Application of palmatine or salt thereof in resisting methicillin-resistant staphylococcus aureus

Through multi-target synergistic effects, Bamatin solves the problem of differences in potency between existing antibacterial drugs in vivo and in vitro, achieves effective inhibition and elimination of MRSA, and has excellent in vitro and in vivo antibacterial properties and safety.

CN120586104AActive Publication Date: 2025-09-05CHONGQING BULL ANIMAL PHARMA
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510834123.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-20
Publication Date
2025-09-05
Estimated Expiration
2045-06-20

AI Technical Summary

Technical Problem

Existing antimicrobial drugs have strong in vitro activity against methicillin-resistant Staphylococcus aureus (MRSA), but their potency in vivo is significantly attenuated, leading to treatment difficulties. The emergence of vancomycin-resistant MRSA (VRSA) has exacerbated the difficulty of treatment.

Method used

Bamipine or its salts inhibit MRSA through multi-target synergistic effects, including increasing cell wall permeability, damaging cell membranes, destroying extracellular barrier structures and intracellular homeostasis systems, inhibiting ATP synthesis and biofilm formation, and promoting mecA gene expression, and have excellent anti-MRSA properties in vivo and in vitro.

Benefits of technology

Bamatin effectively inhibits and kills MRSA in vitro, eliminates MRSA from the blood and organs in vivo, reduces the load, is highly safe, does not affect liver and kidney function, significantly improves survival rate and reduces organ bacterial load.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120586104A_ABST
    Figure CN120586104A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of antibacterial preparations, and particularly relates to application of palmatine or salt thereof in resisting methicillin-resistant staphylococcus aureus. The palmatine or the salt thereof can effectively inhibit and kill methicillin-resistant staphylococcus aureus in vitro, the effective inhibitory concentration of the palmatine or the salt thereof on the methicillin-resistant staphylococcus aureus is greater than or equal to 500 mu g / mL, and the effective bactericidal concentration of the palmatine or the salt thereof on the methicillin-resistant staphylococcus aureus is greater than or equal to 1000 mu g / mL; the methicillin-resistant staphylococcus aureus in blood and / or visceral organs can be effectively removed in vivo, so that the load of the methicillin-resistant staphylococcus aureus in the blood and / or visceral organs is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of antibacterial preparations, and particularly relates to use of bamipine or its salt in resisting methicillin-resistant Staphylococcus aureus. Background Art

[0002] Methicillin-resistant Staphylococcus aureus (MRSA), a typical multidrug-resistant Gram-positive pathogen, has become a major challenge in clinical treatment for infectious diseases such as bacteremia. Because MRSA is inherently resistant to β-lactam antibiotics and can further break through the targets of other antimicrobial drugs through acquired resistance mechanisms, conventional antimicrobial treatment is prone to failure, significantly increasing patient mortality and the medical burden. The spread and prevalence of such drug-resistant pathogens is more likely to trigger a public health crisis similar to the widespread drug resistance during the penicillin era. Therefore, effective control of MRSA infections has become an urgent need in the global anti-infective field.

[0003] Currently, the first-line treatment for MRSA infections in clinical practice relies primarily on vancomycin, but its long-term use has induced the emergence of vancomycin-resistant MRSA (VRSA), further exacerbating the treatment dilemma. Against this backdrop, overcoming the existing resistance dilemma of β-lactam antibiotics and developing novel anti-MRSA drugs have become key strategies to circumvent the risk of treatment failure under the selective pressure of antimicrobial drugs. However, the development of existing antimicrobial drugs has been slow, and there is an urgent need to discover candidate compounds with novel mechanisms of action or highly active in vivo.

[0004] It is worth noting that the current development of antimicrobial drugs still relies heavily on in vitro antimicrobial activity screening. While some natural products and their monomeric components exhibit potent antimicrobial activity in vitro, their actual potency in vivo is significantly attenuated or even inactivated due to factors such as complex pharmacokinetics (such as absorption, distribution, metabolism, and excretion), biotransformation processes, and tissue-specific distribution. This "in vitro-in vivo potency discrepancy" greatly limits the efficiency of candidate drug development. Therefore, there is an urgent need to screen for new anti-MRSA compounds that exhibit both in vitro and in vivo efficacy. Summary of the Invention

[0005] The present invention aims to provide a new use of bamipine or a salt thereof in combating methicillin-resistant Staphylococcus aureus (MRSA). The present invention has verified that bamipine or a salt thereof has excellent anti-MRSA performance both in vivo and in vitro, with an effective antibacterial concentration of ≥500 μg / mL and an effective bactericidal concentration of ≥1000 μg / mL against MRSA.

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0007] In one aspect, the present invention provides a use of bamipine or a salt thereof in treating methicillin-resistant Staphylococcus aureus for non-therapeutic purposes.

[0008] Preferably, in the above use, bamipine or its salt has one or more of the following functions:

[0009] (A1) Bamipine or its salt has the function of increasing the permeability of the cell wall structure of methicillin-resistant Staphylococcus aureus;

[0010] (B1) Bamipine or its salt has the function of damaging the cell membrane of methicillin-resistant Staphylococcus aureus;

[0011] (C1) Bamipine or its salt has the function of destroying the extracellular barrier structure and intracellular homeostasis system of methicillin-resistant Staphylococcus aureus;

[0012] (D1) Bamipine or its salt has the function of inhibiting ATP synthesis in methicillin-resistant Staphylococcus aureus cells;

[0013] (E1) Bamipine or its salt has the function of inhibiting the formation of biofilm structure of methicillin-resistant Staphylococcus aureus;

[0014] (F1) Bamipine or its salt has the function of promoting the expression of the mecA gene.

[0015] Preferably, in the above use, the palmatine salt is hydrochloride.

[0016] Another aspect of the present invention provides a use of bamipine or a salt thereof in preparing a medicament for treating a disease, wherein the disease is methicillin-resistant Staphylococcus aureus infection.

[0017] Preferably, in the above use, the disease is anemia or inflammation.

[0018] Preferably, in the above use, bamipine or its salt has one or more of the following functions:

[0019] (A2) Bamipine or its salt has the function of reducing the load of methicillin-resistant Staphylococcus aureus in the blood;

[0020] (B2) Bamipine or its salt has the function of reducing the load of methicillin-resistant Staphylococcus aureus in organs.

[0021] Preferably, in the above use, the dosage form of the drug includes tablets, powders, injections, oral solutions, sprays, patches or ointments.

[0022] Preferably, in the above use, the palmatine salt is hydrochloride.

[0023] The beneficial effects of the present invention include:

[0024] (1) Bamatin can effectively inhibit and kill methicillin-resistant Staphylococcus aureus in vitro. Its effective inhibitory concentration for methicillin-resistant Staphylococcus aureus is ≥500μg / mL, and its effective bactericidal concentration is ≥1000μg / mL.

[0025] (2) Bamatin can effectively eliminate methicillin-resistant Staphylococcus aureus in the blood and / or organs in the body, thereby reducing the load of methicillin-resistant Staphylococcus aureus in the blood and / or organs.

