Absidia parviflora capable of efficiently degrading straws and application of absidia parviflora

Abstract

The invention discloses absidia parviflora capable of efficiently degrading straws and application of the absidia parviflora. The method comprises the following steps: firstly, separating from wheat roots to obtain the Lichtheimia corymbifer DQ-01 with an effect of efficiently degrading straws, wherein the preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) No.40705; the strain has relatively strong salt-resistant and alkali-resistant capabilities and has the characteristic of high yield of cellulase, and after the fermentation liquid preparation of the strain is used for fermenting wheat and corn straws for 12 days, the degradation rates of the wheat and corn straws respectively reach 89.3% and 86.1%.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a strain of Absidia corymbifera capable of efficiently degrading straw and an application thereof. Background Art

[0002] my country is a major agricultural country. It is the world's largest wheat producer and the world's second largest corn producer. A large amount of straw is produced in the production process of crops such as wheat and corn. As a residual by-product of crops, straw has long been treated as agricultural waste and burned, causing serious waste of resources and environmental damage. According to statistics, my country produces about 800 million tons of straw each year. If scientific and technological means are used to transform agricultural straw into resources, it can not only solve the current agricultural production problems, but also bring considerable economic benefits. Nowadays, my country's comprehensive utilization of crop straw resources is mainly based on straw fertilizer and straw feed. However, overall, the comprehensive utilization rate of crop straw in the country is low. How to improve the comprehensive utilization efficiency of straw has become a difficult problem that needs to be solved urgently.

[0003] Currently, straw is mostly returned to the fields in my country. Due to a lack of scientific theoretical guidance, most people return straw directly to the fields by burying it. Direct return can replenish organic matter in the soil, but straw matures slowly in the soil and consumes a large amount of nitrogen during the process, which depletes soil fertility to a certain extent. The hidden dangers of returning straw to the fields are becoming increasingly prominent. To address this, people have begun composting straw, adding composting agents, and then returning it to the fields after composting to form organic fertilizer. However, during the composting process, the cellulose structure in the pile is complex, making it difficult to degrade the cellulose carried by straw, dead branches, and leaves alone. This results in poor composting results and significantly increases composting time. Therefore, it is necessary to add a large number of cellulase-producing bacteria during the composting process to increase the activity of microbial enzymes to degrade straw. This will ensure more thorough degradation of the cellulose in crop straw and enhance the ecological benefits of returning straw to the fields. Therefore, it is necessary to select and cultivate cellulase-producing bacterial strains from ecological environments and apply them in practical production to achieve sustainable agricultural development.

[0004] Currently, screening for efficient cellulose degradation strains has become one of the new approaches for efficient decomposition of crop straw. However, the number of hydrolytic enzymes produced by the currently screened cellulose degradation strains is limited, and the degradation effect is not ideal. Patent CN101665284A discloses a strain of Stenotrophomonas maltophilia ( 嗜麦芽窄食单胞菌) in cellulose-containing wastewater, which can degrade cellulose in livestock and poultry breeding wastewater. In addition, patent CN101974436A found that Penicillium expansum W4 can degrade lignocellulose, thereby improving the quality of mushroom cultivation medium. Although fungal resources are abundant, there are currently very few fungi that can be actually applied to farmland and degrade straw. 科里姆比费拉被孢霉 ) is a new strain with relatively little functional research, which has potential development value and important practical significance for the effective utilization of crop straw. Summary of the Invention

[0005] To solve the above problems, the present invention isolated and screened a strain of Absidia corymbifera ( 科里姆比费拉被孢霉 ) DQ-01, a strain with strong salt and alkali tolerance and high cellulase production. This study used Absidia corymbifera DQ-01 to prepare a fermentation liquid formulation, which was successfully applied to corn and wheat straw degradation. This not only improved straw degradation efficiency but also enriched the resource base for degradation strains, demonstrating broad application prospects.

[0006] The above-mentioned object of the present invention is achieved by the following technical solutions: the present invention first isolates Absidia corymbosa ( 被孢霉属 科里姆比费拉 ) DQ-01, which was deposited with the General Microbiology Center of the China General Culture Collection (CGMCC) on June 20, 2023, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, under the accession number CGMCC No. 40705. After two days of growth on beef extract peptone agar, this strain produces round colonies with lush, long, and thick white hyphae. The colonies gradually change from white to a slightly off-white hue, with a slight yellowish tint on the back.

