Litchi disease-resistant gene LcEXP1 and application thereof

Abstract

The invention discloses a litchi disease-resistant gene LcEXP1 and an application thereof. The litchi disease-resistant gene LcEXP1 is separated from litchis, the full-length cDNA (complementary deoxyribonucleic acid) of the gene is 750bp, and the encoded protein is an expansion protein with the full length consisting of 250 amino acids. The litchi disease resistance related gene LcEXP1 is transiently expressed in tobacco, different tobacco leaves are inoculated with phytophthora capsici and alternaria alternata after two days, it can be observed that after expression of the LcEXP1, scabs are remarkably reduced compared with negative control, and biostatistical analysis shows that the areas of the two treated scabs are remarkably different. Therefore, the gene can effectively promote the disease resistance of plants such as tobacco and the like, and has a wide application prospect in developing products for improving the disease resistance of the plants.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a litchi disease-resistant gene LcEXP1 and applications thereof. Background Art

[0002] Litchi (Litchi chinensis) is a fruit tree widely distributed in tropical and subtropical regions of my country. Its planting range includes Guangdong, Guangxi, Hainan, Fujian, Yunnan, Sichuan and other regions. In 2023, the planted area of ​​lychee in my country was about 7.9012 million mu, with an output of about 3.2943 million tons. It is one of the important economic forest and horticultural fruit trees in my country. In addition to being affected by climatic conditions, litchi production is also greatly hindered by litchi diseases such as litchi frost blight. However, there are currently no litchi varieties that are highly resistant to litchi diseases. The prevention and control of litchi frost blight and other diseases still relies on agricultural control and chemical control, as well as some biological control methods. The identification of litchi disease-resistant genes and their application and transformation can provide more resources for litchi disease prevention and control.

[0003] During plant growth, cells secrete a protein called expansin. This protein weakens the cell wall polysaccharide network, inducing stress relaxation and extension of the detached cell wall in a pH-dependent manner, allowing the cell to increase in volume under the influence of turgor pressure. Expansin has been identified as playing an important role in plant growth and abiotic stress. Using an Agrobacterium-mediated transient expression system and inoculating pathogens allows direct assessment of whether the protein induces plant disease resistance. Summary of the Invention

[0004] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a litchi disease-resistant gene LcEXP1.

[0005] Another object of the present invention is to provide an application of the litchi disease-resistant gene LcEXP1.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A litchi disease resistance gene LcEXP1, whose nucleotide sequence is at least one of the following:

[0008] (a) the nucleotide sequence shown in SEQ ID NO. 2;

[0009] (b) Analogs of the nucleotide sequence in (a) above obtained by base insertion, deletion, or substitution that still have the function of improving plant disease resistance.

[0010] The above-mentioned litchi disease resistance gene LcEXP1 can improve the disease resistance of tobacco; preferably, it can improve the ability of tobacco to resist Phytophthora capsici and / or Alternaria alternata.

[0011] A litchi disease resistance protein LcEXP1, which is at least one of the following:

[0012] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO.1;

[0013] (b) An analogue of the amino acid sequence shown in SEQ ID NO: 1 obtained by replacing, inserting or deleting one or more amino acids and still having the function of improving plant disease resistance.

[0014] The nucleotide sequence of the gene encoding the above-mentioned litchi disease resistance protein LcEXP1 is obtained according to the codon coding rules.

[0015] A litchi disease-resistant gene LcEXP1 expression vector comprises the nucleotide sequence shown in SEQ ID NO.2.

[0016] The vector skeleton of the litchi disease-resistant gene LcEXP1 expression vector is pBin-RFP.

[0017] Application of the above-mentioned litchi disease resistance gene LcEXP1, litchi disease resistance protein LcEXP1, and litchi disease resistance gene LcEXP1 expression vector in improving tobacco disease resistance.

[0018] Application of the above-mentioned litchi disease-resistant gene LcEXP1, litchi disease-resistant protein LcEXP1, and litchi disease-resistant gene LcEXP1 expression vector in the preparation of plant disease-resistant drugs.

