

[0021] The primer combination consists of the upstream primer 9PC-3-FAM shown in SEQ ID NO: 2, the upstream primer 9PC-3-VIC shown in SEQ ID NO: 3, and the downstream primer 9PC-3-R shown in SEQ ID NO: 4;

[0022] The TT genotype is homozygous for the T20A SNP site.

[0023] The genotype AA is homozygous based on the T20A SNP site;

[0024] The T20A SNP site is the 42,148,495th SNP on soybean chromosome 9, with the soybean Wm82.a2.v1 genome sequence as the reference genome, corresponding to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0025] The molecular marker shown in SEQ ID NO: 1.

[0026] Application of the above-mentioned kits or molecular markers in the identification or auxiliary identification of soybean protein content.

[0027] The application of the above-mentioned kits or molecular markers in screening or assisting screening soybeans with different protein contents.

[0028] Application of the above-mentioned kits or molecular markers in soybean breeding.

[0029] The primer combination is used in the targeted or assisted targeted cultivation of soybean varieties with high protein content. The primer combination consists of the upstream primer 9PC-3-FAM shown in SEQ ID NO: 2, the upstream primer 9PC-3-VIC shown in SEQ ID NO: 3, and the downstream primer 9PC-3-R shown in SEQ ID NO: 4.

[0030] The beneficial effects of adopting the above technical solution are as follows: This invention provides KASP markers for identifying TT and AA allelic variations in genotypes and their correlation with soybean protein content. Applying the KASP markers of this invention to marker-assisted selection of soybean protein content can rapidly and efficiently screen soybean varieties (germplasm) with high protein content, thereby accelerating the breeding process of high-quality new soybean varieties. This invention has significant theoretical and economic value for utilizing marker-assisted selection of soybean germplasm or breeding progeny materials with high protein content. Attached Figure Description

[0031] Figure 1 This is a QTL mapping analysis result diagram of the protein content trait of population number 14020 in Example 1 of the present invention;

[0032] Figure 2 This is a plot of the marker selection efficiency of the normal distribution of protein content in population number 14020 in Example 1 of the present invention;

[0033] Figure 3 This is a graph showing the genotyping and protein content results of the KASP marker for population number 14020 in 2024 in Example 2 of the present invention. Detailed Implementation

[0034] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods.

[0035] It should be understood that, when used in this application specification and the appended claims, the term "comprising" indicates the presence of the described features, integrals, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components and / or a collection thereof.

[0036] It should also be understood that the term “and / or” as used in this application specification and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0037] References to "one embodiment" or "some embodiments" as described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.

[0038] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance.

[0039] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0040] Example 1: Discovery of Soybean Protein Content-Specific SNP Sites

[0041] The soybean material used in this embodiment originated from the following: In 2006, a RIL population was established by hybridization using cultivated soybean Jidou 12 (maternal parent) and wild soybean ZYD02738 (paternal parent). In 2012, Jidou 12 was used as the maternal parent and the RIL population as the paternal parent for backcrossing, resulting in the BC1F1 population in 2013. In 2014, Jidou 12 was used as the maternal parent and the BC1F2 population (a combination of Jidou 12 and ZYD02738) as the paternal parent for backcrossing, resulting in the BC2F1 population in 2015. After four self-pollinations, the BC2F4:5 population, numbered 14020, was obtained, comprising 55 lines. In December 2018, leaves were taken from the BC2F4:5 plants in Sanya, and DNA was extracted by BioMed Corporation. Genotyping was performed on each line to construct a genetic map.

[0042] Based on phenotypic data, QTL mapping was performed on soybean protein content, such as... Figure 1As shown in Table 1, the QTL locus qOil-14020-09, associated with soybean protein content, was located on soybean chromosome 9. Its LOD value was 4.50, explaining 29.30% of the phenotypic variation. The soybean SNP associated with the QTL was labeled CHr09_42148495_T_A. This SNP, with the soybean Williams82 (Wm82.a2.v1) genome sequence as a reference, is the 42,148,495th SNP on soybean chromosome 9, and its nucleotide type is T or A, corresponding to the 20th nucleotide of SEQ ID NO: 1.

