Application of Japonica Rice OsLEC1 Gene Fragment in Improving Callus Formation Ability in Indica Rice
By introducing the japonica rice OsLEC1 gene fragment, constructing a recombinant expression vector and performing Agrobacterium-mediated genetic transformation, the problem of weak callus formation ability of indica rice was solved, and efficient genetic transformation and accelerated breeding process were achieved.
Patent Information
- Application Number
- CN202511093684.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-06
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-08-06
AI Technical Summary
Indica rice has weak callus formation ability, resulting in low genetic transformation efficiency. The hormone combination optimization in existing technologies is complex and the expression is not time-space specific, making it difficult to apply on a large scale.
The japonica rice OsLEC1 gene fragment, including the OsLEC1 promoter, gene region and downstream sequence, was introduced to construct a recombinant expression vector, and the callus formation ability of indica rice was improved through Agrobacterium-mediated genetic transformation.
It significantly improves the efficiency of indica rice callus formation, breaks through the bottleneck of genetic transformation, shortens the breeding cycle, reduces labor costs, and provides an efficient genetic transformation system.
Smart Images

Figure CN120574886B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to application of a japonica rice OsLEC1 gene fragment in improving the callus formation ability of indica rice. Background Art
[0002] Indica rice (Oryza sativa L. subsp. indica), a global staple crop, has long been hampered by its significantly weaker callus formation ability compared to japonica rice. Mainstream indica rice varieties (such as 9311) exhibit low callus induction rates from mature embryos, and the callus tends to brown and become loose, resulting in low regeneration rates. This forces breeding efforts to rely on high concentrations of exogenous hormones (such as 2,4-D), increasing reagent costs by 50% and causing phenotypic variation.
[0003] Existing technical means to enhance the wound healing ability of indica rice have significant defects: hormone combination optimization requires repeated variety-specific adjustments, and excessive hormones can inhibit regeneration; overexpression of key genes often uses constitutive promoters (such as CaMV 35S) to drive cDNA, resulting in non-spatiotemporal specific expression and interfering with normal development; epigenetic regulation operations are complex and have a high risk of off-target, making them difficult to apply on a large scale.
[0004] Notably, OsLEC1 (LEAFY COTYLEDON 1), a key factor in embryonic development, plays a central role in regulating somatic embryogenesis: it promotes meristematic cell proliferation by activating callus embryogenicization pathways (e.g., upregulating WOX11 and BBM genes). However, existing technologies have focused solely on heterologous expression of OsLEC1 cDNA, neglecting the adaptability of native regulatory elements (e.g., promoter-enhancer interactions) to the indica rice genetic background. Furthermore, the application of OsLEC1 genomic fragments containing intact native regulatory regions in indica rice remains a challenge. Summary of the Invention
[0005] The present invention provides an application of a japonica rice OsLEC1 gene fragment in improving the callus formation ability of indica rice. The nucleotide sequence of the OsLEC1 gene fragment is shown in SEQ ID NO. 1 or 2.
[0006] The present invention also provides the use of a recombinant expression vector containing the japonica rice OsLEC1 gene fragment in improving the callus formation ability of indica rice.
[0007] In one embodiment of the present invention, the starting vector for constructing the recombinant expression vector is a pRI101-ON vector or a pCAMBIA1300 vector.
[0008] In one embodiment of the present invention, the indica rice is 9311.
[0009] The present invention also provides a method for improving the callus formation ability of indica rice, comprising the following steps:
[0010] The recombinant expression vector is introduced into Agrobacterium competent cells, and then the indica rice callus is immersed in the Agrobacterium suspension.
[0011] In one embodiment of the present invention, the Agrobacterium is EHA105.
[0012] In one embodiment of the present invention, the indica rice is 9311.
[0013] In one embodiment of the present invention, the callus formation ability of indica rice is enhanced by overexpressing the japonica rice OsLEC1 gene fragment.