[0007] The present invention also provides a kind of Absidia corymbifera ( 科里姆比费拉被孢霉 ) Fermented liquid preparation of DQ-01.

[0008] The preparation method of the above-mentioned Absidia corymbifera DQ-01 fermentation liquid preparation comprises the following steps: (1) Seed solution acquisition: First, activate Absidia corymbifera DQ-01, inoculate it into PDB medium, and culture it at a constant temperature of 28-32°C with shaking for 48-72 hours to obtain seed solution; (2) Large-scale fermentation: The seed liquid is inoculated into the fermentation medium at a rate of 1-3%, and the fermentation culture is carried out at 28-32°C for 60-90 hours to obtain the fermentation liquid preparation of Absidia corymbifera DQ-01.

[0009] The seed liquid culture medium (PDB medium) has the following formula: 200g potatoes, 15g glucose (or sucrose), 1000mL water, and a natural pH. The fermentation medium is the same as the seed liquid culture medium.

[0010] The present invention also provides Absidia corymbifera ( 科里姆比费拉被孢霉 ) Application of DQ-01 or its fermentation liquid preparation in straw degradation.

[0011] Compared with the prior art, the advantages of the present invention are: 1. The present invention is isolated from wheat roots and screened with Congo red medium and filter paper strip medium to obtain Absidia corymbosa with high efficiency in degrading straw. 科里姆比费拉被孢霉 The present invention discovered for the first time that Absidia corymbosa can efficiently degrade straw, enriching the types of microorganisms used for straw degradation.

[0012] 2. The present invention has found through experiments that strain DQ-01 can grow under alkaline conditions with a sodium chloride concentration of 10% and / or a pH of 10, indicating that strain DQ-01 has strong salt and alkali resistance.

[0013] 3. Experiments conducted by the present invention revealed that the carboxymethyl cellulase, filter paper enzyme, and β-glucosidase activities produced by strain DQ-01 reached their maximum values ​​on the third day, at 14.97 U / mL, 9.57 U / mL, and 12.57 U / mL, respectively. The exo-β-glucanase activity reached its maximum value on the second day, at 11.50 U / mL. These results demonstrate that strain DQ-01 is a high-producing cellulase enzyme.

[0014] 4. Absidia corymbifera 科里姆比费拉被孢霉 DQ-01 fermentation liquid formulation is easy to prepare and has high degradation efficiency. After 12 days of fermentation, the fermentation liquid formulation achieved degradation rates of 89.3% for wheat and 86.1% for corn straw, respectively. This strain demonstrates broad application prospects in straw degradation. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Absidia corymbifera 科里姆比费拉被孢霉 ) DQ-01 colony morphology; Figure 2 is the glucose standard curve; Figure 3 Absidia corymbifera 科里姆比费拉被孢霉 ) DQ-01 cellulase activity assay results. DETAILED DESCRIPTION

[0016] To clearly illustrate the technical features of the present invention, the present invention is described below with reference to specific embodiments and accompanying drawings. However, the scope of protection of the present invention is not limited to these embodiments. Any modifications or equivalent substitutions that do not depart from the spirit of the present invention are included within the scope of protection of the present invention.

[0017] Example 1: Isolation and purification of fungus DQ-01 The fungus DQ-01 involved in the present invention was isolated and obtained in the laboratory of Jinzhou Hanzhuang Junong Modern Agriculture Technology Co., Ltd. in June 2022; the isolation source was wheat roots (from the wheat fields in Diao Town, Zhangqiu District, Jinan City); the isolation method adopted the dilution coating method.

[0018] The culture medium used for separation and purification is as follows: Rose Bengal agar medium: peptone 5 g, glucose 10 g, potassium dihydrogen phosphate 1 g, anhydrous magnesium sulfate 0.5 g, rose Bengal 0.033 g, chloramphenicol 0.1 g, agar 20 g, water 1000 mL, pH 7.2±0.2.

[0019] PDA medium: potato extract powder 5 g / L, glucose 20 g / L, agar 15 g / L, pH 7.0±0.1.

[0020] Wheat roots were collected from the wheat fields in Diao Town, Zhangqiu District, Jinan City by random sampling method, temporarily stored in foam boxes containing ice packs, and then transported back to the laboratory for isolation of related fungi.