[0043] Table 1. QTL mapping results of protein content traits in the 114020 population.

[0044]

[0045] In the population corresponding to the soybean SNP marker CHr09_42148495_T_A, each family had three genotypes: TT, AA, and T / A. Genotype TT was homozygous for T, genotype AA was homozygous for A, and genotype TA was heterozygous for both T and A. The phenotypic values ​​of protein content and the identification results of the genotype and phenotype of CHr09_42148495_T_A for the 55 soybean lines in this example are as follows: Figure 2 As shown in Table 2, the average protein content of AA genotype and TT genotype families was 41.33% and 43.50%, respectively. Compared with the average protein content of AA genotype families, the average protein content of TT genotype families was significantly higher by 5.26% (P < 0.001).

[0046] Table 214020 Soybean Population Molecular Markers and Protein Content Detection Results

[0047]

[0048]

[0049] Example 2: Gene identification of KASP markers in secondary soybean populations

[0050] In practical applications, the genotype of soybeans can be detected using the following method.

[0051] KASP markers were designed targeting the specific CHr09_42148495_T_A site on chromosome 9, and the following primers were designed:

[0052] 9PC-3-FAM: gaaggtgaccaagttcatgctATAGGGGCCTTGGATTTCTT (SEQ ID NO: 2);

[0053] 9PC-3-VIC: gaaggtcggagtcaacggattATAGGGGCCTTGGATTTCTA (SEQ ID NO: 3);

[0054] 9PC-3-R: GTTGCTAAGGTCACTCCCAG (SEQ ID NO: 4);

[0055] Amplification was performed using 5 μL of KASPAssay Mix enzyme: (1.2 μL each of 9PC-3-FAM and 9PC-3-VIC, 3 μL of 9PC-3-R, and 4.6 μL of ddH2O). The reaction system was as shown in Table 3, and the reaction program was: 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 30 s, 10 cycles, with a temperature decrease of 0.6℃ per cycle; 94℃ for 20 s, 55℃ for 1 min, 26 cycles, and a final temperature of 30℃ for 1 min.

[0056] Table 3 PCR reaction system for the test population

[0057]

[0058] Genetic identification was performed on 260 lines from the F3 secondary group derived from population number 14020 using the marker CHr09_42148495_T_A. KASP marker detection revealed that 42 of the 260 Chinese soybean germplasm materials were genetically modified.

[0059] The germplasm with the AA genotype and 81 germplasms with the TT genotype are shown in the following genotyping results. Figure 3 As shown in Table 4.

[0060] Table 4. Results of molecular marker and protein content detection in secondary soybean populations.

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067] Table 5. Statistical analysis of the relationship between CHr09_42148495_T_A allelic variant types and protein content.

[0068]

[0069] The average protein content of AA and TT genotype families was 41.43% and 42.40%, respectively. Compared with the average protein content of AA genotype families, the average protein content of TT genotype families was significantly higher by 2.35% (P < 0.01). This indicates that identifying soybean protein content using the marker CHr09_42148495_T_A is reliable and effective.

[0070] In summary, soybeans with the TT genotype (CHr09_42148495_T_A) exhibit a high protein content trait; soybeans with the AA genotype (CHr09_42148495_T_A) exhibit a low protein content trait; and the protein content of soybeans with the TT genotype (CHr09_42148495_T_A) is higher than that of the tested soybeans with the AA genotype (CHr09_42148495_T_A). Therefore, when selecting soybean varieties with superior protein content, soybeans with the TT genotype at the CHr09_42148495_T_A locus should be selected for breeding and improvement.