[0014] Compared with the prior art, the present invention has the following beneficial effects:
[0015] (1) The present invention significantly improves the efficiency of indica rice callus formation
[0016] The present invention improves the callus induction rate of mature embryo-induced indica rice by introducing an OsLEC1 gene fragment (mainly comprising an OsLEC1 promoter, a gene region, and a sequence downstream of the gene region, with a total length of 6000 bp and 8000 bp) into japonica rice.
[0017] This advantage is directly derived from the introduction of japonica rice OsLEC1 gene fragments. As a key regulatory factor for embryonic development, the OsLEC1 gene can activate the embryonic callus-related pathways in indica rice and make up for the natural regeneration ability defects of indica rice.
[0018] (2) This invention breaks through the bottleneck of genetic transformation of indica rice
[0019] The improvement in callus formation capacity has partially solved the industry problem of low genetic conversion rate of indica rice, providing an efficient receptor system for CRISPR editing, transgenic breeding, etc., and improving the conversion success rate.
[0020] (3) This invention shortens the breeding cycle and reduces labor costs
[0021] Efficient callus induction reduces the number of repeated experiments, shortens the period for obtaining usable callus tissue in a single experiment, and significantly accelerates the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1Figure 1 is a diagram of the vector construction structure in Example 1, where A is a schematic diagram of the gene structure of OsLEC1; B is a schematic diagram of the construction of the pOsLEC1:OsLEC1 (6000) vector, and 6000-F1 / F2 / F3 / F4 and 6000-R1 / R2 / R3 / R4 are the vector construction primers; C is a schematic diagram of the construction of the pOsLEC1:OsLEC1 (8000) vector, and 8000-F1 / F2 / F3 and 8000-R1 / R2 / R3 are the vector construction primers.
[0023] Figure 2 Figure 2 shows the callus phenotypes of indica rice after the japonica OsLEC1 gene was transferred from the japonica rice gene. A and B show the phenotypic characteristics of callus induced from the scutellum of T2 transgenic seeds. Scale bar: 10 mm. C shows the fresh weight of callus induced from the scutellum of T2 transgenic seeds. Data are presented as the means of three biological replicates, with error bars representing standard errors. *, *, *, and * represent p < 0.05, 0.01 < p < 0.05, and p < 0.01, respectively. DETAILED DESCRIPTION
[0024] Example 1
[0025] 1. Cloning of OsLEC1 genomic fragment and vector construction
[0026] 1.1 Sources:
[0027] Japonica rice variety: Nipponbare (Oryza sativa L. ssp. japonica 'Nipponbare')
[0028] Target gene: OsLEC1 (LOC_Os02g49370)
[0029] 1.2 Fragment amplification:
[0030] The fragment mainly includes pOsLEC1:OsLEC1(6000) and pOsLEC1:OsLEC1(8000). The pOsLEC1:OsLEC1(6000) sequence contains a promoter region 3.5 kb upstream of the start codon (ATG) and a regulatory sequence 1.5 kb downstream of the stop codon. The pOsLEC1:OsLEC1(8000) sequence contains a promoter region 4.1 kb upstream of the start codon (ATG) and a regulatory sequence 2.3 kb downstream of the stop codon.
[0031] 1.2.1 pOsLEC1:OsLEC1(6000) and pOsLEC1:OsLEC1(6000) sequence cloning:
[0032] pOsLEC1: OsLEC1 (6000) fragment is located on chromosome 2 of the rice genome (gene sequence SEQ ID NO.1 is as follows):
[0033]
[0034] pOsLEC1:OsLEC1 (8000) fragment sequence SEQ ID NO. 2 is as follows:
[0035]
[0036] PCR was performed to amplify four fragments of pOsLEC1:OsLEC1(6000) and three fragments of pOsLEC1:OsLEC1(8000). The primer sequences are as follows:
[0037] Table 1 Primers for pOsLEC1:OsLEC1(6000)
[0038]
[0039] Table 2 Primers for pOsLEC1:OsLEC1(8000)
[0040]
[0041] The cloning process of pOsLEC1:OsLEC1(6000) gene fragment and pOsLEC1:OsLEC1(6000) gene fragment is as follows:
[0042] Using japonica rice genomic DNA, clones 6000-1, 6000-2, 6000-3, and 6000-4; and 8000-1, 8000-2, and 8000-3 were cloned separately. Using overlapping PCR, clones 6000-1, 6000-2, 6000-3, and 6000-4 were linked together, and similarly, clones 8000-1, 8000-2, and 8000-3 were linked together. (Overlapping PCR utilizes primer design and the extension ability of DNA polymerase in PCR to join two or more DNA fragments with partially overlapping sequences.) The linked fragments were ligated into the pCAMBIA1300 vector and sequenced to confirm the correct vector.