[0019] The disease resistance is the ability to resist Phytophthora capsici and / or Alternaria alternata.

[0020] The present invention has the following advantages and effects compared to the prior art:

[0021] (1) The litchi disease resistance-related gene LcEXP1 in the present invention is isolated from litchi. The full-length cDNA of the gene is 750 bp. The protein encoded by the gene is an expansion protein composed of 250 amino acids. The litchi disease resistance gene can be used in plant disease resistance breeding and the synthesis of new disease resistance genes, and is a disease-resistant material with great application value.

[0022] (2) The present invention transiently expressed the litchi disease resistance gene LcEXP1 in tobacco. Two days later, different tobacco leaves were inoculated with Phytophthora capsici and Alternaria alternata. Lesions were observed to be significantly smaller after LcEXP1 expression compared to the negative control, and biostatistical analysis showed a significant difference in lesion area between the two treatments. Therefore, this litchi disease resistance gene can be used in plant disease resistance breeding and the synthesis of new disease resistance genes, and is a highly valuable disease-resistant material. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a diagram showing the effects of expressing LcEXP1 and RFP on the infection of tobacco by Phytophthora capsici. The left side shows the effects of expressing LcEXP1 on the infection of tobacco by Phytophthora capsici; the right side shows the effects of expressing RFP on the infection of tobacco by Phytophthora capsici.

[0024] Figure 2 This is a statistical analysis chart of the lesion area of ​​tobacco infected by Phytophthora capsici. The statistical method used was paired T test, the error bars are standard errors, and * indicates significant differences (*P<0.05; **P<0.01).

[0025] Figure 3 This is a diagram showing the effects of expressing LcEXP1 and RFP on Alternaria infection of tobacco; the left side shows the effects of expressing LcEXP1 on Alternaria infection of tobacco; the right side shows the effects of expressing RFP on Alternaria infection of tobacco.

[0026] Figure 4 This is a statistical analysis chart of the lesion area of ​​tobacco infected by Alternaria alternata. The statistical method used was paired T test. The error bars are standard errors. * indicates significant differences (*P<0.05; **P<0.01). DETAILED DESCRIPTION

[0027] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0028] If specific experimental conditions are not specified in the following embodiments, conventional experimental conditions or those recommended by the reagent company will generally be used. Materials and reagents used were commercially available unless otherwise specified.

[0029] Example 1 Extraction of LcEXP1 gene and construction of expression vector

[0030] 1.1 Extraction of Litchi RNA and Obtaining cDNA of Target Gene

[0031] Place the sample to be ground in a mortar and pestle, add liquid nitrogen, and continue grinding. Add more liquid nitrogen before the liquid nitrogen vaporizes and continue grinding. Extract and purify RNA according to the kit's extraction and purification instructions. Perform genomic DNA cleanup and reverse transcription according to the Novozymes reverse transcriptase instructions to obtain reverse-transcribed cDNA.

[0032] 1.2 PCR amplification

[0033] By analyzing the litchi genome, we predicted that the litchi gene may encode LcEXP1. We designed primers (upstream primer LcEXP1-F and downstream primer LcEXP1-R) and successfully cloned the LcEXP1 gene from litchi cDNA. Its nucleotide sequence is shown in SEQ ID NO:2, and the amino acid sequence of its encoded protein is shown in SEQ ID NO:1.

[0034] Upstream primer LcEXP1-F:

[0035] ACGATAGCCGGTACCCCATGGCAATTGTTCTTAAG;

[0036] Downstream primer LcEXP1-R:

[0037] CTCGGAGGAGGCCATCCCAGTGAGCTGAATTTGAG.

[0038] The PCR program was as follows: 95°C, 3 min; 95°C, 15 sec; 57°C, 15 sec; 72°C, 90 sec; 34 cycles; 72°C, 5 min.