[0026] (3) In the concentration range of 1×MIC to 8×MIC, the hemolytic activity of bamipine was maintained in the range of 0.45% to 3.90% (1×MIC: 0.45%, 2×MIC: 1.38%, 4×MIC: 2.50%, 8×MIC: 3.90%), which is significantly lower than the clinical safety threshold (5%). Moreover, bamipine does not affect liver and kidney function, and has a certain protective effect on the liver and kidneys, indicating that bamipine has good safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is the dynamic inhibition curve of bamipine against MRSA;

[0028] Figure 2 is the effect of bamipine on the electrical conductivity of MRSA;

[0029] Figure 3 This is the result of NPN fluorescent dye uptake after MRSA was treated with bamipine;

[0030] Figure 4 This is the β-galactosidase result after bamipine acts on MRSA;

[0031] Figure 5 The effect of bamipine on the morphology and structure of MRSA cells was observed by electron microscopy. a and c are blank control groups; b and d are 2×MIC bamipine-treated groups;

[0032] Figure 6 The effect of bamipine on MRSA DNA content; a and d are blank control groups; b and e are 1×MIC bamipine treatment groups; c and f are 2×MIC bamipine treatment groups;

[0033] Figure 7 The effect of bamipine on MRSA energy metabolism;

[0034] Figure 8 The effect of bamipine on the biofilm formation ability of MRSA; *: compared with the control group, P < 0.05; **: compared with the control group, P < 0.01; ***: compared with the control group, P < 0.001;

[0035] Figure 9 The effect of bamipine on MRSAmecA; *: compared with the control group, P < 0.05; **: compared with the control group, P < 0.01; ***: compared with the control group, P < 0.001;

[0036] Figure 10 The hemolytic activity of different concentrations of bamipine;

[0037] Figure 11 is the survival curve of mice in each group;

[0038] Figure 12 This is a graph of liver and kidney indicators in mice;

[0039] Figure 13 HE staining results of mouse lung tissue (×400); a) is the normal group; b) is the model group; c) is the vancomycin group; d) is the high-dose bamipine group; e) is the medium-dose bamipine group; f) is the low-dose bamipine group. DETAILED DESCRIPTION

[0040] The examples are provided to better illustrate the present invention, but are not intended to limit the present invention to the examples. Therefore, non-essential improvements and adjustments to the embodiments made by those skilled in the art based on the above-mentioned invention still fall within the scope of protection of the present invention.

[0041] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "comprise" and the like are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0042] In a first aspect, an embodiment of the present invention provides a use of bamipine or a salt thereof in combating methicillin-resistant Staphylococcus aureus for non-therapeutic purposes.

[0043] It should be noted that the present invention has verified that bamipine or its salts have excellent anti-methicillin-resistant Staphylococcus aureus performance, can be used in vitro against methicillin-resistant Staphylococcus aureus, and have excellent antibacterial effects. Among them, the effective inhibitory concentration of bamipine or its salts against methicillin-resistant Staphylococcus aureus is ≥500μg / mL, and the effective bactericidal concentration of bamipine or its salts against methicillin-resistant Staphylococcus aureus is ≥1000μg / mL. That is, the minimum inhibitory concentration of bamipine or its salts against methicillin-resistant Staphylococcus aureus is 500μg / mL. At a concentration of 1000μg / mL, the bactericidal rate of bamipine or its salts against methicillin-resistant Staphylococcus aureus can reach 99.99%, which meets the MBC judgment standard.

[0044] In some specific examples, in the above uses, palmatine or its salt has one or more of the following functions:

[0045] (A1) Bamipine or its salt has the function of increasing the permeability of the cell wall structure of methicillin-resistant Staphylococcus aureus;

[0046] (B1) Bamipine or its salt has the function of damaging the cell membrane of methicillin-resistant Staphylococcus aureus;

[0047] (C1) Bamipine or its salt has the function of destroying the extracellular barrier structure and intracellular homeostasis system of methicillin-resistant Staphylococcus aureus;

[0048] (D1) Bamipine or its salt has the function of inhibiting ATP synthesis in methicillin-resistant Staphylococcus aureus cells;

[0049] (E1) Bamipine or its salt has the function of inhibiting the formation of biofilm structure of methicillin-resistant Staphylococcus aureus;

[0050] (F1) Bamipine or its salt has the function of promoting the expression of the mecA gene.

[0051] It should be noted that, by constructing an in vitro pharmacodynamic model, the present invention found that bamipine or its salt inhibited MRSA proliferation through multi-target synergistic action. Electron microscopy showed that bamipine or its salt could destroy the cell wall and plasma membrane structure. Combined with the changes in indicators such as conductivity and ATP content, it was confirmed that it exerted its antibacterial effect by destroying the integrity of the membrane barrier and interfering with energy metabolism; and at sub-inhibitory concentrations, bamipine or its salt could still significantly inhibit the growth of bacteria in the biofilm, and the inhibitory effect was dose-dependent, indicating that it could break through the biofilm resistance barrier. In addition, mecA gene expression regulation and hemolysis test data showed that bamipine or its salt enhanced the antibacterial effect by regulating the PBP2a resistance gene pathway. The hemolysis test provides a safety basis for its clinical transformation. This multi-action mechanism shows that bamipine or its salt has the potential to become a multi-target therapeutic agent for anti-resistant bacteria.

[0052] In some specific examples, in the above uses, the palmatine salt is hydrochloride, i.e., palmatine hydrochloride.

[0053] In a second aspect, an embodiment of the present invention provides a use of bamipine or a salt thereof in preparing a medicament for treating a disease, wherein the disease is a methicillin-resistant Staphylococcus aureus infection.

[0054] It should be noted that, based on the resistance of bamipine or its salt to methicillin-resistant Staphylococcus aureus, bamipine or its salt can be prepared into a drug for treating diseases related to methicillin-resistant Staphylococcus aureus infection. Diseases related to methicillin-resistant Staphylococcus aureus infection include but are not limited to wounds infected with methicillin-resistant Staphylococcus aureus, and wounds include but are not limited to surgical wounds.

[0055] In some embodiments, in the above uses, the disease is anemia or inflammation.

[0056] In some specific examples, in the above uses, palmatine or its salt has one or more of the following functions:

[0057] (A2) Bamipine or its salt has the function of reducing the load of methicillin-resistant Staphylococcus aureus in the blood;

[0058] (B2) Bamipine or its salt has the function of reducing the load of methicillin-resistant Staphylococcus aureus in organs.