[0043] The specific operations and systems are as follows:
[0044] Table 3 Four fragment cloning PCR system
[0045]
[0046] Table 4 PCR program for cloning four fragments
[0047]
[0048] After the PCR reaction, take 5 μL of the product, detect it by 1% agarose gel electrophoresis, and then purify and recover the target fragment using the Easy Gel Extraction & Clean-up Kit, and determine the product concentration.
[0049] Based on the product concentrations determined in the previous step, fragments 6000-1, 6000-2, 6000-3, and 6000-4 of pOsLEC1:OsLEC1(6000) were ligated using DNA polymerase via PCR to obtain fragment 6000. Similarly, fragments 8000-1, 8000-2, and 8000-3 of pOsLEC1:OsLEC1(8000) were ligated to obtain fragment 8000. The ligation system is as follows:
[0050] Table 5 Connection system
[0051]
[0052] Table 6
[0053]
[0054] Table 7 Fragment ligation PCR program
[0055]
[0056] Vector digestion:
[0057] At the same time, the empty vector pCAMBIA1300 was double-digested with XBAI and KPNI. The enzyme digestion system was 50 μL, including 5 μL of substrate, 5 μL of XBAI and KPNI enzymes, and 10 μL of buffer (cutsmart); the substrate was the empty vector pCAMBIA1300, the enzyme digestion time was 4 h, and the reaction temperature was 37°C; the enzyme digestion products were detected using 1% agarose gel, and the target products were recovered and the concentration was determined.
[0058] Table 8
[0059]
[0060] Add all components on ice, mix thoroughly, and centrifuge briefly to collect the solution at the bottom of the tube. Allow to ligate for 2 hours at room temperature.
[0061] After the ligation reaction, the 6000 fragment and the 8000 fragment obtained above were respectively connected to the pCAMBIA1300 vector after enzyme digestion. Both ends of the 6000 and 8000 fragments had homology arms of XBAI and KPNI enzymes.
[0062] Figure 1Figure 1A is a schematic diagram of the gene structure of OsLEC1; Figure 1B is a schematic diagram of the construction of the pOsLEC1:OsLEC1 (6000) vector, and 6000-F1 / F2 / F3 / F4 and 6000-R1 / R2 / R3 / R4 are the vector construction primers; Figure 1C is a schematic diagram of the construction of the pOsLEC1:OsLEC1 (8000) vector, and 8000-F1 / F2 / F3 and 8000-R1 / R2 / R3 are the vector construction primers.
[0063] 1.4 Connection system:
[0064] Homology arms have been added to the primers during cloning, eliminating the need for enzyme digestion. The product can be directly ligated to the target vector pCAMBIA1300. The ligation system is as follows:
[0065] Table 9
[0066]
[0067] Add all components on ice, mix thoroughly, and centrifuge briefly to collect the solution at the bottom of the tube. Allow to ligate for 2 hours at room temperature.
[0068] 1.5 E. coli transformation and verification:
[0069] The ligation product was transformed into E. coli DH5α competent cells, plated on LB plates containing 50 mg / L kanamycin, and incubated at 37°C for 16 h. A single colony was picked and shaken to extract the plasmid. The correctness of the insert was verified by Sanger sequencing.