[0071] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0072] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0073] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. Use of a SNP site, characterized in that, the SNP site is the 42148495th SNP on chromosome 9 of soybean in the soybean Wm82.a2.v1 genome sequence, corresponding to the 20th nucleotide from the 5' end of the sequence shown in SEQ ID NO: 1, and when the site is TT homozygous, the corresponding genotype is A; when the site is AA homozygous, the corresponding genotype is B; the use is for screening or assisting in screening soybeans with different protein contents, with the different protein contents being: the soybean of genotype A is higher than or candidate higher than the soybean of genotype B.

2. A method of screening or aiding in the screening of soybeans for different protein content, characterized in that, comprising the following steps: detecting whether the genotype of the soybean to be tested is genotype TT or genotype AA, and the protein content of the soybean of genotype TT is > the protein content of the soybean of genotype AA; the soybean of genotype TT is a soybean with genotype TT homozygous based on the T20A SNP site; the soybean of genotype AA is a soybean with genotype AA homozygous based on the T20A SNP site; the T20A SNP site is the 42148495th SNP on chromosome 9 of soybean in the soybean Wm82.a2.v1 genome sequence, corresponding to the 20th nucleotide from the 5' end of the sequence shown in SEQ ID NO:

1.

3. The method of claim 2, wherein, The step of detecting whether the genotype of the soybean to be tested is genotype TT or genotype AA is as follows: (a1) using the genomic DNA of the soybean to be tested as a template, performing PCR amplification with a primer combination to obtain a PCR amplification product; the primer combination consists of the upstream primer 9PC-3-FAM shown in SEQ ID NO: 2, the upstream primer 9PC-3-VIC shown in SEQ ID NO: 3, and the downstream primer 9PC-3-R shown in SEQ ID NO: 4; (a2) after step (a1) is completed, detecting the fluorescence signal of the PCR amplification product with an instrument, and obtaining the genotype of the soybean to be tested according to the color of the fluorescence signal; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 9PC-3-FAM, showing red fluorescence, then the soybean sample to be tested is genotype TT; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 9PC-3-VIC, showing blue fluorescence, then the soybean sample to be tested is genotype AA.

4. The method of claim 2, wherein, The step of detecting whether the genotype of the soybean to be tested is genotype TT or genotype AA is as follows: (b1) using the genomic DNA of the soybean to be tested as a template, performing PCR amplification with a primer combination to obtain a PCR amplification product; the primer combination consists of the upstream primer 9PC-3-FAM shown in SEQ ID NO: 2, the upstream primer 9PC-3-VIC shown in SEQ ID NO: 3, and the downstream primer 9PC-3-R shown in SEQ ID NO: 4; (b2) sequencing the PCR amplification product obtained in step (b1); (b3) obtaining the genotype of the soybean to be tested according to the sequencing result obtained in step (b2).

5. A kit for identifying or aiding in the identification of soybean protein content, characterized in that, The primer combination comprises primers for detecting whether the genotype of the soybean to be tested is genotype TT or genotype AA; The primer combination consists of an upstream primer 9PC-3-FAM shown in SEQ ID NO: 2, an upstream primer 9PC-3-VIC shown in SEQ ID NO: 3, and a downstream primer 9PC-3-R shown in SEQ ID NO: 4; The genotype TT is a genotype TT homozygous based on a T20A SNP site; The genotype AA is a genotype AA homozygous based on a T20A SNP site; The T20A SNP site is a SNP at the 42148495th position on chromosome 9 of soybean with the Wm82.a2.v1 genome of soybean as the reference genome, corresponding to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

6. Use of the kit of claim 5 in identifying or assisting in identifying the protein content of soybean.

7. Use of the kit of claim 5 in screening or assisting in screening soybeans with different protein contents.

8. Use of a primer combination in directed breeding or assisting in directed breeding of soybean lines with high protein content, the primer combination consisting of an upstream primer 9PC-3-FAM shown in SEQ ID NO: 2, an upstream primer 9PC-3-VIC shown in SEQ ID NO: 3, and a downstream primer 9PC-3-R shown in SEQ ID NO: 4.

Images