[0059] It should be noted that the present invention is based on the construction of a systemic bacteremia animal model and implements a multi-dimensional detection system: dynamic monitoring of body weight, analysis of whole blood cell parameters, quantitative circulatory pathogen load, assessment of liver and kidney tissue pathological damage, count of colonies in solid organs and pathological anatomy observation, to construct a multi-parameter comprehensive evaluation system, aiming to scientifically analyze the in vivo antibacterial effect of bamipine or its salts. According to the statistical analysis of the experimental data, the model group showed significant pathological manifestations: significant weight loss, significant inhibition of behavioral activity, motor dysfunction in some individuals, and a cumulative mortality rate of 50%. Quantitative blood infection counts showed that the blood bacterial load and major organ bacterial load in this group were significantly higher than those in other groups, and the liver and kidney biochemical indicators were higher than those in the control group. Histopathological examination of the lungs showed extensive parenchymal damage and obvious lesions. The body weight of the experimental animals in the high-dose bamipine or its salt treatment group maintained the physiological control level, there was no significant abnormality in feeding and drinking behavior, the survival state was good, and the survival rate was significantly improved compared with the model group (the low and medium dose groups were 70% and 80%, respectively). At the same time, pathogen detection showed that the bacterial load in the peripheral blood of the treatment group decreased, and the bacterial load in major organs (heart, liver, spleen, lungs, and kidneys) also decreased significantly, with no statistically significant difference compared with the vancomycin-positive control group. Biochemical index analysis showed that liver and kidney function parameters improved in a dose-dependent manner in each dose group, and organ coefficients returned to the physiological range. HE staining histopathological evaluation showed that the alveolar structure of the lung tissue in the group treated with bamipine or its salt was intact, with no inflammatory infiltration or fibrotic lesions, and the pathological score was comparable to that of the vancomycin group. This shows that bamipine or its salt has good antibacterial efficacy in vivo.

[0060] In some specific examples, in the above uses, the dosage form of the drug includes tablets, powders, injections, oral solutions, sprays, patches or ointments.

[0061] It should be noted that the dosage forms of the drug for treating methicillin-resistant Staphylococcus aureus infection of the present invention can be any type known in the art, such as tablets, powders, injections, oral solutions, sprays, patches, or ointments. Methods for preparing the above dosage forms are known in the art.

[0062] In some specific examples, in the above uses, the palmatine salt is hydrochloride, i.e., palmatine hydrochloride.

[0063] In order to better understand the present invention, the content of the present invention is further explained below with reference to specific examples, but the content of the present invention is not limited to the following examples.

[0064] In the following examples, TSB liquid culture medium was purchased from Qingdao Haibo Biotechnology Co., Ltd.

[0065] Example 1

[0066] The embodiments of the present invention provide an in vitro antibacterial test of bamipine against MRSA, specifically including determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of bamipine on MRSA, testing of the effect of bamipine on the growth curve of MRSA, testing of the effect of bamipine on the electrical conductivity of MRSA, testing of the effect of bamipine on the cell wall of MRSA, testing of the effect of bamipine on the cell membrane of MRSA, observation of the antibacterial effect of bamipine on MRSA by scanning electron microscopy (SEM) and transmission electron microscopy (TEM), observation of changes in the intracellular DNA content of bacteria by laser focusing microscopy, effect of bamipine on MRSA energy metabolism, determination of the ability of bamipine to inhibit MRSA biofilm formation, effect of bamipine on the PBP2a encoding gene mecA, and determination of the red blood cell hemolysis rate by bamipine.

[0067] (1) Determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of bacterium against MRSA

[0068] The minimum inhibitory concentration (MIC) of bacterium against MRSA was determined by the microdilution method, and the minimum bactericidal concentration (MBC) was determined by the colony count method, as follows:

[0069] (1) 96-well plate loading: Add 200 μL of drug stock solution (concentration of 4000 μg / mL, solvent is TSB liquid medium) to the highest concentration well (the first well from the left of the 96-well plate). Starting from the second well, add 100 μL of TSB liquid medium to each well. Use a pipette to draw 100 μL of drug stock solution from the first well to the second well for geometric dilution. Set 14 mass concentration gradients. Use a pipette to add 100 μL of 1×10 6 CFU / mL bacterial suspension, so that the final concentration of bamipine is 2000μg / mL, 1000μg / mL, 500μg / mL, 250μg / mL, 125μg / mL, 62.5μg / mL, 31.25μg / mL, 15.63μg / mL, 7.81μg / mL, 3.91μg / mL, 1.95μg / mL, 0.98μg / mL, 0.49μg / mL and 0.25μg / mL, and positive control wells (200μL bacterial solution) and negative control wells (200μL TSB culture medium) are set up, with 3 replicates per group.

[0070] (2) MIC result reading: After incubating the 96-well plate in a 37°C incubator for 24 hours, the results of the culture system in the 96-well plate are interpreted. The negative control wells remain transparent and clear, while the positive control wells are clearly turbid. The MIC determination standard is defined as the lowest drug concentration threshold at which all bacteria form colonies that can be identified by the naked eye.

[0071] (3) MBC result assessment: After completing the MIC test, 100 μL was drawn from the negative control well (transparent and clear) of each test group and evenly spread on the TSA agar surface using a sterile spreading stick to form a bacterial liquid film; the inoculated culture medium was transferred to a 37°C constant temperature culture environment for continuous incubation for 24 h, and the colony count test was performed after the incubation was completed; the MBC value was determined by counting the colony forming units corresponding to each well and combining it with the CLSI drug sensitivity test standard: when the drug concentration reaches a level that reduces the initial bacterial count by more than 99.9% (residual bacterial count), the critical concentration is identified as the minimum bactericidal concentration (MBC).

[0072] The results showed that at a concentration of 500 μg / mL bamipine, the culture wells remained transparent and clear, and 90% of the strain growth was inhibited. Based on this, the MIC of bamipine was determined to be 500 μg / mL. In addition, colony count analysis showed that when the drug concentration was increased to 1000 μg / mL, the number of viable MRS bacteria decreased by 4 logarithmic levels (bactericidal rate 99.99%), meeting the MBC judgment standard. These results indicate that bamipine can significantly inhibit the growth of MRSA and has a direct killing effect.

[0073] (2) Test on the effect of Bamatin on MRSA growth curve

[0074] A concentration gradient was set according to the MIC of palmatine for the strain to be tested. 1000 μg / mL, 500 μg / mL, 250 μg / mL, 125 μg / mL, 62.5 μg / mL, 31.25 μg / mL and 15.63 μg / mL palmatine solutions were added from left to right in a 96-well plate. Then, a MRSA bacterial suspension (1×10 5CFU / mL) was added to each well and mixed evenly to give a final concentration of 2×MIC (the MIC of bamipine for MRSA is 500μg / mL, 2×MIC represents 1000μg / mL, and the same applies below), 1×MIC, 1 / 2×MIC, 1 / 4×MIC, 1 / 8×MIC, 1 / 16×MIC, and 1 / 32×MIC. 200μL of blank bacterial suspension was selected as a control. The 96-well plate was placed in a 37°C constant temperature incubator and OD600nm was measured at 0h, 2h, 4h, 6h, 8h, 10h, 12h, 14h, 16h, 18h, 20h, 22h, and 24h. With the incubation time as the horizontal axis and the OD600nm value as the vertical axis, the dynamic inhibition curve of bamipine was drawn to analyze its dynamic inhibition effect. The experiment was repeated 3 times.

[0075] The results are as follows Figure 1 The results showed that bamipine's antibacterial effect on MRSA was concentration-dependent. Within 14 hours, the turbidity of the culture medium in the 1×MIC and 2×MIC groups did not show a significant increase. The control group entered the logarithmic growth phase at 5 hours and reached a stable phase between 17 and 24 hours. The subinhibitory concentration group (1 / 32×MIC to 1 / 2×MIC) delayed bacterial proliferation within the initial 6 hours. Although growth resumed in the subsequent period, the increase in turbidity was lower than that of the control group. These data indicate that bamipine can effectively inhibit the proliferation of MRSA and that the antibacterial strength is positively correlated with drug concentration.