[0021] The specific separation and purification methods are as follows: (1) Preparation of sample suspension: Accurately weigh 10 g of the sample, grind it thoroughly in a sterile mortar, and place it in a 250 mL Erlenmeyer flask containing an appropriate amount of glass beads and Tween 80 containing 90 mL of sterile water. Oscillate at a constant temperature of 30°C and 150 rpm for about 30 min to fully disperse the microorganisms and make the bacteria evenly free in the sterile water to prepare a sample suspension.

[0022] (2) Dilution coating: Use the 10-fold dilution method to dilute the sample suspension into 10 -1 ~10 -6 Dilution of bacterial suspension; respectively from 10 -4 , 10 -5 and 10 -6 100 μL of each diluted bacterial sample was taken and spread on a plate containing Bengal red agar medium, and three plates were spread for each gradient.

[0023] (3) Cultivation: Seal the coated plate and place it in a 30°C incubator for 2 to 3 days. Observe the growth of the colonies on the plate regularly.

[0024] (4) Purification: According to the different colony morphologies on the plate, use an inoculation hook to pick single bacteria for purification culture, and invert the culture at a constant temperature of 30°C until a single colony grows on the plate; the purification culture medium is PDA medium.

[0025] (5) Storage: Inoculate the purified single colony into a PDA culture medium test tube, culture at 30°C for 2-3 days, and then store in a refrigerator at 4°C for future use.

[0026] According to the above method, a total of 15 fungal strains with different colony morphologies were isolated and numbered DQ-01 to DQ-15.

[0027] Example 2: Screening of fungus DQ-01 capable of degrading cellulose 1. Initial screening Screening medium (Congo red medium): (NH4)2SO4 2.0 g, MgSO4·7H2O 0.5 g, K2HPO4 1.0 g, NaCl 0.5 g, CMC-Na 2.0 g, Congo red 0.2 g, agar 20.0 g, distilled water 1000 mL, natural pH, autoclave at 121°C and set aside.

[0028] The 15 fungal strains isolated in Example 1 were activated on PDA culture medium and cultured at 30°C for 48 h. A 5 mm cake of the activated strains was punched out with a hole punch and inoculated in the center of a plate containing screening culture medium. The culture was then cultured at 30°C for 48 h. The formation of hydrolysis zones in each culture dish was observed, and the diameter of the hydrolysis zone (D) and colony diameter (d) were measured. The ratio (D / d), i.e., the HC value, of each strain was calculated.

[0029] The results showed that among the 15 bacterial strains tested, only transparent circles appeared on the screening culture medium inoculated with DQ-01, DQ-02, DQ-08, DQ-10 and DQ-11, preliminarily indicating that the above five bacterial strains have the function of degrading cellulose; further comparison of the HC values ​​of the five bacterial strains found that the HC value of DQ-01 was significantly higher than that of other strains, preliminarily indicating that strain DQ-01 has better ability to degrade cellulose than other strains.

[0030] Table 1 Statistical results of HC values ​​of cellulose-degrading strains

[0031] 2. Rescreening PDB medium: potato extract powder 5 g / L, glucose 20 g / L, pH 7.0 ± 0.1.

[0032] Filter paper strip culture medium: (NH₄)₂SO₄ 1.0 g, MgSO₄·7H₂O 0.5 g, KH₂PO₄ 1.0 g, yeast extract 0.1 g, distilled water 1000 mL, starch-free filter paper (1 cm × 6 cm). The starch-free filter paper was prepared by soaking the filter paper in 1% (w / v) acetic acid solution for 24 h to remove starch. The paper was then tested with iodine solution to confirm the absence of starch, then washed with 2% sodium bicarbonate solution until neutral, dried naturally, and cut into 1 cm × 6 cm sections for later use.

[0033] The five strains obtained in the initial screening were activated on PDA medium and cultured at 30°C for 48 h. A 5 mm cake of the activated strains was punched out with a hole punch and inoculated into PDB medium. The seed liquid of each strain was obtained by constant temperature shaking culture at 30°C and 150 r / min for 36 h. The inoculum was inoculated into 100 mL of filter paper strip culture medium (6 1 cm × 6 cm filter paper strips were placed) at a 20% inoculum volume, and the filter paper disintegration was observed at 2, 4, 6, and 8 days.