[0070] Example 2 Agrobacterium-mediated genetic transformation of indica rice
[0071] 1. Agrobacterium Preparation:
[0072] The recombinant plasmids verified to be correct in Example 1: pOsLEC1:OsLEC1(6000) / pOsLEC1:OsLEC1(8000) were electrotransformed into Agrobacterium tumefaciens EHA105 competent cells.
[0073] Spread on YEP plates containing rifampicin (50 mg / L) and kanamycin (50 mg / L) and culture at 28°C for 48 h.
[0074] Recipient material: Indica rice variety 9311.
[0075] Table 10
[0076]
[0077] Mature embryos of wild-type 9311 were used as materials to induce callus tissue, which was infected and transformed with Agrobacterium EHA105. After hygromycin resistance screening, transgenic plants were obtained by differentiation and regeneration of resistant callus tissue.
[0078] 2. Screening of transgenic plants and identification of positive seedlings
[0079] Genomic DNA from transgenic plants was extracted from leaves and initially screened by PCR using OsLEC1-specific primers (spanning the vector-insert junction). Both pOsLEC1:OsLEC1(6000) and pOsLEC1:OsLEC1(8000) can be detected using these primers. The primer sequences are as follows:
[0080] PLL-F: GTTGGTCAAGTCCTGGTCGT (SEQ ID NO. 17);
[0081] PLL-R: GCTGTTGCTACAGTAACATTGC (SEQ ID NO. 18).
[0082] 3. Evaluation of callus formation ability
[0083] Material Handling:
[0084] T1 generation positive seeds and wild type 9311 control seeds were oven-dried at 37°C for 72 h, shelled, and disinfected with 75% ethanol for 3 min and then 30% NaClO for 15 min, and then washed five times with purified water.
[0085] Callus induction and weighing:
[0086] The seeds were inoculated into CIM medium (composition as follows) and cultured at 26°C in the light for 3 weeks.
[0087] Table 11
[0088]
[0089] The fresh callus tissue was peeled off and the fresh weight of the callus produced by a single seed was weighed using an electronic balance (accuracy 0.0001 g).
[0090] 4. Data Analysis:
[0091] The mean and standard deviation of callus fresh weight of transgenic lines (6kbp / 8kbp) and wild type were calculated, and the significant differences were confirmed by t-test (*p*<0.01).
[0092] 5. Result evaluation: If the fresh weight of callus of transgenic strains is greater than the mean of wild type + 3×SEM and *p* < 0.01, it is considered to be significantly improved. Figure 2 shown.
[0093] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. Application of a japonica rice OsLEC1 gene fragment in improving the callus formation ability of indica rice, characterized in that: The nucleotide sequence of the OsLEC1 gene fragment is shown in SEQ ID NO. 1; the callus formation ability of indica rice is enhanced by overexpressing the japonica rice OsLEC1 gene fragment.
2. Use of a recombinant expression vector containing the japonica rice OsLEC1 gene fragment according to claim 1 in improving the callus formation ability of indica rice, characterized in that: The callus formation ability of indica rice was enhanced by overexpressing the japonica rice OsLEC1 gene fragment.
3. The use according to claim 2, characterized in that The starting vector for constructing the recombinant expression vector is pRI101-ON vector or pCAMBIA1300 vector.
4. The use according to any one of claims 1 to 3, characterized in that The indica rice is 9311.
5. A method for improving the callus formation ability of indica rice, characterized in that: The following steps are involved: The recombinant expression vector according to claim 2 or 3 is introduced into Agrobacterium competent cells, and then the indica rice callus is immersed in an Agrobacterium suspension.
6. The method according to claim 5, characterized in that The Agrobacterium is EHA105.
7. The method according to claim 6, characterized in that The indica rice is 9311.
8. The method according to claim 7, characterized in that The callus formation ability of indica rice was enhanced by overexpressing the japonica rice OsLEC1 gene fragment.
Citation Information
Patent Citations
Method for high efficiency regeneration and genetic transformation of indica rice
CN102943090A
Method for acquiring aromatic rice strain by targeting Badh2 gene via CRISPR / Cas9 gene editing technology
CN105505979A