[0076] (3) Test on the effect of bamipine on MRSA conductivity

[0077] Methicillin-resistant Staphylococcus aureus pellets were collected, washed with sterile PBS, and resuspended in various concentrations of bamipine solution. The pellets were mixed to achieve final concentrations of 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC. The pellets were incubated at 37°C and shaken at 180 rpm for 8 hours. Samples were collected at 0, 2, 4, 6, and 8 hours, and the supernatant was centrifuged (6000 rpm for 10 minutes). The untreated bacterial suspension served as a blank control. The conductivity of the supernatant at different time points was measured using a conductivity meter. The experiment was repeated three times.

[0078] Conductivity changes as Figure 2 The results show that different concentrations of bamipine have differential effects on MRSA membrane permeability. The conductivity of the negative control group showed a rapid upward trend from 0 to 2 hours, then decreased from 2 to 4 hours, and then resumed a steady growth from 4 to 8 hours. Although the 1 / 2×MIC group showed a similar fluctuation pattern, the increase in conductivity was greater than that of the control group, suggesting a partial membrane damage effect. The 1×MIC and 2×MIC groups showed a rapid increase in conductivity early in the experiment, from 0 to 2 hours, confirming that this concentration threshold can rapidly destroy membrane integrity. Furthermore, the conductivity values ​​of the 1×MIC and 2×MIC groups remained higher than those of the negative control group from 0 to 8 hours.

[0079] (IV) Test of the effect of Bamatin on MRSA cell wall

[0080] In the following tests, NPN is a commonly used fluorescent probe for measuring cell wall permeability. When the bacterial outer membrane structure is intact, NPN cannot penetrate the dense peptidoglycan layer due to polar repulsion. However, if the cell wall is structurally damaged, the probe molecule can penetrate the hydrophobic region and stimulate a fluorescent signal.

[0081] (1) In a reaction system containing 5 mM HEPES buffer (pH = 7.4), ATCC 43300 (Staphylococcus aureus) bacterial suspension (1 × 10 5 CFU / mL) was mixed evenly with 10 μM NPN (N-phenyl-1-naphthylamine, purchased from Beijing Solebow Technology Co., Ltd.), incubated at 37°C for 1 h, and the background fluorescence signal intensity was measured using a spectrophotometer (excitation wavelength 350 nm, emission wavelength 420 nm).

[0082] (2) Equal volumes of bacterial suspension were mixed with bamipine solution in a sterile 96-well black plate to a final concentration of bamipine of 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC. Fluorescence was recorded over time. Three replicates were performed in each group, and the experiment was repeated three times. The MRSA strain treated with 30 μg / mL vancomycin was set as the positive control group; the original bacterial suspension without drug treatment was used as the negative control group, and fluorescence intensity was detected and analyzed simultaneously.

[0083] The test results are as follows Figure 3 As shown, when bamipine (1×MIC and 2×MIC) was applied to MRSA strains, the uptake rate of the NPN fluorescent probe showed a rapid upward trend within the first 2 minutes of drug exposure, and the intracellular fluorescence signal intensity was significantly enhanced compared to the blank control group. Compared with vancomycin, bamipine also exhibited cell wall permeability regulation. These results indicate that bamipine can cause changes in the structural permeability of the MRSA cell wall.

[0084] (V) Effect of Bamatin on MRSA Cell Membrane

[0085] It should be noted that β-galactosidase, a highly conserved hydrolase, is widely present in animal tissues, plants, microbial systems, and in vitro cell culture systems. This enzyme possesses dual catalytic properties: it specifically hydrolyzes β-galactosidic bonds and mediates transgalactosidation reactions. When cell membrane integrity is impaired, leading to abnormally increased permeability, intracellular β-galactosidase can leak out. Based on this characteristic, quantitative measurement of the enzyme's activity level in the extracellular environment can serve as an effective biomarker for assessing the extent of damage to biomembrane structure.

[0086] (1) Cultivate ATCC43300 to the logarithmic growth phase (OD 600nm =0.5), different concentrations of bamipine solution were added to make the final concentration of bamipine 2×MIC, 1×MIC, 1 / 2×MIC, 1 / 4×MIC, and the bacterial concentration was 1×10 5 In addition, sterile PBS buffer was used instead of palmatine as a control group.

[0087] (2) Constant temperature culture at 37°C and 180 rpm in a shaking incubator: 1 mL of bacterial solution was taken at 0 h, 2 h, 4 h, 6 h, and 8 h, placed in a 1.5 mL centrifuge tube, centrifuged at 15,000 rpm at 4°C for 10 min, discarded the supernatant, added 1 mL of the extract, and disrupted the bacteria with ultrasound (ice bath, power 200 W, ultrasound 3 s, interval 10 s, repeated 30 times), centrifuged at 15,000 rpm at 4°C for 10 min, took the supernatant, and placed on ice for testing. The β-galactosidase activity was determined according to the instructions of the kit.

[0088] Test results such as Figure 4 As shown in the results, the extracellular β-galactosidase activity of the non-medicated control group did not show significant fluctuations. In the groups treated with 1×MIC and 2×MIC palmatine concentrations, a sharp upward trend in extracellular enzyme activity was detected within 2 hours, and it was maintained at a dynamic equilibrium level in the subsequent period, and the degree of membrane damage was concentration-dependent.

[0089] (VI) Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observation of the antibacterial effect of bamipine on MRSA

[0090] The logarithmic phase bacterial suspension was mixed evenly with an equal volume of bamipine solution to make the final concentration of bamipine reach 2×MIC. At the same time, a bacterial suspension without drug treatment was set as a blank control group and cultured at 37°C and 180rpm for 6 hours; the bacteria were collected by centrifugation at 4000rpm for 10 minutes and washed three times with sterile PBS buffer; the bacterial precipitate was fixed with 2.5% glutaraldehyde at 4°C for 12 hours; the sample was dehydrated with a gradient ethanol solution, and the treatment time was 15 minutes at each concentration gradient; then, it was replaced with tert-butanol dehydrating agent twice, and the sample was dried with the help of a critical point dryer; after the sample was gold-sprayed, it was observed using a scanning electron microscope. For the fixation of transmission electron microscopy samples, glutaraldehyde was used for 12 hours, followed by fixation with 1% osmium acid solution for another hour; the bacteria were collected by centrifugation at 4000 rpm for 10 minutes, rinsed three times with sterile PBS buffer, and dehydrated through acetone gradient; the samples were embedded in epoxy resin and left overnight, dried at 50°C for 48 hours, and then stained with 1% uranyl acetate for 30 minutes, and finally observed using a transmission electron microscope.