[0034] The results showed that strain DQ-01 began to degrade cellulose two days after inoculation, with the edges of the paper strips beginning to bend. By eight days after inoculation, the filter paper strips had become mushy. The effects of the other strains lagged significantly behind. This suggests that strain DQ-01 significantly outperformed the other four strains in its ability to degrade cellulose, consistent with the results in Experimental Example 1. Therefore, we selected strain DQ-01 as the subject for further study.

[0035] Table 2 Degradation effect of different strains on filter paper strips

[0036] Note: (-) means no obvious change; (+) means the edge of the paper strip; (++) means the paper strip is bent as a whole; (+++) means the paper strip is incomplete and short; (++++) means it is in a mushy state.

[0037] Example 3: Identification of strain DQ-01 1. Microbiological identification The strain DQ-01 was inoculated on a PDA plate and cultured at a constant temperature of 30°C. The characteristics of the colonies were observed after 48 hours. The results showed that the average mycelial growth rate of the strain on the PDA plate was 29.4 mm / day; the colonies were round, with lush, long, and thick white mycelium. The colonies gradually changed from white to slightly grayish white, with a slight yellow on the back (refer to Figure 1 ).

[0038] 2. Molecular Biology Identification Strain DQ-01 was activated on a PDA culture medium plate, and a bacterial cake was taken and inoculated into the center of a PDA plate containing cellophane. After the mycelium was fully grown, the upper mycelium was collected and the DNA of strain DQ-01 was extracted using a fungal DNA kit and amplified. The amplification primers and amplification conditions were as follows.

[0039] ITS primers: ITS1 (5′-TCCGTAGGTAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTAT-TGATATGC-3′).

[0040] PCR reaction system (50 μL): 2× PCR Mix 25 μL, 20 mol / L ITS1 / ITS4 primers 2.5 μL each, template DNA 2 μL, ddH2O 18 μL.

[0041] Amplification conditions: 94°C, 5 min; 94°C, 30 s; 53°C, 30 s; 72°C, 60 s; 35 cycles in total; 72°C, 10 min; storage at 4°C; and the amplified product was obtained.

[0042] The amplified product was sent to Shandong Senqi Biotechnology Co., Ltd. for determination. The results showed that the full length of the detected gene sequence was 366 bp; BLAST similarity comparison was performed on GenBank and it was found that the gene sequence was similar to 科里姆比费拉被孢霉 The rDNA sequence of MT316349.1 has a base similarity of 99.19%. The strain DQ-01 was identified as Pseudomonas aeruginosa by comprehensive microbiological characteristics and ITS sequence analysis. 科里姆比费拉被孢霉 ); The strain was deposited in the General Microbiology Center of China Culture Collection of Microorganisms (CGMCC) on June 20, 2023. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No.40705.

[0043] The rDNA sequence of the ITS region of strain DQ-01 is as follows (SEQ No. 1): GGTTACTTGGATTTCTCCAAGTAGTGTCCCATAGATAGAAAAGCTAGTTCATTAAAAGACTTAATGCTTGGAATTGAACTCACTAACCAAGCTTGCTCTTAAAGCGCTCTAAAGTTTCCATCCGGTGTTAGATGTTCTAACACCTAGGACATTGATTTAAGGCCATGACAGCAACTAAATG CCATCAACTAGAAGCCCAGTTCCAACTCAACACAAAAGGTTAAGTTGATTGGTGGATGCAGATACTGAAACAACTGTGCCTAGTAGTTGACTACTAGGCGCAAGATGCGTTCAAGAACTCGATGATTCACTATGAATGCAAGCGCAATAATTATCGCACTTTGCTACGCTCTTCTCGATGCGA.

[0044] Example 4: Test on high-yield cellulase activity of DQ-01 The cellulase activity in the enzymatic hydrolysate of strain DQ-01 was indirectly determined by 3,5-dinitrosalicylic acid colorimetry (DNS).

[0045] Liquid enzyme production culture medium: sodium carboxymethyl cellulose 20.0 g / L, ammonium sulfate 2.0 g / L, potassium dihydrogen phosphate 2.0 g / L, ferrous sulfate heptahydrate 0.01 g / L, calcium chloride 0.1 g / L, sodium chloride 5.0 g / L.