[0039] The PCR product was purified and separated by electrophoresis on a 1% agarose gel. The agarose gel containing the target fragment was excised and collected in a 2 mL centrifuge tube. The fragment was recovered using the Omega Gel Extraction Kit. Sequencing confirmed the gene fragment with sequence SEQ ID NO: 2.

[0040] 1.3 Construction of expression vector

[0041] The plant expression vector pBin-RFP was digested with restriction endonuclease SmaⅠ to linearize the vector. The digestion method was referred to the instruction manual. The digestion reaction conditions were incubation at 37°C for 15 min and inactivation at 80°C for 20 min.

[0042] Use the homologous recombination enzyme ClonExpress Ultra One Step Cloning Kit V2 to ligate the gene fragment obtained from the target gene cloning with the linearized vector. The ligation method is referred to the instruction manual. The recombination reaction conditions are 50°C for 5 min.

[0043] The recombinant plasmid pBin-RFP:LcEXP1 containing RFP red fluorescent protein was obtained. After propagation in Escherichia coli JM109 strain, the plasmid was extracted and sequenced. The sequencing confirmed that the pBin-RFP:LcEXP1 expression vector was correctly obtained.

[0044] Example 2 Transient Expression of LcEXP1 in Tobacco

[0045] 2.1 Preparation of Nicotiana benthamiana seedlings for testing

[0046] Nicotiana benthamiana seeds were stored in the laboratory and sown in a 26°C greenhouse. After incubation for 6 days, the seeds were transplanted into seedling cups with a side length of approximately 6 cm and a substrate ratio of vermiculite:peat soil = 3:2. The seeds were grown under conditions of 16 hours of light and 8 hours of darkness for about 25 days and used when their functional leaves matured.

[0047] 2.2 pBin-RFP: LcEXP1 expression vector transformed into Agrobacterium

[0048] A 1.5 mL centrifuge tube containing 100 μL of competent Agrobacterium GV3101 was placed on ice for freeze-thaw. 5 μL of the recombinant plasmid was added, gently flicked to mix, and then placed on ice for 30 minutes. After the ice bath, the tube was placed in liquid nitrogen for 5 minutes, followed by a 37°C water bath for 5 minutes. After the water bath, the tube was placed on ice for 2 minutes. Approximately 700 μL of liquid LB medium was added and cultured at 28°C at 180 rpm for 3 hours. The cultured Agrobacterium was centrifuged at 4000 rpm for 4 minutes, and the supernatant was discarded. 100 μL of the culture solution was then spread onto a solid LB plate containing a final concentration of 100 μg / mL kanamycin and 50 μg / mL rifampicin. The plate was incubated at 28°C for 2 days. Single colonies were selected for colony PCR to identify positive clones.

[0049] 2.3 Transient expression of LcEXP1 protein in Nicotiana benthamiana

[0050] Transfer a single colony of Agrobacterium containing the pBin-RFP plasmid and the recombinant plasmid prepared in 2.1 to 2 mL of LB liquid medium containing kanamycin (50 μg / mL) and culture at 180 rpm at 28°C for 1-2 days. Use an Agrobacterium containing the RFP control vector as a control. Collect the cells by centrifugation at 4000 rpm for 4 minutes. Gently pellet the cells with pre-chilled MgCl₂ and centrifuge at 4000 rpm for 4 minutes. Repeat three times. Adjust the OD value of the culture to 0.4-0.6 with MgCl₂ before injecting each strain into tobacco leaves, injecting half of each leaf with both Agrobacterium strains.

[0051] 2.4 Pepper Phytophthora infection experiment

[0052] Phytophthora capsici strain LT263 was maintained by the Tropical and Subtropical Fungi Laboratory of South China Agricultural University (this strain has been published in the literature, see Cui C, Herlihy JH, Bombarely A, McDowell JM, Haak DC. Draft Assembly of Phytophthora capsici from Long-Read Sequencing Uncovers Complexity. Mol Plant Microbe Interact. 2019 Dec; 32(12): 1559-1563. doi: 10.1094 / MPMI-04-19-0103-TA. Epub 2019 Oct). 16.PMID:31479390.), culture on carrot medium at 28°C for 5 days, and then use a 5mm punch to punch out bacterial cakes for later use; 2 days after the tobacco leaves were injected in 2.3, cut the leaves and inoculate the pepper phytophthora cake mycelium side down on the back of the tobacco leaves, inoculating one cake on each side of the leaf at the same position, and place them in a plastic box to keep them moist.