[0091] The SEM imaging results are as follows Figure 5As shown, the results showed that the MRSA control group, without drug intervention, exhibited a typical regular spherical structure and maintained a tight grape-like cluster-like aggregation. However, after exposure to 2×MIC bamipine, the pathogen's ultrastructure underwent significant changes: irregular surface collapse formed on most bacteria, the original cluster connection network was broken, and over 80% of the cell membranes showed discontinuous rupture. TEM observations revealed that the cell membrane of the control strain was intact and continuous, and the electron cloud distribution of the intracellular matrix was uniform and dense. However, cells in the 2×MIC bamipine treatment group displayed multidimensional damage characteristics, including cytoplasmic vacuolization, separation of the cytoplasm from the cell wall, cell shrinkage and decreased electron density, cell wrinkling, cell rupture, and leakage of contents. These results indicate that bamipine can disrupt the extracellular barrier structure and intracellular homeostasis system of MRSA.

[0092] (VII) Observation of changes in bacterial intracellular DNA content using laser focusing microscopy

[0093] It should be noted that as the core carrier of bacterial genetic regulation, DNA dominates the proliferation, differentiation, and genetic information transmission processes of pathogens. Due to the fluorescent properties of DAPI, this probe can selectively penetrate the cell walls and cell membranes of living cells, specifically binding to intracellular nucleic acids to produce a high-intensity blue fluorescent signal. This study compared the MRSA strains in the bamipine-treated group with those in the blank control group through fluorescence signal intensity analysis to evaluate the intervention effect of bamipine on intracellular nucleic acid metabolism.

[0094] The bacterial suspension was mixed with a bamipine solution to create a gradient of final bamipine concentrations (2×MIC and 1×MIC) and cultured at 37°C with constant shaking (1800 rpm for 8 hours). After incubation, the suspension was treated with 10 μg / mL LDAPI (4',6-diamidino-2-phenylindole) staining solution in the dark for 15 minutes. Ten μL of the mixture was evenly spread on a clean glass slide, sealed with an anti-quencher, and fluorescence signals were immediately acquired using a confocal laser scanning microscopy (CLSM) system.

[0095] The test results are as follows Figure 6 As shown in the results, the fluorescence intensity of the bacteria after treatment with bamipine was lower than that of the blank group. The experiment suggested that bamipine may exert its antibacterial effect by interfering with the nucleic acid metabolic pathway, and preliminarily verified that DNA is its potential target.

[0096] (8) Effect of Bamipine on MRSA Energy Metabolism

[0097] It should be noted that ATP is the core energy carrier of microbial metabolic activities, and the dynamic changes in its intracellular concentration can reflect the physiological activity state of the bacteria.

[0098] The bacterial suspension was mixed with a palmatine solution to a final concentration of 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC. The bacterial suspension without palmatine served as a blank control. Three replicates were set for each group, and the experiment was repeated three times. Culture was performed at 37°C with constant temperature and shaking at 180 rpm. Bacteria were collected by centrifugation (12,000 rpm, 5 min) at 0, 1, 2, 3, 4, 5, and 6 h of culture. After resuspending in PBS, the cells were disrupted and resuspended at low temperature using an ultrasonic cell disruptor (ultrasonic power 200 W, ultrasonic time 3 s, interval time 3 s, 40 cycles). The cells were then centrifuged (12,000 rpm, 5 min), and the supernatant was collected. ATP content was determined according to the instructions of the ATP kit.

[0099] Test results such as Figure 7 As shown in the results, after 1 hour, the intracellular ATP content of the control group and the treatment groups at various concentrations showed a downward trend. However, as the exposure time prolonged, the intracellular ATP content of the control group showed an increasing trend. The change trend of 1 / 4×MIC was similar to that of the control group, while the intracellular ATP content of bacteria in the 1 / 2×MIC, 1×MIC, and 2×MIC concentrations of bamipine treatment groups all decreased. The results indicate that bamipine can inhibit the synthesis of intracellular ATP in methicillin-resistant Staphylococcus aureus, leading to an imbalance in energy metabolism. Ultimately, by inhibiting the basic metabolic pathway of the bacteria, it blocks its proliferation process and inhibits the growth of the bacteria.

[0100] (IX) Determination of the inhibitory ability of bamipine on MRSA biofilm formation

[0101] Single colonies were picked from ATCC 43300TSA culture plates and incubated in 4 mL of TSB culture medium at 37°C with shaking at 180 rpm until the logarithmic growth phase; 200 μL of bacterial solution was inoculated into a sterile 96-well plate, and a series of gradient concentrations of bamipine solution were added to make the final concentrations 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC. The control group was served without drug addition; after incubation in a 37°C constant temperature incubator for 24 h, the culture medium was discarded and the plates were washed three times with 200 μL of sterile PBS buffer for about 30 s each time to remove floating bacteria; 200 μL of 70% methanol was added for fixation for 30 min, the fixative was aspirated, the 96-well plate was placed in a constant temperature dry state at 37°C, and the biofilm was stained with 0.1% crystal violet solution for 5 min; the staining solution was removed, and the plates were rinsed three times with 200 μL of sterile PBS buffer, and then dried at 37°C for 1 h; 200 μL of The dye was dissolved in 33% acetic acid solution (for 15 min to ensure complete dissolution of the biofilm matrix), and the absorbance was measured at 570 nm using a multifunctional microplate reader.

[0102] The results of the test are as follows Figure 8As shown, the results showed that the MRSA biofilm formation ability decreased in a dose-dependent manner with the drug concentration. When the concentration of bamipine was 1 / 2×MIC, it was observed that the inhibition rate of MRSA biofilm formation after bamipine treatment reached about 60%, indicating that bamipine can effectively inhibit the formation of MRSA biofilm structure.

[0103] (10) Effect of Bamipine on the PBP2a encoding gene mecA

[0104] (1) RNA extraction: Take the activated bacterial suspension and add prepared bamipine solution of different concentrations to make the final concentration of bamipine in the bacterial suspension 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC, respectively. At the same time, set up a control group without bamipine solution; shake and culture in a constant temperature shaking incubator at 37℃ and 180rpm for 12h; centrifuge the bacterial suspension at 4℃ and 6000rpm for 15min, collect the bacterial precipitate, and wash twice with DEPC water; centrifuge at 8000rpm for 5min to remove the supernatant, add 20mg / mL lysozyme for 60min to enzymatically degrade the MRSA cell wall; extract RNA according to the RNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.); package and store in an ultra-low temperature environment of -80℃; proceed to the subsequent steps after the RNA purity and concentration meet the standards by ultra-micro spectrophotometer.

[0105] (2) Reverse transcription: Reverse transcription was performed using the MightyScript First-Strand cDNA Synthesis Master Mix (Genomic DNA-free) kit from Sangon Biotech (Shanghai) Co., Ltd.

[0106] (3) Determination of relative expression

[0107] Fluorescent quantitative PCR was performed using the SGExcel FastSYBR qPCR Master Mix Kit (Shanghai, China) from Sangon Biotech Co., Ltd. cDNA was diluted 5-8 times and used as a template for analysis. Primer sequences were shown in Table 1, and the real-time PCR reaction system was shown in Table 2.

[0108] Table 1 Primer information

[0109] Gene name Primer-F Primer-R mecA AAAATCGATGGTAAAGGTTGGC AGTTCTGCAGTACCGGATTTGC

[0110] Table 2 Fluorescence quantitative PCR amplification reaction system

[0111]

[0112]

[0113] Perform reverse transcription reaction on a fluorescence quantitative PCR instrument according to the conditions in Table 3.