[0046] The specific method is as follows: (1) Preparation of crude enzyme solution The strain DQ-01 was activated on PDA medium and cultured at 30°C for 48 h. A 5 mm cake of the activated strain was punched out with a hole punch and inoculated into 100 mL of liquid enzyme-producing medium. The culture was shaken at 30°C and 150 rpm for 72 h to obtain a fermentation broth. The obtained fermentation broth was centrifuged at 4°C and 6000 rpm for 10 min. The supernatant was the crude enzyme solution, which was used to determine the enzyme activity.

[0047] (2) Preparation of standard curve Take 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mL of 1g / L glucose standard solution in 25 mL test tubes, accurately add 1.5 mL of DNS reagent to the test tube, and fully react in a boiling water bath for 5 minutes. After the reaction is complete, cool to room temperature and add distilled water to adjust the volume to 20 mL, shake well, and measure the absorbance at a wavelength of 540 nm. Draw a standard curve with glucose content as the horizontal axis and absorbance as the vertical axis (refer toFigure 2 ).

[0048] The standard curve is: y = 0.9197x - 0.1345 (R 2 =0.9986).

[0049] (3) Cellulase activity assay ① Carboxymethyl cellulase activity assay Transfer 0.5 mL of crude enzyme solution to a test tube, add 1 mL of 1% CMC-Na solution and 0.5 mL of 0.1 mol / mL phosphate buffer (pH 6.0), respectively, and mix thoroughly. After fully reacting in a 50°C water bath for 30 min, remove the solution and add 1.5 mL of DNS reagent. Terminate the reaction by boiling in a water bath for 5 min and cool to room temperature. Use the crude enzyme solution inactivated by boiling in a water bath for 10 min as the blank control group, measure the amount of reducing sugar at 540 nm, and calculate the enzyme activity.

[0050] ② Filter paper enzyme activity assay Take a 1cm×2cm filter paper strip as the substrate, add 1.5mL of 0.1mol / mL phosphate buffer (pH 6.0) and 0.5mL of crude enzyme solution, react in a 50℃ water bath for 60min, then remove and add 1.5mL of DNS reagent; the remaining operations are the same as treatment method ①, and the OD value is measured at 540nm.

[0051] ③β-glucosidase activity assay Accurately weigh 1.5 mL of 1% salicin solution into a clean test tube, add 0.5 mL of crude enzyme solution, and the remaining operations are the same as treatment method ①.

[0052] ④ Exo-β-glucanase activity assay Add 1% microcrystalline cellulose substrate solution and 0.5 mL of 0.1 mol / mL phosphate buffer (pH 6.0) to the test tube, then add 0.5 mL of crude enzyme solution. React in a 50°C water bath for 30 min, then remove and add 1.5 mL of DNS reagent. The remaining steps are the same as in step ①.

[0053] One unit of enzyme activity is defined as the amount of glucose generated per minute, equivalent to 1 μg. The enzyme activity formula is as follows.

[0054] Enzyme activity X = 1000 × G / (V × T) Where X is the enzyme activity of the sample (U / mL); G is the number of milligrams of glucose corresponding to the absorbance value on the standard curve; V is the amount of enzyme added (mL); and T is the action time (min).

[0055] The results are as follows Figure 3As shown in the results, analysis revealed that the carboxymethyl cellulase, filter paper enzyme, and β-glucosidase activities produced by strain DQ-01 reached their maximum values ​​on the third day, at 14.97 U / mL, 9.57 U / mL, and 12.57 U / mL, respectively. The exo-β-glucanase activity reached its maximum value on the second day, at 11.50 U / mL. These results indicate that strain DQ-01 is a high-producing cellulase enzyme.

[0056] Example 5: Heat and salt-alkali resistance test of DQ-01 NaCl was added to PDA culture medium at 2%, 4%, 6%, 8%, 10%, and 12% to prepare plates with different NaCl contents. Activated strain DQ-01 cakes (5 mm) were inoculated on PDA plates with different NaCl contents and cultured at 30°C for 7 days. The growth of the colonies was observed.

[0057] PDA culture medium with pH values ​​of 8, 9, 10, and 11 was prepared using 40% NaOH solution. Activated strain DQ-01 was punched into 5 mm cakes and inoculated onto PDA plates with different pH values. The plates were cultured at 30°C for 7 days and the growth of the colonies was observed.