[0053] Wait 2 days after inoculation and observe the size of pepper lesions under ultraviolet light. Figures 1 and 2 As shown, it can be observed that the infected lesions of tobacco leaves transformed with pBin-RFP:LcEXP1 are significantly smaller than those of the negative control transformed with pBin-RFP. Biostatistical analysis shows that the lesion area of ​​the LcEXP1-expressing treatment is significantly different.

[0054] 2.5 Alternaria infection experiment

[0055] Alternaria alternata was preserved by the Tropical and Subtropical Fungi Research Laboratory of South China Agricultural University. This strain has been published in the literature, see Zhong J, Situ J, He c, et al. Avirulent milRNA of Fusarium oxysporum f.sp.cubense impairs plant resistance by targeting bananaAP22 transcription factor coding gene MaPl6LJ]. Horticulture Research, 2025, 12(4). After culturing on PDA medium at 28°C for 7 days, a 5mm punch was used to punch out a bacterial cake for later use. The experiment was carried out according to the experimental steps in 2.4, except that the pepper phytophthora cake was replaced with the alternaria cake.

[0056] After inoculation, wait for 2 days and observe the size of the infected lesions of Alternaria under ultraviolet light. Figures 3 and 4 As shown, it can be observed that the infected lesions of tobacco leaves transformed with pBin-RFP:LcEXP1 are significantly smaller than those of the negative control transformed with pBin-RFP. Biostatistical analysis shows that the lesion area of ​​the LcEXP1-expressing treatment is significantly different.

[0057] In summary, it can be seen that after the litchi disease-resistant gene LcEXP1 is constructed into a vector and transferred into tobacco through Agrobacterium, it can improve its ability to resist infection by pepper phytophthora and alternaria, proving that this gene can effectively promote the disease resistance of plants such as tobacco, and has broad application prospects in the development of products that improve plant disease resistance.

[0058] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A litchi disease resistance gene LcEXP1, characterized by: The nucleotide sequence of the litchi disease-resistant gene LcEXP1 is shown in SEQ ID NO.

2.

2. The litchi disease-resistant gene LcEXP1 according to claim 1, characterized in that: The litchi disease-resistant gene LcEXP1 can improve the disease resistance of tobacco.

3. A litchi disease resistance protein LcEXP1, characterized by: The amino acid sequence of the litchi disease resistance protein LcEXP1 is shown in SEQ ID NO.

1.

4. The litchi disease resistance protein LcEXP1 according to claim 3, characterized in that: The nucleotide sequence of the litchi disease resistance protein LcEXP1 encoding gene is obtained according to the codon encoding rules.

5. An expression vector for the litchi disease-resistant gene LcEXP1, characterized by: It includes the nucleotide sequence shown in SEQ ID NO.

2.

6. The expression vector according to claim 5, characterized in that: The vector skeleton of the litchi disease-resistant gene LcEXP1 expression vector is pBin-RFP.

7. Use of the litchi disease resistance gene LcEXP1 according to claims 1-2, the litchi disease resistance protein LcEXP1 according to claims 3-4, and the litchi disease resistance gene LcEXP1 expression vector according to claims 5-6 in improving tobacco disease resistance.

8. Use of the litchi disease-resistant gene LcEXP1 according to claims 1-2, the litchi disease-resistant protein LcEXP1 according to claims 3-4, and the litchi disease-resistant gene LcEXP1 expression vector according to claims 5-6 in the preparation of plant disease-resistant drugs.

9. The use according to claim 7 or 8, characterized in that: The disease resistance is the ability to resist Phytophthora capsici and / or Alternaria alternata.

Images