[0114] Table 3 Fluorescence quantitative PCR amplification reaction program

[0115]

[0116] The test results are as follows Figure 9 The results showed that the relative expression of the mecA gene in MRSA strains treated with different concentrations of bamipine showed a dose-dependent upregulation trend. This result suggests that bamipine can significantly upregulate the expression of the mecA gene encoding the PBP2a protein in MRSA through a regulatory network, and its mechanism of action may involve multiple levels such as release of transcriptional repression, activation of stress response, and interference with signaling pathways.

[0117] (11) Determination of the hemolysis rate of red blood cells by bamipine

[0118] It should be noted that drugs cause hemolysis of red blood cells. The reason is that the toxicity of drugs to red blood cells causes serious rupture of the cell membrane, releasing hemoglobin into the medium, and turning the opaque cell suspension into a red, transparent hemoglobin solution. The effect of drugs on red blood cell hemolysis can be measured by detecting changes in the absorbance of the red blood cell solution.

[0119] (1) Preparation of red blood cell suspension: a sterile defibrinated rabbit blood sample (1 mL) was taken and placed in 10 mL of sterile D-Hanks solution (pH = 7.2), and centrifuged (3000 rpm, 10 min) to obtain a red blood cell pellet; after aspirating the supernatant, the sample was washed with an equal volume of sterile D-Hanks solution (repeated 3 times, each time at 3000 rpm, 10 min centrifugation) until the supernatant became transparent after centrifugation; 200 μL of the dense red blood cell pellet was removed and resuspended in 9800 μL of sterile D-Hanks solution to prepare a standard red blood cell suspension with a final concentration of 2%;

[0120] (2) The red blood cell suspension in step (1) was drawn and mixed with equal volumes of gradient concentrations of bamipine solution (the final concentration of bamipine was 1×MIC, 2×MIC, 4×MIC, and 8×MIC), and the mixture was placed in a 37°C constant temperature incubator for 1 h; Triton X-100 solution was set as a positive control and normal saline was set as a negative control, and the mixture was incubated simultaneously;

[0121] (3) After the incubation, the sample was removed and centrifuged at 3000 rpm for 10 min at 4°C. The supernatant was aspirated and added to a 96-well plate, with 100 μL per well and 3 replicates per group. The OD value was measured using a multifunctional microplate reader. 530nm The corresponding absorbance was measured at 400 nm. The hemolytic activity was calculated according to the following formula:

[0122] Hemolysis rate (%) = [(sample OD 530nm -Negative OD 530nm ) / (positive OD530nm -Negative OD 530nm )]×100%.

[0123] Hemolysis test data such as Figure 10 As shown, the positive control group showed a typical hemolytic effect, and no obvious hemolytic reaction was detected in the groups treated with bamipine at all concentrations. The dose escalation study showed that within the concentration range of 1×MIC to 8×MIC, the hemolytic activity was maintained in the range of 0.45% to 3.90% (1×MIC: 0.45%, 2×MIC: 1.38%, 4×MIC: 2.50%, 8×MIC: 3.90%), which is significantly lower than the clinical safety threshold (5%). This data shows that bamipine has a good safety profile.

[0124] Example 2

[0125] The present invention provides an experiment on the antibacterial effect of bamipine on MRSA in vivo.

[0126] (1) Experimental groups

[0127] Sixty KM mice (6-8 weeks old, weighing 18-22 g) were fed adaptively for one week and then randomly assigned to six experimental groups, with 10 mice in each group. The experimental grouping is shown in Table 4 below.

[0128] Table 4 Experimental grouping

[0129] Group Name Quantity (pieces) Blank control group (normal group) 10 Model control group (model group) 10 Low-dose bamipine treatment group (low-dose group) 10 Bamastatin medium-dose treatment group (medium-dose group) 10 High-dose bamipine treatment group (high-dose group) 10 Vancomycin-treated group 10

[0130] (II) Establishment of bacteremia model and drug administration method

[0131] (1) The experimental mice received 100 μL of 2×10 9 CFU / mL of bacterial suspension (MRSA, MRSAATCC 43300, purchased from Shanghai Luwei Technology Co., Ltd.) was injected, and the amount of bacteria per mouse was 2×10 8 CFU, and the blank control group was injected with an equal volume of sterile PBS buffer;

[0132] (2) 24 hours after the bacterial solution was injected, each treatment group was treated according to the ratio of body weight to drug volume; among them, the bamipine treatment group was injected with 500μg / mL, 1000μg / mL and 2000μg / mL bamipine solution (solvent was normal saline) through the tail vein, and the corresponding doses were adjusted to 2.5mg / kg, 5mg / kg and 10mg / kg body weight; the vancomycin group was given a 1000μg / mL concentration solution (solvent was normal saline) to achieve the dosing standard of 5mg / kg body weight; the blank control group animals continued to receive sterile PBS buffer. During the efficacy observation phase, the physiological state changes of the test subjects were systematically recorded every 2 hours, covering indicators such as activity level and feeding behavior. Individuals who died during the experiment were immediately fixed with tissue, and the overall intervention period lasted for 7 days.

[0133] (III) Basic phenotypic detection of mice

[0134] (1) Changes in mouse appearance

[0135] The changes in mice in each group before and after infection were observed, as follows:

[0136] Before infection, the mice showed signs of health: their fur was soft and shiny, they maintained a stable food and water intake, and their behavioral activities were well-regulated; after infection, significant pathophysiological conditions were observed in the mice: they almost did not eat, their drinking frequency dropped sharply, they moved slowly, and their body weight continued to decrease and their fur was matted and dull; individuals in the critical stage showed typical pathological characteristics: kyphosis of the spine, motor dysfunction of one side of the limbs, loss of autonomous movement ability, weak respiratory rhythm, and body surface temperature significantly below the normal physiological threshold.

[0137] (2) Changes in mouse weight

[0138] Longitudinal detection and analysis of the changes in body weight of mice in each group 7 days before and after infection are shown in Table 5. The results show that compared with the normal group, the differences in body weight changes of mice in the other groups reached a significant level (P<0.05), but there was no significant difference in body weight changes between the vancomycin group and the medium and high doses of bamipine groups.

[0139] Table 5 Effect of Bamipine on body weight of MRSA infected mouse model

[0140]

[0141] Note: *: compared with the normal group, P < 0.05; **: compared with the normal group, P < 0.01; ***: compared with the normal group, P < 0.001

[0142] (3) Analysis of mouse survival rate

[0143] Based on the data of the time and number of deaths in each group, the survival rate was analyzed by drawing a survival curve. The survival curve is as follows Figure 11 The survival rates are shown in Table 6. The results showed that mice in the model group began to die 24 hours after infection, and the first death occurred in the low-dose bamipine treatment group on the third day. Survival analysis at the endpoint (day 7) showed that the survival rate in the model group dropped to 50%, while the low-dose and medium-dose treatment groups maintained survival levels of 70% and 80%, respectively, and all other groups maintained a 100% survival rate.