[0058] The results showed that strain DQ-01 could grow under conditions of sodium chloride concentration of 10% and pH=10, indicating that strain DQ-01 has strong salt and alkali resistance.

[0059] Table 3 Statistics of salt and alkali resistance of strain DQ-01

[0060] Note: “+” represents growth, “–” represents no growth Example 6: Preparation of liquid formulation of DQ-01 (1) Strain DQ-01 was inoculated onto a PDA plate for activation and cultured at 30°C for 48 h; (2) Use a punch to punch the bacterial cake at the edge of the activated strain, inoculate it into the seed liquid culture medium, and culture it in a shake flask at 30°C and 150 rpm for 72 h to obtain the seed liquid of DQ-01; (3) The seed liquid prepared in step (2) was inoculated into the fermentation medium at an inoculation mass ratio of 1:50. The fermentation conditions were the same as those in step (2) to obtain the fermentation liquid of strain DQ-01. The fermentation liquid is the liquid preparation of strain DQ-01, and the effective viable count is >1×10 9 CFU•mL -1 .

[0061] The seed liquid culture medium is PDB medium: 200 g potatoes, 15 g glucose (or sucrose), 1000 mL water, natural pH. Aliquot and sterilize at 121°C for 25 min.

[0062] The fermentation medium is the same as the seed culture medium.

[0063] Example 7: Experiment on degradation of crop straw by DQ-01 Wheat and corn straw were soaked in sterile distilled water for 24 hours, dried, and chopped into small pieces. Accurately weigh 5 g of straw segments and place them in a conical flask. 0.2 g of ammonium sulfate, 0.05 g of MgSO₄·7H₂O, and 15 mL of PBS buffer (5 mmol / L) were added. 3 mL of DQ-01 liquid preparation was pipetted into the conical flask and incubated at 14°C. The degradation of the straw was regularly observed and the degradation rate was calculated. A blank control (CK) was used, along with a sample without inoculation. Each treatment was replicated three times.

[0064] Degradation rate (D) = (M0-M1) / M0×100% Where, M0: mass of straw before fermentation / g; M1: mass of undegraded straw / g.

[0065] Observations revealed that hyphae began to appear on the wheat and corn straws two days after inoculation in the experimental groups. By the third day, the straws were completely covered with hyphae, with degradation rates reaching 15.3% and 12.1%, respectively. By the sixth day, the experimental groups had softened and rotted, with degradation rates of 35.5% and 27.8%, respectively. After 12 days, the degradation reached a steady state, with straw degradation rates of 89.3% and 86.1%, respectively. These results further demonstrate that strain DQ-01 has a strong straw-degrading ability.

[0066] Table 4 Straw degradation results

Claims

1. A plant of Pleurotus arborescens ( Lichtheimia corymbifera ) DQ-01, the deposit number of the strain is CGMCC No.40705.

2. The Absidia corymbifera strain DQ-01 according to claim 1, characterized in that The strain has strong salt and alkali resistance and can grow under alkaline conditions with a sodium chloride concentration of 10% and / or a pH of 10.

3. The Absidia corymbifera strain DQ-01 according to claim 1, characterized in that It has the ability to produce high amounts of cellulase.

4. The Absidia corymbifera strain DQ-01 according to claim 3, characterized in that The cellulase is at least one of carboxymethyl cellulase, filter paper enzyme, β-glucosidase or exo-β-glucanase.

5. The Absidia coriacea according to claim 1 ( Lichtheimia corymbifera ) Fermented liquid preparation of DQ-01.

6. The method for preparing the fermentation liquid preparation of Absidia corymbifera DQ-01 according to claim 5, characterized in that: The following steps are involved: (1) Seed solution acquisition: First, activate the Absidia corymbifera strain DQ-01, inoculate it into PDB medium, and culture it at a constant temperature of 28-32°C with shaking for 48-72 hours to obtain seed solution; (2) Large-scale fermentation: The seed liquid is inoculated into the fermentation medium at a rate of 1-3%, and the fermentation culture is carried out at 28-32°C for 60-90 hours to obtain a fermentation liquid preparation of Absidia corymbifera DQ-01; the fermentation medium is PDB medium.

7. Use of the Absidia corymbifera strain DQ-01 according to claim 1 or its fermentation liquid preparation according to claim 5 in degrading straw.

Images