[0144] Table 6 Effect of Bamipine on the survival rate of mice infected with MRSA

[0145]

[0146] (IV) Detection of other indicators in mice

[0147] (1) Routine blood test

[0148] On day 7 after infection, three mice in each group underwent eye blood sampling according to the experimental design. The blood was collected into vacuum tubes. Routine blood tests were then performed using a fully automated veterinary hematology analyzer (BC-30Vet, purchased from Shenzhen Mindray Animal Medical Technology Co., Ltd.). The results are shown in Table 7 below.

[0149] Table 7 Effect of Bamipine on Blood Routine of Mice Infected with MRSA (n=3)

[0150]

[0151]

[0152] As shown in Table 7 above, the model group exhibited clear and severe anemia, with significantly lower hemoglobin, red blood cell count, and hematocrit compared to the normal group. This, combined with the decreased mean corpuscular volume, mean hemoglobin content, and concentration, is consistent with microcytic hypochromic anemia. Among all treatment groups, the vancomycin and high-dose groups showed the most significant improvement: HGB, RBC, and HCT in the vancomycin group approached or exceeded normal levels, indicating complete resolution of the anemia. In the high-dose group, HGB and RBC values ​​were above normal, suggesting possible overstimulation of erythropoiesis. The mid-dose and low-dose groups showed near-normal parameters, demonstrating a good safety profile. The model group exhibited significant features of acute bacterial inflammation: elevated WBC counts, a surge in neutrophil counts, and a Gran% (58.4%), along with a significant decrease in lymphocyte percentage, consistent with a systemic inflammatory response caused by MRSA infection. Among all treatment groups, the vancomycin group had the most significant anti-inflammatory effect, with significant improvements in WBC and Gran% compared to the model group, and a return of Lymph% to 60.6%, indicating effective immune recovery. While the high-dose group showed near-normal WBC and neutrophil counts, Gran% remained elevated, potentially reflecting the potential immunosuppression associated with the drug's inhibitory effect on inflammation. The low-dose group showed an abnormally elevated WBC count, but Gran# and Gran% were lower than those in the model group, suggesting possible initial immune stimulation or mixed infection. The medium-dose group maintained WBC counts comparable to those in the model group, while Gran% remained elevated, indicating inadequate inflammation control. This suggests that bamipine has a modest effect on improving anemia and inflammation caused by MRSA.

[0153] (2) Liver and kidney index detection

[0154] On the 7th day after infection, the remaining mice in each group were killed and samples were collected. Whole blood was collected by eye sampling, and the volume of a single sample was strictly controlled in the range of 0.5-0.8 mL. The upper plasma components were immediately separated by centrifugation at 3000 rpm at 4°C for 5 min. The plasma was aliquoted into sterile cryovials, quickly frozen in liquid nitrogen, and then transferred to a -80°C ultra-low temperature freezer for long-term storage to avoid hemolysis that could lead to sampling failure.

[0155] The plasma samples were tested for biochemical detection of liver function-related enzyme indicators (ALT (alanine aminotransferase), AST (aspartate aminotransferase)) and renal function metabolites (BUN (blood urea nitrogen), CR (blood creatinine)) using kits (the kits were all from Nanjing Jiancheng Research Institute, and the corresponding test kit models were alanine aminotransferase test kit C009-2-1, aspartate aminotransferase test kit C010-2-1, urea nitrogen test kit C013-2-1 and creatinine determination kit C011-2-1). By comparing the dynamic changes in serum biochemical parameters of the test animals before and after infection, the effect of MRSA infection on liver and kidney function was systematically evaluated. The test results are shown in Table 8 and Figure 12 shown.

[0156] Table 8 Effects of Bamipine on Liver and Kidney Indices in Mice Infected with MRSA (n=3)

[0157]

[0158] From the above table 8 and Figure 12 It can be seen that ALT, AST, BUN and CRE in the normal group were all within the healthy range, indicating normal liver and kidney function. ALT, BUN and CRE in the model group were elevated, indicating liver cell damage and impaired glomerular filtration function. ALT and AST in the high-dose bamipine group returned to near normal levels, BUN and CRE decreased by 6.0% and 16.3%, respectively. The effect of the medium-dose bamipine group was second only to that of the low-dose bamipine group. BUN and CRE increased instead of decreasing in the low-dose bamipine group, indicating that low doses may increase the burden on the kidneys. Although the renal function of the vancomycin group improved, CRE and ALT were still weaker than those of the high-dose group. The results showed that bamipine has a certain protective effect on the liver and kidneys.

[0159] (3) Results of bacterial count and culture of mouse blood

[0160] Blood was collected from the mice via the eyeballs. 100 μL of whole blood was evenly spread onto PCA medium using a sterile spreader. Different concentration groups were established through a gradient dilution process, with three replicates per treatment group. The inoculated samples were incubated in a 37°C incubator for 24 hours. Colony counts were performed immediately after completion of the incubation period. The results are shown in Table 9.

[0161] Table 9 Effect of Bacterial Counts in Blood of Mice Infected with MRSA

[0162] Grouping Dose / (mg / kg) Sample size / (pieces) Blood bacterial count / (CFU / mL) Normal group / 10 0±0*** Model Group / 10 9207±1128 Bamatin 2.5 10 6321±688* Bamatin 5 10 5189±762** Bamatin 10 10 3746±583*** Vancomycin group 10 10 3468±774***

[0163] Note: *: compared with the model group, P < 0.05; **: compared with the model group, P < 0.01; ***: compared with the model group, P < 0.001

[0164] As shown in Table 9, the peripheral blood bacterial load in the model group was significantly higher than that in the blank control group, while the bacterial load in the vancomycin group and the bamipine treatment groups (low, medium, and high dose groups) showed a dose-dependent downward trend. Further comparison showed that the bacterial load level in the high-dose bamipine group was slightly different from that in the vancomycin group, confirming that bamipine, at this dose, has a blood MRSA clearance ability comparable to that of standard treatment drugs.

[0165] (4) Results of homogenate counting and culture of important mouse visceral organs

[0166] Freshly excised organ tissue was minced and quantitatively transferred to a homogenization tube. An appropriate volume of pre-chilled saline was added and homogenized at low temperature. After tissue fragmentation, 100 μL of the homogenate was evenly spread on the surface of PCA culture medium. A serial dilution gradient was used to establish different sample concentrations, with three replicates per experimental group. The inoculated culture medium was incubated in a 37°C incubator for 24 hours. Colony counts were performed after the incubation period. The results are shown in Table 10.

[0167] Table 10 Infection levels of various organs

[0168]

[0169] Note: “0” represents <10 3 , "1" represents 10 3 ~10 4 , "2" represents 10 4 ~10 5 , "3" represents 10 5 ~10 6

[0170] As can be seen from Table 10 above, the liver and spleen showed the highest bacterial infection levels, and their colony forming units were 1 to 2 orders of magnitude higher than those of the heart, lungs, and kidneys. The bacterial load of each organ infection in the model group was significantly higher than that in other groups. Compared with the model group, the bacterial load of organs in the low-, medium-, and high-dose groups of bamipine and the vancomycin-positive control group was reduced by 1 to 2 orders of magnitude, confirming that bamipine can effectively eliminate the number of pathogens in the internal organs of MRSA-infected mice and has an anti-infection effect.

[0171] (5) Observation of mouse lung tissue pathology (HE staining)

[0172] 1) Freshly collected tissues were fixed with 4% paraformaldehyde for 24 h.

[0173] 2) After rinsing the fixed tissue with tap water overnight, the tissue was treated with 50% ethanol for 1 hour, 70% ethanol for 1 hour, 80% ethanol for 1 hour, 95% ethanol for 30 minutes, 100% ethanol I for 30 minutes, and 100% ethanol II for 30 minutes to complete the gradient dehydration process. After dehydration, the tissue was immersed in a solution of 50% ethanol and 50% xylene for 30 minutes, followed by an additional immersion in pure xylene for 30 minutes. Wax impregnation was initiated when the tissue became transparent.

[0174] 3) Melt the paraffin in an oven in advance, soak it in 1 / 2 xylene + 1 / 2 paraffin for 1.5 hours, and then transfer it to pure paraffin and soak it for 1.5 hours. Open the embedding device in advance and preheat it. Place the metal mold and the matching embedding box in a constant temperature wax bath for temperature balance. After it reaches the predetermined temperature, move the metal mold under the wax injection port. Briefly press the wax plate to release an appropriate amount of liquid paraffin, and control the injection volume so that the liquid level is slightly higher than the sample surface. Then remove the embedding box from the preheating area and accurately position the sample in the center area of ​​the mold. During the operation, keep the cross section of the sample parallel to the embedding plane.

[0175] 4) After the wax block cools, trim it to expose the target tissue and secure it to the microtome. Use the control interface to precisely calibrate the spatial relationship between the sample and the microtome. Perform continuous sectioning using the rotary sample feeder, setting the slice thickness to 5 μm. Use a brush to gently transfer the sliced ​​wax slide to the slide spreader, set the water temperature to 40°C, and observe that the tissue spread is flat, wrinkle-free, and free of scatter. Tilt the slide slightly to remove any water and allow it to air dry at room temperature.

[0176] 5) Dewax the sections twice in xylene solution for 5-10 minutes each time. Rehydrate with graded ethanol (100%, 95%, 85%, 75%) for 3 minutes at each concentration, and then soak in distilled water for 2 minutes. Transfer the sections to hematoxylin solution for nuclear staining. After staining for 5 minutes, rinse with deionized water to remove any free staining material. Treat with differentiation solution for 1 minute, and rinse twice in tap water for 5 minutes each. Immerse in eosin solution for cytoplasmic staining for 2 minutes. After removing the stain, perform accelerated dehydration.

[0177] 6) Dehydration, transparentization, and mounting: Immerse in 75% ethanol, 85% ethanol, 95% ethanol, and 100% ethanol (I) for 10 seconds each; soak in 100% ethanol (II) for 1 minute. Transparentize twice in xylene for 1 minute each, and permanently mount with neutral optical resin.

[0178] 7) Microscopic examination, image acquisition and analysis.

[0179] The test results of each group of mice are as follows Figure 13As shown in the results, the alveolar structure in the normal, vancomycin, and high-dose bamipine groups was clearly visible, presenting as thin-walled cysts of uniform size lined by a single layer of squamous epithelial cells with oblate, darkly stained nuclei, adherent to the basement membrane. The alveolar cavities were empty and reticular, with occasional small amounts of light pink proteinaceous fluid. The alveolar septa were rich in capillaries, with dilated lumens, flattened endothelial cells, and orange-red red red red blood cells. Interstitial connective tissue was minimal, with scattered fibroblasts and elastic fibers, which stained lighter. The bronchial mucosa was composed of pseudostratified ciliated columnar epithelium with neatly arranged nuclei and a dark pink brush border of ciliary layers. The bronchioles had thin walls, a circular smooth muscle layer, and eosinophilic cytoplasm. The overall structure was clearly layered, with no inflammatory cell infiltration or tissue structural disruption, demonstrating the normal function of lung tissue for air and blood exchange. Compared with the normal group, the model group showed alveolar rupture, a small amount of red blood cells in the alveolar cavity, moderate inflammatory cell infiltration, alveolar septum rupture, pale alveolar staining, necrosis, a small amount of pigment deposition, and alveolar wall thickening. The low-dose bamastatin group showed alveolar rupture, a large amount of red blood cells in the alveolar cavity, moderate inflammatory cell infiltration, alveolar septum rupture, and microthrombosis. The high-dose bamastatin group showed mild inflammatory cell infiltration, alveolar wall thickening, and microthrombosis.

[0180] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should all be covered by the scope of the claims of the present invention.

Claims

1. Use of bamipine or its salt in non-therapeutic treatment of methicillin-resistant Staphylococcus aureus.

2. The use according to claim 1, characterized in that The effective inhibitory concentration of bamipine or its salt against methicillin-resistant Staphylococcus aureus is ≥500 μg / mL.

3. The use according to claim 1, characterized in that The effective bactericidal concentration of bamipine or its salt against methicillin-resistant Staphylococcus aureus is ≥1000 μg / mL.

4. The use according to any one of claims 1 to 3, characterized in that Bamipine or its salt has one or more of the following functions: (A1) Bamipine or its salt has the function of increasing the permeability of the cell wall structure of methicillin-resistant Staphylococcus aureus; (B1) Bamipine or its salt has the function of damaging the cell membrane of methicillin-resistant Staphylococcus aureus; (C1) Bamipine or its salt has the function of destroying the extracellular barrier structure and intracellular homeostasis system of methicillin-resistant Staphylococcus aureus; (D1) Bamipine or its salt has the function of inhibiting ATP synthesis in methicillin-resistant Staphylococcus aureus cells; (E1) Bamipine or its salt has the function of inhibiting the formation of biofilm structure of methicillin-resistant Staphylococcus aureus; (F1) Bamipine or its salt has the function of promoting the expression of the mecA gene.

5. Use of bamipine or its salt in preparing a medicament for treating a disease, wherein the disease is methicillin-resistant Staphylococcus aureus infection.

6. The use according to claim 5, characterized in that The disease is anemia or inflammation.

7. The use according to claim 5 or 6, characterized in that Bamipine or its salt has one or more of the following functions: (A2) Bamipine or its salt has the function of reducing the load of methicillin-resistant Staphylococcus aureus in the blood; (B2) Bamipine or its salt has the function of reducing the load of methicillin-resistant Staphylococcus aureus in organs.

8. The use according to claim 5 or 6, characterized in that The drug is available in tablets, powders, injections, oral solutions, sprays, patches, or ointments.

9. The use according to claims 1, 2, 3 and 5, characterized in that: Palmatine salt is the hydrochloride salt.

Citation Information

Patent Citations

  • Application, preparation and preparation method of synthetic palmatine

    CN101804054A

  • Berberine type picolinic acid quaternary ammonium salt compound and application thereof in preparing medicine

    CN115073447A

  • New application of palmatine or salt and derivative thereof and drug combination of palmatine or salt and derivative thereof and antibacterial drug

    CN118340777A

  • Pharmaceutical composition and application thereof in preparation of medicine for inhibiting methicillin-resistant staphylococcus aureus

    CN118453714A

  • Traditional Chinese medicine composition for treating aplastic anemia and application thereof

    CN120501796A